Congenital Neutropenia Patients Research Articles

Impact of different genetic mutations on granulocyte development and G-CSF responsiveness in congenital neutropenia

AbstractCongenital neutropenia (CN) is a genetic disorder characterized by persistent or intermittent low peripheral neutrophil counts, thus increasing susceptibility to bacterial and fungal infections. Various forms of CN, caused by distinct genetic mutations, exhibit differential responses to granulocyte colony–stimulating factor (G-CSF) therapy, with the underlying mechanisms not fully understood. This study presents an in-depth comparative analysis of clinical and immunological features in 5 CN patient groups (severe congenital neutropenia [SCN]1, SCN3, cyclic neutropenia [CyN], warts, hypogammaglobulinaemia, infections and myelokathexis [WHIM], and Shwachman-Bodian-Diamond Syndrome [SBDS]) associated with mutations in ELANE, HAX1, CXCR4, and SBDS genes. Our analysis led to the identification of 11 novel mutations in ELANE and 1 each in HAX1, CXCR4, and G6PC3 genes. Investigating bone marrow (BM) granulopoiesis and blood absolute neutrophil count after G-CSF treatment, we found that SCN1 and SCN3 presented with severe early-stage disruption between the promyelocyte and myelocyte, leading to a poor response to G-CSF. In contrast, CyN, affected at the late polymorphonuclear stage of neutrophil development, showed a strong G-CSF response. WHIM, displaying normal neutrophil development, responded robustly to G-CSF, whereas SBDS, with moderate disruption from the early myeloblast stage, exhibited a moderate response. Notably, SCN1 uniquely impeded neutrophil development, whereas SCN3, CyN, WHIM, and SBDS also affected eosinophils and basophils. In addition, SCN1, SCN3, and CyN presented with elevated serum immunoglobulins, increased BM plasma cells, and higher A Proliferation-Inducing Ligand levels. Our study reveals a strong correlation between the stage and severity of granulocyte development disruption and the efficacy of G-CSF therapy.

A Pipeline for Comparison and Selection of Clinically Applicable Gene Therapy Approaches for ELANE-Associated Severe Congenital Neutropenia

Several gene editing strategies for autosomal dominant ELANE-associated severe congenital neutropenia (CN) have been proposed. All strategies efficiently correct CN with different degrees of the investigated comprehensiveness of toxicity and off-target activity. The next step now is to select the best approach for clinical translation. The first-line awareness should consider not only the universal applicability of gene editing but, most importantly, its safety. Since CN patients have a high cumulative incidence of leukemogenic transformation and pre-leukemia cells in the patient's bone marrow are detected at an early age, safety considerations are of the utmost importance. We compared gene-editing methods head-to-head in CD34 + cells of two patients with hot-spot ELANE mutations associated with a poor response to G-CSF and high risk for leukemia development, p.A57V and p.G214V. We edited cells with the universal ELANE knockout targeting wild-type and mutant alleles in exon 2 ( uEKO). We also repaired the mutated ELANE by inducing a double-stranded break (DSB) at the position of mutation with the delivery of the WT ELANE template for homology-driven repair (HDR) by AAV6 ( HDR-AAV). We also tested the allele-specific knockout of the mutated allele ( ASKO) and the allele-specific HDR approach that relies on ssODNs to deliver the wild-type sequence for p.G214V mutation ( AS-HDR). We investigated the effects of gene editing on the survival and granulocytic differentiation of gene-edited cells as well as editing efficiency and patient-specific genome-wide off-target profiles. Cell survival was between 74 % and 95 % in all groups post-gene editing. For patient 1 with p.A57V mutation, we observed gene editing of 62 % in the control-AAVS1 locus, 70 % in uEKO, 76 % in ASKO, and 10.3 % HDR with an additional 49.5 % of KO in HDR-AAV. The editing led to a significant increase in differentiated neutrophils from 14.5 % in the control group to 57.4 %, 55.2 %, and 45.3 % in uEKO, ASKO and HDR-AAV groups, respectively. Gene editing also facilitated a significant increase in CFU-G and CFU-GM colonies for all treatment conditions, as compared to the control. For patient 2 with p.G214V mutation, we measured 86 % indels in control-AAVS1, 34.4 % in uEKO and 80.25 % in HDR-AAV. In the AS-HDR group, no HDR was observed, but 92 % of mutant alleles contained frameshift indels. The edits resulted in a significant increase in neutrophils in liquid culture differentiation from 13.6 % in the control AAVS1group to 53.7 %, 57.3 %, and 62.8 % in uEKO, HDR-AAV, and AS-HDR, respectively. CFU-G and CFU-GM colonies were also enhanced. To confirm if allele-specific frameshifts in exon 5 restored granulopoiesis, we utilized a patient-derived iPSC cell line with the p.G214R mutation. We applied ASKO gene editing to this iPSC line and achieved 24 % ASKO. The editing improved neutrophil differentiation significantly, from 2.4 % in unedited cells to 25.55 % in edited cells. CFU assays also showed a significant increase in CFU-G and CFU-GM numbers. To detect off-targets on the patient genotype, we established GUIDE-Seq in patient-derived iPSCs with mutations p.A57V (iCN1) and p.G214R (iCN2). In iCN1, we found 10 off-targets (OT) for the uEKO sgRNA and 3 OTs for the ASKOsgRNA. For iCN2, we found 3 OTs for the HDR-AAV and the AS-HDR guides. These findings show that allele-specific guides have better OT profiles than guides targeting both alleles. Taken together, all tested approaches have low toxicity and comparable efficacy in restoring granulopoiesis in vitro. We found that editing above 30 % efficiently restored granulopoiesis, providing evidence for the therapeutic threshold. This highlights that safety and genome toxicity considerations should guide further clinical translation. To enable clinically relevant off-target activity detection of gene-editing in the patient's genome, GUIDE-Seq in patient-derived iPSCs should be performed. Further, our observation that the introduction of allele-specific frameshift indels in exon 5 can inactivate CN-causing mutations is unexpected and warrants further investigation. Head-to-head comparison of the in vivo engraftment of CD34+ cells gene-edited using several approaches should also be performed in the future.

Heterogeneous Genetic Landscape of Chronic Idiopathic Neutropenia Revealed By Whole Exome Sequencing

