Connecticut King Research Articles

Involvement of a LhMYB18 transcription factor in large anthocyanin spot formation on the flower tepals of the Asiatic hybrid lily (Lilium spp.) cultivar “Grand Cru”

Large variations in anthocyanin color patterns are observed in flowers, especially in those of floricultural crops; however, mechanisms responsible for the pattern development are not yet fully understood. The Asiatic hybrid lily (Lilium spp.) cultivar “Grand Cru” has developed large anthocyanin spots on the interior surfaces of flower tepals, and such pigmentation patterns are rarely observed in other lily cultivars; this study evaluated mechanisms regulating large spot formation. As the expression of anthocyanin biosynthesis genes was coordinated in Grand Cru tepals, the transcriptional regulation of these genes should be responsible for large spot formation. Although LhMYB12 (subgroup 6 R2R3-MYB) often regulates anthocyanin biosynthesis in Asiatic hybrid lily tepals, LhMYB12 was not expressed in Grand Cru. Instead, Grand Cru expressed LhMYB15like, LhMYB16, LhMYB17, and LhMYB18 (subgroup 6 R2R3-MYB) in tepals; among these, LhMYB18 was predominantly expressed in the red spot regions. Transient overexpression of both LhMYB18 and Lilium hybrid basic helix-loop-helix2 activated a lily dihydroflavonol 4-reductase gene promoter in tobacco leaves. Segregation of spot appearance and LhMYB18 expression in the F1 population derived from crosses between Grand Cru and “Connecticut King,” the latter was a cultivar without spots, showed that anthocyanin spots appeared in approximately one-quarter of the F1 plants, and that high LhMYB18 expression was indispensable for spot formation. Thus, LhMYB18 is responsible for large spot formation. Results of the segregation analysis also indicate the involvement of an unidentified gene, which should affect the LhMYB18 expression, in spot development. These findings will advance the understanding of mechanisms regulating pattern development.

First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States.

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription-polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV.

Elucidation of intergenomic recombination and chromosome translocation: meiotic evidence from interspecific hybrids of Lilium through GISH analysis

Intergenomic exchange has been found to be a normal phenomenon in sexual polyploids. In order to distinguish whether such exchanges are derived from intergenomic recombination or translocation, 13 genotypes of an interspecific hybrid, which were previously used as parents to generate sexual polyploids, were selected for a detailed meiosis analysis. In all genotypes under study, variable numbers of bivalents (0–12) resulting from homoeologous pairing were observed. But in two genotypes (006001-6 and 006001-13), a multivalent which was either a quadri- or a trivalent, as well as a bivalent involving two Asiatic chromosomes, was observed. Two Asiatic chromosomes in 006001-6 which were non-homologous were always found to be associated together, and formed trivalent or quadrivalent with chromosomes from homoeologous genome. This indicated that there was a duplication between these two Asiatic chromosomes. Such a duplication might have resulted from the segregation of a chromosomal translocation between two non-homologous chromosomes in the Asiatic parent ‘Connecticut King’ which was transmitted to the progeny (006001-6). With the exception of two genotypes, in 11 genotypes that formed variable frequencies of bivalents, the homoeologous chromosome pairing and chiasma formation were similar to that between homologous chromosomes. After from the analysis of anaphase I stages it was evident that the expected types of chiasma formation involving non-sister chromatids gave rise to two strand single, two strand double, three strand double, four strand double and multiple exchanges. Whereas these events resulted from locus specific homoeologous exchanges, the translocations resulted from an aberrant form of non-homologous chromosomal exchange of segments. Elucidation of such differences is only possible through the analysis of meiosis using GISH.

Genetic mapping in Lilium: mapping of major genes and quantitative trait loci for several ornamental traits and disease resistances

With 1 figure and 3 tables AbstractConstruction of genetic linkage maps for lily was achieved using two populations, LA and AA that share one parent ‘Connecticut King’. Three different molecular marker systems (AFLP™, DArT and NBS profiling) were used in generating linkage maps for ‘Connecticut King’. The LA and the AA populations consist of 20 and 21 linkage groups (LGs), respectively. Average density between markers was 3.9 cM for the LA and 5 cM for the AA population. Several horticultural traits were mapped for the first time in Lilium and showed to be single gene based. We propose to name these genes as LFCc for flower colour, lfs for flower spots, LSC for stem colour, lal for antherless phenotype and lfd for flower direction whereby upper and lower case names refer to dominant and recessive genes, respectively. Additionally, resistance to Lily mottle virus (LMoV) was mapped as a locus on LG AA10. For Fusarium resistance, the Kruskal–Wallis test identified six putative quantitative trait loci (QTL) in the AA population of which one QTL (explaining 25% of the variation in resistance) could be confirmed by interval mapping.

NUTRIENT CONCENTRATIONS OF PLANT TISSUES OF GREENHOUSE CROPS AS AFFECTED BY THE EC OF THE EXTERNAL NUTRIENT SOLUTION

NUTRIENT CONCENTRATIONS OF PLANT TISSUES OF GREENHOUSE CROPS AS AFFECTED BY THE EC OF THE EXTERNAL NUTRIENT SOLUTION

Effect of Methyl Jasmonate on Morphology and Dormancy Development in Lily Bulblets Regenerated In Vitro

Scales of lily bulbs are swollen petioles. Lily scale fragments cultured in vitro regenerate bulblets consisting of scales that may or may not carry a leaf blade. The bulblets are dormant and require a cold treatment to sprout. We added the gaseous plant growth regulator methyl jasmonic acid (MeJA) in the headspace of the tissue-culture container and studied the effect on plantlet morphology (scale/leaf-blade formation) and dormancy development in three lilies, Lilium speciosum “Rubrum No. 10,” L. longiflorum “Snow Queen,” and the Asiatic hybrid “Connecticut King.” Methyl jasmonic acid strongly reduced leaf-blade formation in Lilium longiflorum and Connecticut King. This was a specific effect as scale formation was affected much less. The specific inhibition of leaf-blade formation was not observed in Lilium speciosum. In this lily, high concentrations of methyl jasmonic acid (MeJA) inhibited leaf-blade and scale formation to similar extents. Methyl jasmonic acid reduced dormancy development in all three lilies, with the largest effect observed in Connecticut King. In this Asiatic hybrid, almost all bulblets that had regenerated at 300 or 1000 μl l−1 MeJA in the headspace, did not require a dormancy-breaking treatment to achieve sprouting after planting in soil. Previously, it has been found in lily that treatments that reduce leaf-blade formation promote dormancy development. The present findings with MeJA do not agree with this. In the three lilies, the various parameters that were studied—regeneration, scale weight, leaf-blade weight, and dormancy development—were very differently affected by MeJA.

DISTANT HYBRIDS AND THEIR VERIFICATION BY MEANS OF RAPD

In Poland, apart from Oriental lilies, Lilium longiflorum and its Asiatic hybrids, have become very popular. As a result of interspecific and intergroup hybridization, progeny plants may not always be hybrids. Embryos may be formed via apomixis and such seedlings contain the genetic material of the maternal form. Because apomixis can occur in Lilium regale, L. longiflorum, L. superbum and L. pumilum, confirmation that the obtained seedlings are hybrids is required. Studies identifying hybrids, based on DNA analysis began in the 1980’s. Molecular techniques, with the most popular one – RAPD, are used for identification. As a result of crossing Lilium longiflorum with ‘Connecticut King’, which is an Asiatic hybrid, progeny plants were obtained using embryo isolation method. The confirmation of their hybrid status was performed by RAPD, analysing DNA genotypes of two parental forms and six progeny plants. DNA was isolated from the leaves of young lilies growing in the greenhouse and 11 primers of 10-nucleotide sequences chosen at random, from LA pr 1 to LA pr 11 were used. Amplified markers by RAPD were separated on agar gel and visualized in UV light in the presence of ethidium bromide. Among evaluated genotypes five turned out to be hybrids and one had the same genotype as the maternal plant.