Background: Adultpatients with persistent, unexplained neutropenia who do not fulfill the diagnostic criteria of any underlying disease are characterized as chronic idiopathic neutropenia (CIN) cases.It is an exclusion diagnosis that can be established after a thorough clinical/laboratory investigation for any underlying causes, including negative anti-neutrophil antibody testing, inconclusive bone marrow (BM) aspiration/biopsy and normal cytogenetics. CIN patients regardless of their absolute neutrophil counts (ANC) usually display a benign and uncomplicated clinical course. Although the pathogenesis of CIN remains largely unknown, we hypothesize that a constitutional/congenital background might exist, at least in some cases, that have potentially escaped diagnosis during childhood. Aim of the study: To investigate the genetic landscape of neutropenia in CIN by conducting whole exome sequencing (WES) analysis in a number of adult CIN patients. Methods: We have performed WES in 16 adult (median age 59 years, range 30-72 years) patients (11 females and 5 males) with CIN according to previously published criteria (Fioredda F, et al Hemasphere. 2023). The patients had median ANC 1.2 x 10 9/L (range 0.4-1.6 x 10 9/L) for prolonged period and unknown neutropenia onset in most cases. Genomic DNA was extracted from peripheral blood samples, coding fragment libraries were prepared, sequencing performed on Illumina NovaSeq 6000 System, and data subjected to an in-house pipeline for bioinformatic analysis for variant calling and annotations. Singleton analyses were performed focusing on genes associated with congenital defects of phagocytes, BM failure (BMF) and immune deficiency and dysregulation. Mean depth of coverage was 70x and the mean number of variants/sample was 22553. Results: WES analysis identified 10 pathogenic/likely pathogenic (P/LP) variants in 10 patients. The variants consisted of 4 frameshift mutations, 3 nonsense mutations, 1 missense mutation, 1 splice-site mutation and 1 splice-region mutation. Pathogenic variants in congenital neutropenia (CN)-related genes included only a heterozygous mutation in G6PC3:c.511C>T,p.Gln171Ter (previously detected in one of our CN patients; Nikolouzakis TK et al, Ann Hematol. 2022). Pathogenic variants in genes associated with BMF were detected in two genes, namely FANCM:c.1492C>T, p.Gln498Ter and CTC1:c.3058C>T,p.Gln1020Ter, respectively. The majority of the pathogenic variants were found in genes associated with immune deficiency and dysregulation. These involved: (i) a heterozygous mutation in DCLRE1C:c.1784dup,p.Ile596fs (associated with immunodeficiencies affecting cellular and humoral immunity); (ii) a LP mutation in ORAI1:c.132_133del,p. Arg45fs and a pathogenic variant in SPINK5:c.1302+4A>T (related to combined immunodeficiencies with associated or syndromic features); (iii) a pathogenic variant in MEFV:c.2080A>G, p.Met694Val and a LP variant in PSMG2:c.703-2A>T (both genes associated with autoinflammatory disorders); (iv) a LP variant in IRF7:c.1089dup,p.Pro364Alafs (associated with defects in intrinsic and innate immunity); and (v) a LP variant in PEPD:c.738_739insGT,p.Ser247fs (associated with immune dysregulation). Regarding variants of undetermined significance (VUS) an average of 4.5 VUS variants per patient were detected in genes related to CN ( HAX1, VPS13B, LYST), BMF ( GATA2, SAMD9, CXCR4) or immunodeficiency ( TCF3). However, none of these patients display clinical symptoms typical of these conditions. Specifically, the majority of the patients presented with mild/moderate neutropenia and rarely with severe neutropenia, they have relatively normal BM biopsies and do not display major symptoms or signs related to severe immunodeficiency or immune dysregulation syndromes. Conclusions: This study is the first attempt of WES analysis in adult CIN patients and shows that there is a heterogeneous genetic landscape underlying the disease. More studies are required so that the detected P/LP variants and VUS can be associated with the clinical phenotypes to more accurately interpret their potential contribution to the neutropenia phenotype.

Differential transcriptional control of hematopoiesis in congenital and cyclic neutropenia patients harboring ELANE mutations.

Mutations in the ELANE gene, encoding the neutrophil elastase (NE) protein, are responsible for most cyclic neutropenia (CyN) cases and approximately 25% of congenital neutropenia (CN) cases. In CN and in CyN, a median of 2.8% of CD34+ cells were early CD49f+ hematopoietic stem cells (eHSC) that did not express ELANE and thus escape from the unfolded protein response (UPR) caused by mutated NE. In CyN, the CD49f+ cells respond to granulocyte colony-stimulating factor (G-CSF) with a significant upregulation of the hematopoietic stem cell-specific transcription factors, C/EBPα, MLL1, HOXA9, MEIS1, and HLF during the ascending arm of the cycle, resulting in the differentiation of myeloid cells to mature neutrophils at the cycle peak. However, NE protein released by neutrophils at the cycle's peak caused a negative feedback loop on granulopoiesis through the proteolytic digestion of G-CSF. In contrast, in CN patients, CD49f+ cells failed to express mRNA levels of HSC-specific transcription factors mentioned above. Rescue of C/EBPα expression in CN restored granulopoiesis.

Accumulation of Specific Somatic Leukemia-Associated Mutations in Congenital Neutropenia Precedes Malignant Transformation - New Preconditions for Treatment Decisions

Severe congenital neutropenia (CN) and Shwachman-Diamond Syndrome (SBDS) are pre-leukemia bone marrow failure syndromes with a high cumulative incidence of developing MDS or AML. Clonal hematopoiesis (CH) due to nonsense mutations in the intracellular part of CSF3R or missense TP53 mutations has been reported previously in CN or SBDS patients, respectively. So far, studies of CH in CN were conducted by sequencing CSF3R only (Germeshausen et al., 2007, Klimiankou et al., 2019) or in ELANE-CN patients (Jun Xia et al., 2018). Precise characterization of the timeline and occurrence of somatic mutations found at the neutropenia, pre-leukemia or leukemia stage in CN is essential to make a timely and correct decision on the requirement of bone marrow transplantation prior to transformation to overt leukemia. We therefore aimed to assess the acquisition of somatic leukemia-associated mutations in a large number of genes in a worldwide largest and most representative cohort of CN patients. We performed error-corrected sequencing with fixed single-stranded unique molecular indexes (UMIs) on panel of 31 genes and "hotspot" regions in 340 genes reported to be mutated in de novo MDS/AML. We analyzed 146 CN patients representing most of genetic subtypes of CN, 21 SBDS patients, 29 CN patients who progressed to MDS or AML, and 18 healthy individuals. The median age of CN and SBDS patients was 13,73 and 10,5 years, respectively. For 53 CN patients, we collected sequential samples with a median observation time of 1,1 years. We found that the prevalence of CH with at least 1 somatic DNA lesions in CN group was 49,5 % which is much higher than in healthy individuals of the same age. The prevalence of CH with CSF3R mutations varied between 20 and 38 % in patients with genetic defects in ELANE (n = 75), HAX1 (n = 26), SRP54 (n = 8), JAGN1 (n = 6), and G6PC3 (n = 5). The percentage of CH positive cases without CSF3R mutations ranged between 12 % and 50 %. CN patients acquired somatic coding mutations most frequently in CSF3R (49 %) following by TP53 (4,1 %), ASXL1 (4,1 %), DNMT3A (2,1 %), TET2 (2,1 %), JAK2 (1,37 %), SETBP1 (1,37 %), ARID1B (1,37 %), GNAS (1,37 %), and ZRSR2 (1,37 %). Interestingly, in the SRP54-CN group, we found 1 patient with CSF3R mutation, 1 patient with TP53 mutations, and 1 patient with both mutations. Out of 3 CLPB-CN patients, 1 patient has CSF3R and 1 patient acquired TP53 mutations. High prevalence of CSF3R (67 %), RUNX1 (44 %), SETBP1 (22 %), ASXL1 (17 %), ZRSR2 (11 %), NPM1 (11 %) and PTPN11 (11 %) mutations was detected in CN patients with overt MDS/AML, arguing for a specific pathway which initiates and drives leukemic transformation in CN. Comparison of CN patients who later developed MDS/AML with MDS/AML-free CN cohort revealed enrichment of CSF3R (Fisher's exact test; OR 3,42; 95% CI, 1,27, - 9,36, p = 0,01), and ASXL1 (Fisher's exact test; OR 7,4; 95% CI, 0,93 - 59,16, p = 0,03) mutations. In contrast, RUNX1 and SETBP1 mutations were associated with overt MDS/AML in CN. These data argue that the acquisition of CSF3R and ASXL1 mutations are early events in CN leukemogenesis, whereas RUNX1 and SETBP1 mutations may have stronger leukemogenic potential and therefore are rarely found at the neutropenia stage. Moreover, mutation burden at the neutropenia stage in CN patients who later progressed to MDS/AML was significantly higher (p = 0.016, by Fisher's exact test), as compared to CN group who haven't developed leukemia so far. The number of mutations in samples prior AML/MDS was dependent on duration to overt AML/MDS with gradual accumulation of genetic lesions over time. CH was detected in 66,7 % of SBDS patients with a high prevalence of TP53 mutations (9 out of 14 patients with CH) followed by missense mutations in IDH1 (n = 1), FOXP1 (n = 1), and PTPN11 (n = 1). Our results are in line with previous publications about dominant role of TP53 mutation in SBDS patients. Prevalence of CH didn't differ between CN patients depending on G-CSF dose (median = 4,06 μg/kg/d) in two biggest CN cohorts harboring ELANE or HAX1 mutations. Taken together, CN per se contributes to high level of CH already in the young age, as compared to healthy population. Acquisition of multiple genetic lesions, especially RUNX1, SETBP1, ASXL1, TP53, PTPN11 in association with CSF3R mutation might be a strong indicator of the advanced pre-leukemia stage in CN patients at neutropenia stage and requires closer patient follow up.

Truncated CSF3 receptors induce pro-inflammatory responses in severe congenital neutropenia.

Severe congenital neutropenia (SCN) patients are prone to develop myelodysplastic syndrome (MDS) or acute myeloid leukaemia (AML). Leukaemic progression of SCN is associated with the early acquisition of CSF3R mutations in haematopoietic progenitor cells (HPCs), which truncate the colony-stimulating factor 3 receptor (CSF3R). These mutant clones may arise years before MDS/AML becomes overt. Introduction and activation of CSF3R truncation mutants in normal HPCs causes a clonally dominant myeloproliferative state in mice treated with CSF3. Paradoxically, in SCN patients receiving CSF3 therapy, clonal dominance of CSF3R mutant clones usually occurs only after the acquisition of additional mutations shortly before frank MDS or AML is diagnosed. To seek an explanation for this discrepancy, we introduced a patient-derived CSF3R-truncating mutation in ELANE-SCN and HAX1-SCN derived and control induced pluripotent stem cells and compared the CSF3 responses of HPCs generated from these lines. In contrast to CSF3R-mutant control HPCs, CSF3R-mutant HPCs from SCN patients do not show increased proliferation but display elevated levels of inflammatory signalling. Thus, activation of the truncated CSF3R in SCN-HPCs does not evoke clonal outgrowth but causes a sustained pro-inflammatory state, which has ramifications for how these CSF3R mutants contribute to the leukaemic transformation of SCN.

Heterogeneous genetic landscape of congenital neutropenia in Korean patients revealed by whole exome sequencing: genetic, phenotypic and histologic correlations

Congenital neutropenia (CN) is a hematological disease heterogeneous in its genetic, phenotypic and histologic aspects. We aimed to identify the genetic etiology of Korean CN patients in the context of bone marrow (BM) histology and clinical phenotype. Whole-exome sequencing (WES) or targeted sequencing was performed on the BM or peripheral blood specimens of 16 patients diagnosed with CN based on BM exam from 2009 to 2018. Absolute count of myeloperoxidase (MPO)-positive cells was calculated using ImageJ software. Semi-quantitation of MPO-positive cells in BM sections was performed by MPO grading (grades 0–3). Comprehensive retrospective review on real-world data of 345 pediatric patients with neutropenia including 16 patients in this study during the same period was performed. Seven disease-causing variants were identified in ELANE, G6PC3 and CXCR4 in 7 patients. A novel homozygous G6PC3 variant (K72fs) of which the mechanism was copy-neutral loss of heterozygosity was detected in two brothers. A low myeloid-to-erythroid ratio (0.5–1.5) was consistently observed in patients with ELANE mutations, while MPO-positive cells (40%–50%) with MPO grade 1 or 2 were detected in myelokathexis caused by G6PC3 and CXCR4 mutations. Meanwhile, disease-causing variants were detected in ELANE, TAZ and SLC37A4 in 5 patients by retrospective review of medical records. Our results suggest that following the immunological study and BM exam, WES or an expanded next generation sequencing panel that covers genes related to immunodeficiency and other inherited bone marrow failures as well as CN is recommended for neutropenia patient diagnosis.

Spectrum of Pathogenic Genetic Variants in a Large Cohort of North American Congenital and Cyclic Neutropenia Patients: A Report from the Severe Chronic Neutropenia International Registry

▪Severe congenital neutropenia (SCN) is characterized by persistent neutropenia and risk of invasive, life-threatening infection as well as transformation to hematopoietic malignancy. The closely related syndrome cyclic neutropenia is characterized by recurrent episodic neutropenia accompanied by symptoms including infection. Understanding the genetic etiology of congenital neutropenia can help to direct therapy, guide surveillance and health maintenance strategies, and contribute to our understanding of basic neutrophil biology. Although mutations in ELANE are the most frequent cause of congenital neutropenia, there is a wide and ever-growing list of additional causative variants. Additionally, there appears to be regional genetic variability. For example, mutations in HAX1 are rarely if ever observed in North America while they are more common in Europe. We undertook exome sequencing of a large cohort from the Severe Chronic Neutropenia International Registry (SCNIR) of North America in an effort to define the genetic spectrum of congenital neutropenia and aid in the discovery of new pathogenic variants.We expanded our previously reported study of whole exome sequencing to include 152 cases of chronic neutropenia, comprised of 94 cases of SCN and 58 cases of cyclic neutropenia. We selected cases in which ELANE testing was negative, or in a small minority of cases, where ELANE testing had not yet been performed. Indeed, exome sequencing only identified 7 cases (5 SCN and 2 cyclic) carrying pathogenic ELANE mutations in this cohort. In the remaining 145 cases, we analyzed exomes for the presence of variants in genes previously associated with congenital neutropenia including AK2, AP3B1, CD40LG, CLPB, CSF3R, CXCR2, CXCR4, DNAJC21, DNM2, DOCK2, EFL1, EIF2AK3, ELANE, G6PC3, GATA1, GATA2, GFI1, GINS1, HAX1, IRAK4, JAGN1, KAT6A, KRAS, LAMTOR2, LYST, MYD88, PGM3, PSTPIP1, RAB27A, RAC2, SBDS, SEC61A1, SLC37A4, SMARCD2, SRP54, STK4, TAZ, TCIRG1, TCN2, TLR8, USB1, VPS13B, VPS45, WAS, WDR1 and WIPF1. Pathogenic heterozygous mutations of CLPB that localize to the ATP-binding pocket were identified in 7 cases, making it the second most common cause of congenital neutropenia in North America. We additionally identified 4 cases with G6PC3 pathogenic variants, and one case each with pathogenic variants in JAGN1, CXCR4 (the cause of WHIM syndrome), germline homozygous CSF3R, and GFI1.Interestingly, we identify 2 unrelated individuals (one with SCN and one with cyclic) and 2 siblings with SCN all of whom possess a recently described heterozygous variant in SRP54 (p.T117del). We collected genomic DNA from the affected mother of the 2 siblings, an additional unaffected sibling, and the unaffected grandparents. Through this kinship, we can confirm the de novo appearance of this variant in the second generation and demonstrate that it tracks with disease status (Figure 1). We also identified 2 unrelated individuals with SRP54 variants affecting residue 175 also located within the GTPase domain (p.G175E or p.G175del). Both variants are absent from the gnomAD database, and studies are underway to demonstrate de novo acquisition.In summary, we have defined the spectrum of mutations present in ELANE-wildtype chronic neutropenia cases in North America. Pathogenic or likely pathogenic variants were identified in 26 out of 145 (18%) cases. The most frequently mutated genes were of CLPB, SRP54, and G6PC3, while mutations in HAX1 were not seen. Importantly, some of these mutations are associated with genetic syndromes with extra-hematopoietic findings (for example, CLPB and SRP54) that would warrant additional evaluations and targeted health maintenance. These findings emphasize the importance of sending large panels for genotyping, rather than targeted ELANE testing. [Display omitted] DisclosuresBolyard: X4 Pharmaceuticals: Research Funding. Makaryan: Emendo Biotherapeutic: Research Funding. Dale: X4 Pharmaceuticals: Consultancy, Honoraria, Research Funding.