Mapping of quantitative trait loci for carotenoid pigmentation in flower tepals of Asiatic hybrid lily

Flower pigmentation is one of the most important traits for ornamental plants. To clarify the genetic basis for carotenoid pigmentation in flower tepals of Asiatic hybrid lily ( Lilium sp.), we evaluated the segregation of a tepal-carotenoid content among F 1 plants derived from a cross between ‘Montreux’ (having a small amount of carotenoids) and ‘Connecticut King’ (having a large amount of carotenoids), and mapped genetic loci for the carotenoid pigmentation onto the molecular linkage maps of ‘Montreux’ and ‘Connecticut King’ that we constructed previously. The tepal-carotenoid content among the F 1 plants showed continuous segregation, indicating that several genes are associated with this trait. Quantitative trait loci (QTL) analysis identified one QTL, qCARmon6, on the sixth linkage group of the ‘Montreux’ map. qCARmon6 explained 58.2% of the total phenotypic variation, that is, this locus had a large effect on the carotenoid accumulation. The result that qCARmon6 was mapped on the linkage group of ‘Montreux’ which has a small amount of carotenoid pigments in tepals indicates that this locus has a dominant negative effect on carotenoid pigmentation.

THE RELATIONSHIP OF STORAGE AND VIABILITY OF LILY POLLEN

ISHS XXVI International Horticultural Congress: Asian Plants with Unique Horticultural Potential: Genetic Resources, Cultural Practices, and Utilization THE RELATIONSHIP OF STORAGE AND VIABILITY OF LILY POLLEN

Spatial and temporal expression of chalcone synthase and dihydroflavonol 4-reductase genes in the Asiatic hybrid lily

cDNA clones of three chalcone synthase (CHS) genes ( LhCHSA, LhCHSB and LhCHSC) and one dihydroflavonol 4-reductase (DFR) gene ( LhDFR) were isolated, and spatial and temporal expression of these genes was analyzed for two Asiatic hybrid lily cultivars, ‘Montreux’ (pink tepals with spots) and ‘Connecticut King’ (yellow tepals without spots). Pink tepals and tepal spots contain the same kind of anthocyanin, and yellow tepals have no anthocyanin. In both cultivars, the expression of all four genes was not detected in unpigmented leaves, stems and white bulbscales, but was detected in anthocyanin pigmentation-induced bulbscales, indicating that these genes are transcriptionally active in both cultivars. In flower organs, three CHS genes were expressed in anthocyanin-pigmented tepals, filaments and pistils of ‘Montreux’, and in unpigmented filaments and pistils of ‘Connecticut King’. Pigmented anthers accumulated only LhCHSC mRNA in both cultivars. LhDFR was abundantly expressed in pigmented tepals, anthers, filaments and pistils of ‘Montreux’, and in pigmented anthers of ‘Connecticut King’. These results indicate that different expression of these genes, especially of the LhDFR gene, controls the distinct pigmentation pattern in flower organs in both cultivars. In three F 1 plants with many spots on yellow or white tepals, derived from a cross between ‘Montreux’ and ‘Connecticut King’, anthocyanin accumulation in tepal spots was accompanied by the LhCHSA and LhDFR expression, indicating that the expression of CHS and DFR genes is independently controlled between tepals and tepal spots.

A genetic model for a pollenless trait in Asiatic hybrid lily and its utilization for breeding

Lilium cultivars that do not release pollen grains have been in demand since pollen grain stains are not easily removed from clothes. The author obtained one F 1 plant showing a pollenless phenotype (designated as a PL clone) from the cross between two Asiatic hybrid lily cultivars, ‘Montreux’ and ‘Geneva’. The PL clone showed short filaments with immature anthers and did not release pollen grains. The PL clone was crossed with four Asiatic hybrid lily cultivars, and segregation of plants with the pollenless phenotype among F 1 plants was investigated. All F 1 plants showed the pollenless phenotype when the PL clone was backcrossed with ‘Geneva’ and ‘Montreux’, suggesting cytoplasmic gene(s) is related to the pollenless trait. However, F 1 plants with pollen grains appeared from the crosses of the PL clone ב Connecticut King ’ and the PL clone ב Sancerre’ . From these results, a genetic model for the pollenless trait is proposed. F 1 plants showing the pollenless phenotype had shorter tepals than F 1 plants with pollen grains, indicating that pollenless genes reduce flower size directly or indirectly.

Production of seedlings from ovules excised at the zygote stage in Lilium spp.