Establishment of the Safe and Efficient CRISPR/Cas9-RNP Based Gene-Correction Platform of ELANE Mutations in iPSCs of Severe Congenital Neutropenia (CN) Patients with No Response to G-CSF and High Risk to Develop Leukemia

Severe congenital neutropenia (CN) is a monogenic pre-leukemia bone marrow failure syndrome characterized by an absolute neutrophil count (ANC) below 500 cells per microliter and recurrent, life-threatening bacterial infections. Treatment with recombinant human granulocyte colony-stimulating factor (rhG-CSF) increases ANC in the majority of CN patients and dramatically improves the quality of life. However, some CN patients do not respond or respond only poorly to G-CSF and should be treated by bone marrow transplantation (BMT). In some cases, “G-CSF no-responder” CN patients fail to engraft bone marrow transplant and no therapeutic options for these patients remain. Therefore, establishment of the alternative therapeutic approaches for these patients is indispensable.Many underlying genetic defects have been identified in CN. Autosomal dominant ELANE mutations have been identified in a majority of CN patient. Some ELANE mutations (e.g. p.A57V, p.C151Y, p.G214ter) are associated with no response or poor response to G-CSF therapy or high frequency of leukemia development.In the present study, we established a DNA- and virus-free clinical-grade gene correction approach of these phenotypically severe ELANE mutations in induced pluripotent stem cells (iPSCs) of CN patients using CRISPR/Cas9-based technology. We used ribonucleoprotein (RNP) form of CRISPR Cas9 as a safe tool to correct ELANE mutations. For this, we generated and characterized iPSCs from ELANE -CN patients harboring p.C151Y and p.G214ter ELANE mutations. We used embryoid body (EB)-based hematopoietic differentiation method to evaluate granulocytic differentiation of CN-patients specific iPSCs. Granulocytic differentiation was studied by absolute live cell counts, FACS analysis of myeloid-specific surface markers expression levels, CFU assay, cell morphology of cytospin preparations and nitroblue tetrazolium (NBT) assay. We found markedly diminished granulocytic differentiation of ELANE -CN iPSCs (ELANE mutations p.C151Y and p.G214ter), as compared to healthy individuals. We designed and generated repair templates and specific Crispr-RNA (crRNA) for the fourth (GGGACGCCGCCTGGGCAACG) and fifth (GGACGAAGGAGGCAATTTCG) exons of ELANE for correction of mutations p.C151Y and p.G214R, respectively and made efficient Crispr-Cas9 Ribonucleoprotein (RNP) complexes to edit the mutations along with ssODN repair templates.We further established gentle and efficient transfection of iPSCs from CN patients with ELANE -mutations specific-CRISPR/Cas9 ribonucleoprotein (RNP) complexes. We also developed simple and fast screening method for the selection of the ELANE gene corrected single iPSCs clones using restriction fragment length polymorphism (RFLP) analysis and Cas9 in vitro digestion technique. Selected clones were further analyzed for granulocytic differentiation. Up to now, we compared myeloid differentiation of iPSCs generated from healthy individuals with iPSCs from one CN- ELANE patient (p.C151Y) before- and after correction of ELANE mutation. We found that correction of ELANE mutation resulted in fully normalized granulocytic differentiation, that was in line with normalized levels of ELANE mRNA, correction of previously increased unfolded protein response (UPR)-activated gene expression, such as CHOP, ATF4, BIP, and reduction of elevated STAT5A levels in the ELANE corrected cells.Taken together, we established a safe and efficient CRISPR/Cas9-RNP based ELANE gene-correction platform of iPSCs of ELANE -CN patients that may provide novel stem cell-based therapy for CN patients with high risk of leukemia development as well as for G-CSF-non-responsive patients. This platform may be also applied for treatment of patients with other monogenic bone marrow failure syndromes. DisclosuresNo relevant conflicts of interest to declare.

BAALC Is a Key Mediator of Leukemia Development in Congenital Neutropenia

We recently reported high frequency of cooperating acquired CSF3R and RUNX1 mutations in severe congenital neutropenia (CN) patients that developed AML or MDS. CN is a pre-leukemic bone marrow failure syndrome (BMFS) and longitudinal retrospective analysis of CN bone marrow samples allows identification of the pathological intracellular events that lead to leukemogenic transformation.In the present study, we report the identification of a key mechanism of leukemogenesis in CN. We made use of the induced pluripotent stem cell (iPSC) model and embryoid body (EB)-based in vitro hematopoietic differentiation of iPSCs generated from a CN patient harboring ELANE mutation before (CN-iPSCs) and after (CN/AML-iPSCs) overt AML. CN/AML-iPSCs clones revealed CSF3R and RUNX1 mutations and trisomy 21. EB-based hematopoietic differentiation revealed that CN-iPSCs produced similar amounts of CD34+ cells, but approximately 2-fold reduction of mature granulocytes and CFU-G colonies in CFU-assay, as compared to healthy donor-derived iPSCs. CN/AML-iPSCs produced CD34+ cells but did not differentiate into mature granulocytes at all.Analysis of the gene expression profiles of five CN/AML patients including our index patient, revealed that genes upregulated in early hematopoietic stem/progenitor cells (HSPCs), such as Brain And Acute Leukemia, Cytoplasmic (BAALC), Hematopoietic Prostaglandin D Synthase (HPGDS), Natriuretic Peptide Receptor 3 (NPR3) and CD109 were markedly increased in CN/AML blasts harboring both RUNX1 and CSF3R mutations, as compared to hematopoietic cells prior to leukemia. This genetic signature suggests transformation of hematopoietic cells into more primitive hematopoietic progenitors after acquisition of CSF3R and RUNX1 mutations. We were able to confirm strong increase of BAALC, HPGDS, NPR3 and CD109 mRNA levels in CD34+ cells derived from CN/AML-iPSCs, as compared to CN-iPSCs, suggesting that our iPSC-model is reliable to study leukemogenesis.In order to evaluate which of these candidate genes (BAALC, HPGDS, NPR3 and CD109)is responsible for the leukemogenic transformation in CN, we generated CN/AML-iPSCs clones deficient for one selected genes. We established CRISPR-Cas9-mediated gene knockout using transfection of CN/AML-iPSCs with pSpCas9(BB)-2A-GFP vector expressing Cas9 and sgRNA, that were designed to specifically target first exon of each candidate gene. CN/AML-iPSCs transfected with specific sgRNAs were sorted and single cell clones were analyzed further.Knockout of the selected genes did not affect survival and pluripotency of CN/AML-iPSCs and we were able to study EB-based hematopoietic differentiation of gene-edited CN/AML-iPSCs clones. Interestingly, knockout of HPGDS, NPR3 or CD109 did not correct defective granulocytic differentiation of CN/AML-iPSCs, whereas knockout of BAALC in CN/AML-iPSCs resulted in the tremendous increase of the granulocytic differentiation, as assessed by FACS, CFU assay, morphological analysis of cytospin preparations and nitroblue tetrazolium (NBT) assay. Granulocytic differentiation of BAALC -deficient CN/AML-iPSCs was comparable to CN-iPSCs, but was still reduced in comparison to healthy donor-derived iPSCs.These data clearly showed that knockout of BAALC in CN/AML-iPSCs overcomes differentiation block at the early hematopoietic progenitor cell stage, demonstrating a fundamental role of BAALC in leukemia development in CN. BAALC, HPGDS and CD109 are known to be markedly up-regulated in RUNX1 -mutated de novo AML and qRT-PCR of CD34+ cells generated from BAALC -knockout CN/AML-iPSCs revealed a decrease of mRNA expression levels of BAALC, HPGDS and CD109 . At the same time, knockout of RUNX1 in CN/AML-iPSCs using CRISPR/Cas9-editing revealed even higher decrease of mRNA levels of BAALC, NPR3 and CD109 . These data suggest that HPGDS and CD109 up-regulation is downstream of RUNX1 -mediated BAALC induction in AML.Taken together, we established a reliable in vitro model to study leukemogenesis in the pre-leukemic BMFS, using CN as an example. With the help of this model, we identified BAALC up-regulation as a key “leukemogenic” factor downstream of RUNX1 and CSF3R mutations. Based on these observations, we conclude that inhibition of BAALC in hematopoietic cells of CN patients may prevent leukemogenic transformation of hematopoiesis or eliminate AML blasts in CN-AML. DisclosuresNo relevant conflicts of interest to declare.

Effects of CSF3R mutations on Myeloid Differentiation and Proliferation of Hematopoietic Cells of Congenital Neutropenia Patients

Over the last 25 years, with the clinical approval of recombinant human granulocyte colony-stimulating factor (rhG-CSF) remarkable progress has been achieved in the therapy of severe congenital neutropenia (CN). Nevertheless, CN patients have a high rate of transformation to myelodysplasia (MDS) or acute myeloid leukemia (AML). This risk is especially high in the group of patients who harbor acquired G-CSFR mutations, suggesting that these mutations are involved in the leukemogenesis. Deep sequencing of the intracellular part of G-CSFR allowed us to identify a subset of CN patients with a high mutant allele frequency (MAF) of G-CSFR mutations in the granulocytic compartment. We performed CSF3R mutation analysis of myeloid colonies from colony forming unit (CFU) assay of BM and CD34+ samples of 3 ELANE -CN patients, in which the percentage of granulocytes with G-CSFR mutation varied between 22.6% and 81%. Average number of sequenced colonies per CFU sample was 18. Intriguingly, we found that only cell clones with WT G-CSFR were grown in CFU assay. We hypothesized that lack of G-CSFR mutant clones in CFU assay is due to abnormal signaling downstream of truncated G-CSFR. To compare myeloid differentiation of G-CSFR mutant and WT G-CSFR hematopoietic cells, we generated ELANE -CN patient-derived induced pluripotent stem cells (CN-iPSCs) and performed CRISPR/Cas9 genome editing of CSF3R . Using 2 different sgRNAs specific for the intracellular region of G-CSFR, we introduced nucleotide indels at amino acid positions 740 and 735 (NP_000751.1) in CN-iPSCs. Subsequently, homozygous and heterozygous CN-iPSCs clones with truncated distal part of cytoplasmic domain of G-CSF receptor and subsequent loss of 3 out of 4 conserved tyrosine residues were generated.We compared myeloid differentiation of healthy donor iPSCs (HD-iPSCs), CN-iPSCs and CN-iPSCs with heterozygous and homozygous truncated G-CSF receptor (G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs, respectively). Absolute cell count during myeloid differentiation (18-32 day) of HD-iPSCs, G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs didn't differ significantly (p>0.05). In contrast, absolute cell count was found to be elevated from day 25 to day 32 of differentiation when G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs hematopoietic progenitors were compared with CN-iPSCs-derived hematopoietic cells (p<0.05). FACS analysis of CN-iPSCs derived hematopoietic progenitors with and without truncated G-CSF receptor using a panel of hematopoietic markers (KDR, CD34, CD235a, CD41a, CD45 and CD33) showed no difference in percentage of early progenitors (CD34+/KDR+), E/MK precursors (CD41a+CD235a+/ CD45-), CD34+/CD45+ and CD34+/CD43+ cells. Intriguingly, we observed increase in percentage of CD34+/CD43+ (p<0.01), CD33+/CD45+ (p<0.05) and CD41a+CD235a+/ CD45- (p<0.05) cells at day 14 of myeloid differentiation of G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs versus HD-iPSc. As expected, relative number CD14+ and CD16+ cells were not changed upon myeloid differentiation of hematopoietic progenitors with mutant G-CSFR but relative levels of CD15+ and CD15+/CD16+ were negatively affected by homozygous and heterozygous G-CSFR mutations. Next, CFU assay of hematopoietic progenitors derived from G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs produced markedly less colonies than HD- and CN-iPSCs derived hematopoietic cells. Cell morphology analysis also confirmed the reduced number of mature granulocytes seen after myeloid differentiation of G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs. Finally, reprogramming of BM cells from CN patients into iPSCs followed by mutation analysis of single cell derived iPSCs clones allowed us to identify iPSCs with naturally acquired G-CSFR mutations. Preliminary results revealed reduced myeloid differentiation of these cells, which is in line with data generated from G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs.Using a combination of patient CN-iPSCs and CRISPR/Cas9 gene editing we were able to recapitulate main features of G-CSFR mutant versus G-CSFR WT CN cells - defective neutrophil differentiation and increased proliferation of human hematopoietic progenitors. Since virtually all studies of truncated G-CSFR receptor signaling have been performed in murine cytokine-responsive myeloid cell lines, our approach is more suitable to explore human aberrant G-CSF receptor signaling in depth. DisclosuresNo relevant conflicts of interest to declare.

HAX1 Associated Congenital Neutropenia: A 25 Year Long-Term Analysis of the European Scnir Cohort