The present study was undertaken to establish a culture system for ovules excised at the zygote stage in Lilium spp. Ovules of Lilium × `Connecticut King' and L. × `Enchantment' were excised together with placental tissue 3, 5, and 10 days after pollination (DAP) and cultured on B5 medium and half-strength B5 medium containing sucrose at different concentrations. In vitro embryo development in ovules cultured at 3 DAP was influenced by the basal media and the sucrose concentration. The half-strength B5 medium with 9% sucrose was the best condition, but only a few ovules isolated from placental tissue developed into seedlings. Application of embryo culture, in which embryos were excised from ovules after 14 weeks of ovule-with-plancetal-tissue culture, greatly improved the production of seedlings. The present study indicates that a two-step culture procedure, ovule-with-placental-tissue culture and embryo culture, make it possible to produce seedlings from ovules just after fertilization.

Isolation and characterization of gametic microprotoplasts from developing microspores of Lilium longiflorum for partial genome transfer in the Liliaceous ornamentals

We have established a system for isolating gametic microprotoplasts from developing microspores of Lilium longiflorum 'Hinomoto' (2n =2× =24) as a first step toward the production of intergeneric hybrid plants with one or a few alien chromosomes via microprotoplast fusion in the Liliaceous ornamentals. Anthers of this cultivar containing microsporocytes at mainly diakinesis to metaphase I were cultured for 3–4 days in a medium containing half-strength MS salts, double-strength MS vitamins, 1 g l–1 casamino acids, 100 g l–1 sucrose, and one of four spindle toxins: amiprophos-methyl, isopropyl N-(3-chlorophenyl)carbamate (CIPC), colchicine or propyzamide. Of the four spindle toxins examined, CIPC at concentrations of 5 or 10 µM efficiently induced micronucleation with the mean number of nuclei per meiocyte being 7.5. CIPC treatment also efficiently induced micronucleation in the other five Lilium genotypes evaluated (L. regale, L. longiflorum 'Georgia', L. speciosum 'Uchida', the Asiatic hybrid lily 'Connecticut King' and the Aurelian hybrid lily 'Golden Splendor') with the mean number of nuclei per meiocyte falling within the range 5.4–11.7. In 'Hinomoto', each meiocyte nucleus formed a microcell 4–5 days after initiation of CIPC treatment. Following isolation of such meiocytes from the anthers and their incubation in a cell-wall-digesting enzyme solution, gametic (micro)protoplasts of less than 10 µm, 10–20 µm and 20–50 µm in diameter were obtained with yields of 5.5×104, 6.6×104 and 4.9×104 per anther, respectively. Smaller microprotoplasts with DNA content below the 2C level, as indicated by flow cytometric analysis, were enriched by sequential filtration through nylon sieves of decreasing pore size (50, 20 and 10 µm). The relative fluorescence intensity in some of their nuclei corresponded to that of one or only a few chromosomes.

Genetic analysis of floral anthocyanin pigmentation traits in Asiatic hybrid lily using molecular linkage maps.

To understand the genetic background of two floral anthocyanin pigmentation traits, anthocyanin pigmentation in the flower tepals and spot formation, in the Asiatic hybrid lily (2n = 24), segregation of the two traits among 96 F(1) plants derived from a cross between commercial cultivars 'Montreux' and 'Connecticut King' were investigated. 'Montreux' has anthocyanin pigmentation in the tepals with many spots, and 'Connecticut King' has flowers with carotenoid pigmentation without spots. The F(1) plants with or without anthocyanin pigment in the tepals segregated with a 1:1 segregation ratio, indicating that a single gene controls anthocyanin pigmentation in the tepals. The number of spots per square centimeter of all tepals showed continuous distribution in the F(1) plants. To map the loci for the two anthocyanin pigmentation traits, molecular linkage maps in the Asiatic hybrid lily were constructed using a double pseudo-testcross strategy, with the same F(1) plants used for phenotypic evaluation, and 212 PCR-based DNA markers. The trait for anthocyanin pigmentation in tepals was used as a trait marker. The map of 'Montreux' comprised 95 markers in 26 linkage groups, and the map of 'Connecticut King' used 119 markers in 24 linkage groups. The total map lengths were 867.5 and 1,114.8 cM, respectively. The trait locus for anthocyanin pigmentation in the tepals was between markers ASR35-180 and P506-40 in linkage group 1 of the 'Montreux' map with a map distance of 1.2 cM and 2.6 cM, respectively. A single-point analysis of quantitative trait loci (QTLs) for tepal spot number identified two putative QTLs in linkage groups 1 and 19 of the 'Connecticut King' map. One putative QTL in linkage group 19 explained 64% of the total phenotypic variation. Because both putative QTLs were mapped on the linkage map of 'Connecticut King' that has no spots, dominant alleles of them might suppress spot formation.