Background: Congenital neutropenia (CN) is a group of rare inborn genetic defects including a variety of different gene mutations and different patterns of inheritance. While mutations in the ELANE gene comprise the largest cohort of autosomal dominant CN, HAX1 gene mutations make up the largest cohort of autosomal recessive CN in Europe.Independent of the underlying genetic subtypes, CN patients benefit from G-CSF maintenance treatment, which improved the life expectancy and quality of life significantly. By prolonging the life expectancy, a significant risk of secondary leukemia development has been unmasked for most genetic CN subtypes including HAX1 .There are two HAX1 splice isoforms and genotype-phenotype studies have shown that HAX1 mutations affecting both isoforms (mainly p.Q190X in the original patients in Sweden and p.R86X in Japanese patients) cause severe CN with neurologic symptoms. Mutations affecting only one isoform (mainly p.W44X, found in consanguineous families of Turkic or Arabic origin) lead to severe congenital neutropenia without neurologic involvement.Methods: Here we report on the genotype - phenotype correlation and outcome of 48 patients revealing different HAX1 mutations documented by the European Branch of the SCNIR since 1994.Results:HAX1 mutations have been identified in 48 of the 458 patients with CN enrolled by the European Branch of the SCNIR, especially in consanguineous pedigrees. 45 patients reveal homozygous mutations in one transcript variant (p.W44X), which is the major subtype in patients of Turkic or Arabic origin. In 3 patients originated from Sweden both isoforms are affected (p.Q190X).At diagnosis, all HAX1 patients present with severe neutropenia in CBCs, bone marrow shows a maturation arrest at the promyelocyte/myelocyte stage of granulopoiesis. Most, but not all, patients have received long-term treatment with G-CSF. Patients respond well to G-CSF treatment with a median G-CSF dose of 4.25 µg/kg/day compared to 4.38 µg/kg/day for the total CN cohort of the SCNIR Europe.Age distribution is 2-38 years (median 12.5 years), 46 of 48 patients are alive, 1 patient expired from sepsis at age 2 years after developing hemophagocytic lymphohistiocytosis (HLH) while on G-CSF treatment (2 µg/kg/day), 1 patient expired at age 13 years from transplant related morbidity given for leukemia.7 of the 48 patients (14 %) developed secondary myelodysplastic syndrome or acute leukemia (age at diagnosis 0.9-12.11 years, median 7.1 years). 6 of 7 patients carry mutation p.W44X, 1 patient carries p.Q190X. All 7 patients were treated with allogenic stem cell transplantation (SCT). In addition, 2 patients (age 0.9 and 18.1 years) received SCT for other reasons (prior to G-CSF availability and to cure the primary disease). None of the patients with HAX1 mutations required SCT for G-CSF non - responsiveness.Because of the association of higher G-CSF doses with greater risk of leukemic transformation in CN patients, we examined the relationship between the median G-CSF dose and leukemia development in this cohort and found that patients who developed leukemia also required higher G-CSF doses, as compared to non-leukemic patients (3.8 µg/kg/day in non-leukemic patients vs. 7.05 µg/kg/day in patients with leukemia).Next-generation ultra-deep-sequencing of the critical region of CSF3R of patients cDNA revealed that almost 50% of HAX1 -associated CN patients acquired single or multiple CSF3R mutations. This frequency is much higher than in other CN patient groups.Digenic mutations (HAX1 plus ELANE or G6PC3) were identified in additional 3 patients who presented with severe neutropenia and a variety of additional symptoms and organ involvements.Conclusions:All patients with HAX1 mutations present with profound neutropenia, but respond well to long-term G-CSF treatment. Secondary leukemia is the major reason for SCT in CN patients with HAX1 mutations. The high frequency of CSF3R mutations is unique in this subgroup of CN patients and might lead to a higher risk of leukemia development in the future. Neurologic symptoms are associated with specific HAX1 genotype. Registry and biobanks are extremely valuable for understanding the consequences of rare hematological diseases such as congenital neutropenia. DisclosuresNo relevant conflicts of interest to declare.

Abrogated GADD45b-Mediated Integrity Control of Hematopoietic Stem Cells upon ER Stress and DNA Damage Triggers Lymphopoiesis over Granulopoiesis in Congenital Neutropenia

In patients with severe congenital neutropenia (CN) with maturation arrest of bone marrow granulopoiesis, hematopoietic and myeloid progenitor cells exhibit elevated endoplasmic reticulum (ER) stress and unfolded protein response (UPR) due to inherited mutations in ELANE (neutrophil elastase, NE) or HAX1 (HCLS1-associated protein X-1). UPR and ER stress may induce genetic instability in hematopoietic stem and progenitor cells (HSPCs). Indeed, we recently reported severe changes in cell cycle control and DNA repair pathways (e.g. CHEK1 and BRCA1) in HSPCs of CN patients, as compared to G-CSF treated healthy individuals. We further studied the molecular mechanism of the hyper-sensitivity of CN HSPC to stress conditions. We found that expression of Growth Arrest and DNA-Damage-inducible, beta (GADD45b), which functions as stress sensor regulating cell cycle, survival and apoptosis in response to ER stress or DNA damage, was markedly reduced in myeloid progenitors of CN patients, as compared to G-CSF-treated healthy individuals. GADD45b is essential in stress-induced murine hematopoiesis and myeloid differentiation is severely compromised in gadd45b knockout mice (Gupta S. et al., 2006). Less is known about the functions of GADD45b in the DNA damage response and myeloid differentiation of human HSPCs. To study GADD45b functions in human hematopoiesis, we generated human induced pluripotent stem cells (iPSC) of healthy individuals haplo-insufficient for GADD45b using CRISPR/Cas9-mediated knockout of GADD45b . Human iPSCs were transfected with GADD45b -specific CRISPR/Cas9-gRNA RNP and gene-edited clones were selected for further study. We could not detect any iPSCs clones with frameshift homozygote or compound heterozygote mutations in exon 1 of GADD45b leading to the complete knockout of GADD45b . Most probably GADD45b-deficient iPSCs are lethal. GADD45b+/- iPSCs also presented a profound phenotype. While these cells retained pluripotency, we detected elevated γH2AX levels in GADD45b+/- iPSCs upon UV light exposure, as compared to GADD45b-WT cells. In line with up-regulated γH2AX levels, we measured strongly induced DNA damage, as quantified by Lord-Q DNA damage assay. We further analyzed myeloid differentiation of GADD45b+/- iPSCs using embryoid body (EB)-based method and found that GADD45b+/- iPSCs cells completely lost the capacity to differentiate into hematopoietic cells. We were able to make EBs of GADD45b+/- cells, these EBs survived and showed no signs of degradation or cell death, but they produced no floating (hematopoietic) cells. To study the effects of GADD45b inhibition in hematopoietic cells we transfected bone marrow CD34+ cells with GADD45b -specific CRISPR/Cas9-gRNA RNP. Similar to iPSCs, we detected markedly elevated UV-induced DNA damage and diminished G-CSF-mediated myeloid differentiation of GADD45b-edited CD34+cells in colony-forming units (CFU) assay. These data strongly support the essential role of GADD45b in hematopoietic and myeloid differentiation. Diminished GADD45b expression in CN HSPCs may increase susceptibility to stress and may contribute to malignant transformation.In order to prevent the appearance and clonal outgrowth of stressed HSPCs with inherited disease-causing mutations in combination with acquired oncogenic mutations, intrinsic DNA damage must be tightly controlled. Failures in the control mechanisms may affect the fate of HSPCs as for instance altered proliferation and wrongly biased differentiation. Therefore, we further evaluated the composition of the HSPC pool in GADD45b-deficient bone marrow cells of CN patients (CN- ELANE n=5, CN- HAX1 n=5), in comparison to healthy individuals treated (n=5) or not (n =7) with G-CSF using multicolor FACS panel of J. Dick. Treatment of healthy individuals with G-CSF induces increase of common myeloid progenitors (CMP, 7-fold) and decrease of multi-lymphoid progenitors (MLP, 10-fold). At the same time, the hematopoietic differentiation in CN patients is substantially shifted from CMP (14-fold decrease) to MLP (36-fold increase) lineage with dramatically reduced numbers of GMPs (3-fold) and increased numbers of B/NK progenitors (5-fold). These data suggest that deregulated integrity control of HSPC pool due to elevated UPR and ER stress and reduced GADD45b expression in hematopoietic cells of CN patients may change composition of HSPC pool and G-CSF response. DisclosuresNo relevant conflicts of interest to declare.

IPSC modeling of stage-specific leukemogenesis reveals BAALC as a key oncogene in severe congenital neutropenia.

Severe congenital neutropenia (CN) is a pre-leukemic bone marrow failure syndrome that can evolve to acute myeloid leukemia (AML). Mutations in CSF3R and RUNX1 are frequently observed in CN patients, although how they drive the transition from CN to AML (CN/AML) is unclear. Here we establish a model of stepwise leukemogenesis in CN/AML using CRISPR-Cas9 gene editing of CN patient-derived iPSCs. We identified BAALC upregulation and resultant phosphorylation of MK2a as a key leukemogenic event. BAALC deletion or treatment with CMPD1, a selective inhibitor of MK2a phosphorylation, blocked proliferation and induced differentiation of primary CN/AML blasts and CN/AML iPSC-derived hematopoietic stem and progenitor cells (HSPCs) without affecting healthy donor or CN iPSC-derived HSPCs. Beyond detailing a useful method for future investigation of stepwise leukemogenesis, this study suggests that targeting BAALC and/or MK2a phosphorylation may prevent leukemogenic transformation or eliminate AML blasts in CN/AML and RUNX1 mutant BAALC(hi) de novo AML.

Nicotinamide (vitamin B3) treatment improves response to G‐CSF in severe congenital neutropenia patients

Nicotinamide (vitamin B3) treatment improves response to G‐CSF in severe congenital neutropenia patients

Myelodysplasia syndrome and acute myeloid leukemia in patients with congenital neutropenia receiving G-CSF therapy

AbstractGranulocyte colony-stimulating factor (G-CSF) has had a major impact on management of “severe chronic neutropenia,” a collective term referring to congenital, idiopathic, or cyclic neutropenia. Almost all patients respond to G-CSF with increased neutrophils, reduced infections, and improved survival. Some responders with congenital neutropenia have developed myelodysplastic syndrome and acute myeloblastic leukemia (MDS/AML), which raises the question of the role of G-CSF in pathogenesis. The Severe Chronic Neutropenia International Registry (SCNIR), Seattle, WA, has data on 696 neutropenic patients, including 352 patients with congenital neutropenia, treated with G-CSF from 1987 to present. Treatment and patient demographic data were analyzed. The 352 congenital patients were observed for a mean of 6 years (range, 0.1-11 years) while being treated. Of these patients, 31 developed MDS/AML, for a crude rate of malignant transformation of nearly 9%. None of the 344 patients with idiopathic or cyclic neutropenia developed MDS/AML. Transformation was associated with acquired marrow cytogenetic clonal changes: 18 patients developed a partial or complete loss of chromosome 7, and 9 patients manifested abnormalities of chromosome 21 (usually trisomy 21). For each yearly treatment interval, the annual rate of MDS/AML development was less than 2%. No significant relationships between age at onset of MDS/AML and patient gender, G-CSF dose, or treatment duration were found (P > .15). In addition to the 31 patients who developed MDS/AML, the SCNIR also has data on 9 additional neutropenic patients whose bone marrow studies show cytogenetic clonal changes but the patients are without transformation to MDS/AML. Although our data does not support a cause-and-effect relationship between development of MDS/AML and G-CSF therapy or other patient demographics, we cannot exclude a direct contribution of G-CSF in the pathogenesis of MDS/AML. This issue is unclear because MDS/AML was not seen in cyclic or idiopathic neutropenia. Improved survival of congenital neutropenia patients receiving G-CSF therapy may allow time for the expression of the leukemic predisposition that characterizes the natural history of these disorders. However, other factors related to G-CSF may also be operative in the setting of congenital neutropenia.

Congenital Neutropenia Is Also Associated with a High Cancer Risk: A Study from the French Severe Chronic Neutropenia Registry

Introduction: Congenital neutropenia (CN) is characterized by chronic neutropenia due to a constitutional genetic defect.1 To date, these diseases have not been considered to be frequently associated with malignant solid tumors, unlike the risk of secondary myelodysplastic syndrome leukemia, which is well-known in CN. Methods: The French Severe Chronic Neutropenia Registry (FSCNR) has prospectively enrolled CN patients since 1993. Solid tumors, identified during routine patient follow-up, were classified according to WHO criteria. We included localized lymphoma in the spectrum of malignant solid tumors. We calculated the incidence of malignant solid tumors in a cohort of CN patients. Results: Among 868 patients with various CN subtypes followed for a total of 16617 person-years, 24 patients who developed a malignant solid tumor were identified. Those cancers are described in Table 1, including the CN genetic anomaly. Cancers were almost always diagnosed in adulthood, with median age at diagnosis of 38.1 (range 10-72) years; only 3 cancers were diagnosed before age of 20 years. The cancer rate was 1.2% at 30 years of age, 7% at 40 years and 24% at 50 years (Fig. 1A). The risk-of-cancer percentages depended mainly on the associated genetic deficiency. Solid tumors were roughly distributed as follows: 33% among WHIM (CXCR4) patients, 5.3% among GATA2 patients, 2.7% among ELANE patients, 1.9 % among SBDS patients and 0.8% among for all other subtypes combined (Fig. 1B). Human papillomavirus (HPV) was the cause of cancer for 2/5 in WHIM patients and 2/6 in GATA2 patients. Three Lymphoma were identified, one in GATA2 patient and 2 in WHIM patients. Notably, our cohort's follow-up is skewed to the right, with less efficient monitoring of adults, with still limited long-term follow-up beyond 40 years. Therefore, we probably underestimated the solid-tumor risk in CN patients, as many patients, if alive, are no longer followed in hematology centers. Among 103 patients who underwent hematopoietic stem-cell transplantation (HSCT), 76 were long-term survivors. None of them developed solid tumors, which differs strikingly from the high malignancy risk associated with Fanconi anemia post-HSCT. Lastly, the FSCNR also includes and follows patients with idiopathic neutropenia. Among the 232 idiopathic neutropenia patients, followed for a total of 2866 person-years, no malignancy has been observed so far. Conclusion: Our data lead us to advance that CN patients should be considered at risk of developing solid cancers, especially after the age of 30 years. This risk, at first glance, depended on the CN-associated genetic anomaly, with CXCR4 mutation, GATA2, SBDS and ELANE being the most frequent. HSCT was not associated with a higher risk and may, in contrast, be protective. These findings warrant confirmation but represent a compelling reason to prolong follow-up into adulthood of CN patients diagnosed during childhood. No indication was found of a specific high solid-tumor risk associated with idiopathic neutropenia. Reference Donadieu J, Beaupain B, Fenneteau O, Bellanne-Chantelot C. Congenital neutropenia in the era of genomics: classification, diagnosis, and natural history. Br.J.Haematol. 2017; 179(4): 557-574. Acknowledgments: The French SCN registry is supported by grants from Amgen, Chugai, Prolong Pharma, X4 Pharma, Inserm, the Association 111 les Arts, the Association RMHE, the Association Sportive de Saint Quentin Fallavier. The authors thank the association IRIS and Mrs Grosjean and Mr Gonnot(ASSQF), the association Barth France for their support. Disclosures Hermine: Roche: Consultancy; Celgene BMS: Consultancy, Research Funding; AB Science: Consultancy, Current equity holder in publicly-traded company, Honoraria, Patents &amp; Royalties, Research Funding; Alexion: Research Funding; Novartis: Research Funding. Blaise:Jazz Pharmaceuticals: Honoraria. Sicre de Fontbrune:Alexion Pharmaceuticals Inc.: Honoraria, Research Funding. cohen Beaussant:X4 Pharmaceuticals, Inc.: Current Employment.