PCR-based molecular markers in Asiatic hybrid lily

PCR-based DNA markers in Asiatic hybrid lily were examined. Random primers with various lengths (10-, 12-, 15- and 20-base) were tested in randomly amplified polymorphic DNA (RAPD) reactions with total DNA from two cultivars, ‘Montreux’ and ‘Connecticut King’. Thirty-three out of 61 (54%) 15-base primers and 14 out of 21 (67%) 20-base primers generated polymorphic fragments whereas 17 out of 145 (12%) and 4 out of 24 (17%) of the 10- and 12-base primers, respectively, amplified them. The efficiency of the RAPD reaction increased with increasing primer length. We examined inter-simple sequence repeat (ISSR) reactions using 3′-anchored simple sequence repeat (ASSR) primers, and found 33 out of 63 (52%) primers that amplified polymorphic bands between the two cultivars. We repeated all RAPD and ISSR reactions at least two times and obtained the same DNA fingerprints, indicating high reproducibility obtained with these reactions. All polymorphic fragments were inherited into their F 1 hybrids, indicating that these DNA markers are genetically stable.

MOLECULAR ASSISTED BREEDING FOR DISEASE RESISTANCE IN LILY

The Asiatic hybrid lily (Lilium L.) 'Connecticut King' harbours several beneficial traits such as partial resistance to Fusarium and complete resistance to tulip breaking virus (TBV). The variation in resistance to Fusarium was determined in four different greenhouse tests in four different years on the same 100 descendants of a backcross population. There was considerable variation in Fusarium resistance levels over the years. TBV resistance was determined and segregated, as expected, like a monogenic trait (1:1). In order to identify quantitative trait loci (QTLs) for Fusarium resistance and also to identify linked markers to the TBV resistance a QTL mapping approach was carried out in this backcross population. Segregation of 399 polymorphic AFLPTM (amplified fragment length polymorphism) fragments was determined. Two different enzyme combinations were used, PstI/MseI and EcoRI/MseI, in the latter one extra selective nucleotide was added to the MseI primer. A paternal ('Connecticut King') linkage map was calculated. This map consisted of 24 linkage groups (Lilium 2n=2x=24) with 251 markers covering 1367 cM. About 25␘f the markers remained unlinked. Four QTLs for Fusarium resistance mapped to linkage groups 1, 5, 13 and 16 respectively. The resistance gene for TBV was placed on linkage group

Frequency of Viable Seeds Obtained from Several Lilium spp. Cross-Pollinated at Different Floral Stages

To study the influences of the floral stage at the time of pollination on the production of viable seeds in Lilium spp., flower buds and flowers were cross-pollinated 1 and 3 days before anthesis (D -1 and D -3), at anthesis (D 0) and 1, 3 and 5 days after anthesis (D +1, D +3, and D +5). The optimum times of pollination for maximum seed production of each cross-combination were D -1, D 0 and D +1 in 'Enchantment'×L. maculatum, 'Enchantment'×'Connecticut King' and 'Georgia'×'Hinomoto', respectively. It was D 0, D +1 and D +3, respectively, for 'Connecticut King'× L. maculatum and 'Connecticut King'×'Enchantment'. In L. rubellum × L. speciosum 'Uchida' a few seeds were produced only when they were pollinated at D -3 and D +5. The viability of seeds obtained in four cross-combinations was estimated by a pattern of cumulative percentage germination of seeds for 30 days, cumulative percentage germination 30 days after sowing (PG), and mean days to germination (MDG). The results varied among cross-combinations and floral stages at pollination. Seeds, produced from pistils pollinated after anthesis, germinated more rapidly at the higher cumulative percentage than did those from pistils pollinated at and before anthesis. On the basis of these results on the yield of viable seeds and seed germination, we conclude that a large number of high quality seeds can be produced consistently between compatible cross-combinations of Lilium spp. when pistils are pollinated within a few day after anthesis

Indeterminate meiotic restitution (IMR): a novel type of meiotic nuclear restitution mechanism detected in interspecific lily hybrids by GISH

A detailed analysis of microsporogenesis was carried out in three diploid lily cultivars (2n=2x=24) and three diploid interspecific hybrids (2n=2x=24) using DNA in situ hybridisation methods (GISH and FISH). In cvs. Gelria (Lilium longiflorum; L genome), Connecticut King and Mont Blanc (both Asiatic hybrids; Agenome) meiosis was regular and only haploid gametes were formed while the three interspecific hybrids between L. longiflorum×Asiatic hybrid (LA) showed a variable frequency of meiotic nuclear restitution and stainable 2n-pollen formation ranging from 3% to 30%. An analysis of meiotic chromosome behaviour of the LA hybrids through GISH and FISH revealed that: (1) the parental chromosomes could be clearly discriminated into univalents, half-bivalents and bivalents in the PMCs; (2) in some of the PMCs the entire complement was present either as univalents or half-bivalents which had the potential to divide equationally (following centromere division) during the first division leading to first division restitution (FDR) gametes; (3) more frequently, however, in one and the same PMC the univalents and half-bivalents divided equationally whereas the bivalents disjoined reductionally at the same time giving rise to 2n-gametes that could vary from the well-known FDR or SDR 2n-gametes. We indicate this novel type of restitution mechanism as Indeterminate Meiotic Restitution (IMR). In order to confirm the occurrence of IMR gametes, the chromosome constitutions of eight triploid BC1 progenies derived from backcrossing the 2n-gamete producing the LAhybrids to the Asiatic hybrid parents were analysed through in situ hybridisation. The results indicated that there were seven BC1 plants in which FDR 2n-gametes, with or without homoeologous recombinations, were functional, whereas in one case the 2n-gamete resulting from IMR was functional. In the latter, there was evidence for the occurrence of genetic recombination through homoeologous crossing-over as well as through the assortment of homoeologous chromosomes. A singular feature of the IMR 2n-gamete was that although it transmitted a euploid number of 24 chromosomes to the BC1 progeny, the number of chromosomes transmitted from the two parental species was dissimilar: 9 L-genome chromosomes and 15 A-genome chromosomes instead of 12 of each.

PHYSIOLOGICAL MARKERS FOR LILY BULB MATURITY

The aim of this study was to find physiological markers for lily bulb maturity. This would provide a tool for the grower to determine the optimal time for lifting. The following physiological parameters were measured in daughter sprouts at two week intervals from week number 34 to 52: the abscisic acid (ABA) content, sucrose content, osmotic potential and respiratory activity. As experimental objects the cultivars Connecticut King (Asiatic hybrids; dormant at lifting), 'Star Gazer' (Oriental hybrids; dormant at lifting) and Snow Queen (longiflorums; non-dormant) were used. In each cultivar one or more parameters were found that changed considerably towards the moment of lifting. The most dramatic changes were observed in the parameters ABA- content, sucrose-content and osmotic potential in the cultivar Connecticut King'. The same trend was observed in Star Gazer', but to smaller extent. These results enable us to assess correlations of these parameters with the flower quality of the bulbs that were lifted at the same moments and stored below 0°C for flower production in the autumn of 1998. In 'Snow Queen only the sucrose content showed an increase with sprout development. Respiratory activity decreased towards the time of lifting in all cultivars. A correlation was found between the process of dormancy and the ABA content. Only in the dormant cultivars ('Connecticut King' and 'Star Gazer') the ABA content increased with sprout development and the increase in ABA level preceded the cessation in sprout growth.

Formation of Calli from Isolated Microscope Cultures of Asiatic Hybrid Lily 'Connecticut King'.

Calli from microspores were induced for the first time in Lilium species. The uninucleate microspores of the Asiatic hybrid lily 'Connecticut King' were isolated and cultured in liquid medium, containing half strength of MS macronutrients, full strength of micronutrients, Fe-EDTA and vitamins of MS, 100 mg·liter-1 cosamino acids, 500 mg·liter-1 glutamine, 1 mg·liter-1 picloram and 0.25 M sucrose or maltose. Microspore viability and development of cultured microspores were influenced by the carbohydrate sources in culture medium. A relatively high viability rate of microspores was observed in the maltose medium, compared with that of sucrose. Cell divisions of microspores and callus formation were found in the maltose medium, whereas in the sucrose medium, a large number of swollen microspores containing many starch grains remained undivided. Hence, maltose is the preferred carbohydrate source for microspore culture of 'Connecticut King'.