Transcriptome Analysis of Severe Congenital Neutropenia Associated Leukemia with Different Types of RUNX1 Mutations in an iPSC-Based Model

Co-acquisition of CSF3R and RUNX1 mutations is the most frequent combination of acquired genetic abnormalities found in AML and MDS cases associated with severe congenital neutropenia (CN). Using the iPSC-based model for CN-associated leukemia, we compared the outcomes of RUNX1 missense mutations and RUNX1 haploinsufficiency by means of hematopoietic differentiation and transcriptome analysis. We generated iPSC lines from 2 CN/AML patients harboring ELANE mutations p.C151Y or p.G214R (CN1 and CN2, accordingly). CN/AML iPSC clones of CN patient 1 were generated from leukaemia cells with CSF3R p.Q741X, missense RUNX1 p.R139G mutation, and trisomy 21 (CN/AML1.1 and 1.2). CN/AML iPSC clones of CN patient 2 (CN/AML2) have CSF3R p.Q743X mutation and truncated RUNX1 mutation p.E175fs introduced by CRISPR/Cas9 gene-editing. The iPSC clones from CN (n = 4) and CN/AML stage (n = 6) were subjected for embryoid body (EB)-based differentiation into hematopoietic stem and mature myeloid cells. We observed dramatically increased proliferation of CN/AML iPSC-derived hematopoietic stem cell progenitors (HSPCs) collected at day 14 of EB differentiation and further cultured on the FLT3-L-secreting feeder cells, as compared to CN - iPSC derived HSPCs. Moreover, myeloid differentiation was severely diminished in CN/AML-iPSC group compared with CN iPSC group. To elucidate the mechanism of leukemogenic transformation in CN, we performed RNA-sequencing of CD34+ hematopoietic stem and progenitor cells (HSPCs) derived from CN and CN/AML iPSC clones. Differential gene expression analyses of RNA-sequencing data of iPSC-derived HSPCs using DESeq2 R package identified 132 up- and 570 down-regulated (log2FC &amp;gt; 1 or &amp;lt; -1, adj. P-value &amp;lt; 0.05), as well as 579 up- and 1422 down-regulated (log2FC &amp;gt; 1 or &amp;lt; -1, adj. P-value &amp;lt; 0.05) genes between CN/AML and CN stages for CN patient 1 and CN patient 2, respectively. There were 189 differentially expressed genes shared between CN/AML1 vs CN1 and CN/AML2 vs CN2 comparisons. Among the top significantly upregulated pathways in the gene set enrichment analysis (GSEA) of CN/AML1 iPSCs with missense RUNX1 mutation were "Hallmark E2F Targets", "Hallmark Oxidative Phosphorylation", "Hallmark MYC Targets V1", whereas genes corresponding to the gene set "Platelet Specific Genes" were significantly downregulated. In CN/AML2 iPSCs with truncated RUNX1 mutation, we detected enrichment of the gene sets "Hallmark G2M Checkpoint", "Hallmark E2F Targets" as well as "Hallmark TGFb signaling". In contrast, the gene set "GO:Structural Constituent of Ribosomes" was enriched in CN2 derived HSPCs. Intriguingly, transcription factor enrichment analysis (TFEA) using the lists of differentially expressed genes (log2FC &amp;gt; 1 or &amp;lt; -1, adj. P-value &amp;lt; 0.05) demonstrated similarities between significantly enriched TFs motifs sets (P-value &amp;lt; 0.05) from both CN/AML vs CN comparisons. Among the transcription factor binding motifs significantly enriched in CN/AML cells (P-value &amp;lt; 0.05) with missense RUNX1 mutation and RUNX1 haploinsufficiency, we found motifs for GATA1, GATA2, and RUNX1, as well as for AML-associated factors such as SUZ12 and EZH2. The vast majority of enriched kinases (HIPK2, MAPK1/3/14, CSNK2A1, ERK1, AKT1, etc.) at the selected threshold (P-value &amp;lt;10-8) were shared in kinase enrichment analysis (KEA) between both CN/AML vs CN comparisons. Taken together, we found a dramatic difference in the gene expression signature between CN- and CN/AML-iPSCs derived HSPCs. The vast majority of significantly enriched transcription factors and kinases were overlapped in HSPCs carrying different types of RUNX1 mutations. These data will help to better understand the mechanistic outcomes of different types of the endogenously expressed mutated RUNX1 proteins in leukemogenesis. This info is crucial for the identification of specific drug targets for CN/AML and de novo AML with mutant RUNX1. Disclosures No relevant conflicts of interest to declare.

Efficient Correction of HAX1 Mutations in Primary HSPCs of Severe Congenital Neutropenia Patients Using CRISPR/CAS9 GENE-Editing

Patients with the rare pre-leukemia bone marrow failure syndrome severe congenital neutropenia (CN) have markedly reduced numbers of neutrophils in peripheral blood (&amp;lt;500/μl), leading to frequent infections and requiring chronic granulocyte stimulating factor (G-CSF) treatment. Approximately 7 % of CN patients carry homozygous loss-of-function mutations in the HAX1 gene. 25 % of HAX1-CN patients develop MDS or AML. The only curative therapy for CN patients with overt MDS/AML is hematopoietic stem cell transplantation with its associated risks. A clinical need for gene therapy for CN patients is imminent. Here, we describe for the first time the application of CRISPR/Cas9 gene-editing in combination with recombinant adeno associated virus 6 (rAAV6)-based delivery of the template for homology-directed repair (HDR) for the mutated HAX1 gene in primary bone marrow mononuclear CD34+ cells (HSPCs) of HAX1-CN patients. We selected HAX1 mutation p.W44X as the most frequently described mutation in HAX1-CN. We established the delivery of the chemically modified sgRNA in combination with SpCas9 V3 in primary HSPCs using electroporation. The HDR template was generated by PCR from healthy donor HSPCs and cloned into pRC6 vector for the production of high titer rAAV6 (&amp;gt;12x1012 viral copies per ml). Our gene-editing protocol produced on average 79,7 % (± 8,62 %) of total editing (TE) in healthy donor HSPCs (n=6). When we transduced healthy donor HSPCs with rAAV6 containing the template at MOI 105 after electroporation with CRISPR/Cas9 RNP, we achieved 38,1 % (± 1,3 %) knock-in (KI) efficiency and 82,3 % (± 8,2 %) TE (n=2). We further applied this approach to primary HSPCs from 5 CN patients harboring the p.W44X HAX1 mutation. We achieved 84,4 % (± 4,2 %) TE and 65,8 % (± 7,12 %) KI. Too proof, that our editing reintroduced HAX1 protein expression, we performed Western Blot analysis of edited cells (n=2) and were able to detect relevant amounts of HAX1 protein. To assess the effect of HAX1 correction on the neutropenic phenotype in vitro, we performed a liquid culture differentiation assay of edited HSPCs to neutrophils. HSPCs from the same patients that were edited in the AAVS1 safe harbor were used as isogenic controls. In the AAVS1 locus the editing efficiency was 76,74 % (± 17,07 %) total indels. By morphological assessment of Wright-Giemsa stained cytospins of edited cells derived on day 14 of differentiation revealed significant (p = 0,005) increases of mature neutrophils for all five edited HAX1-CN patient samples, as compared to the respective controls. This phenotype correction was also observed in flow cytometry by a significant (p = 0,011) increase of mature CD34-CD45+ CD15+CD16+ neutrophils (n=5). To investigate if the HAX1 mutation correction and reinforced expression of HAX1 protein improved the sensitivity of HSPCs to oxidative stress as described by Klein et al. 2007, we performed live-cell imaging of caspase3/7 activation. Live-cell imaging revealed a substantial reduction of H2O2-induced apoptosis in corrected HAX1-CN patients derived HSPCs (n=3). Furthermore, the corrected differentiated cells were investigated for functional hallmarks of granulocytes. We could observe that HAX1 gene-edited HSPCs showed comparable chemotaxis, phagocytosis and no defects in ROS production to isogenic control edited cells. Taken together, we established a protocol for efficient selection-free correction of HAX1 p.W44X mutation in primary HSPCs using CRISPR/Cas9 and rAVV6 HDR repair templates. Our gene-editing reintroduced HAX1 protein expression in primary HSPCs from HAX1-CN patients. Neutrophils derived from corrected cells showed functional improvements in survival to oxidative stress and general neutrophil functions. We believe that these results are enticing to be investigated further for potential clinical translation as an autologous stem cell therapy for HAX1-CN patients. Disclosures No relevant conflicts of interest to declare.

How Many Patients Have Congenital Neutropenia? a Population-Based Estimation from the Nationwide French Severe Chronic Neutropenia Registry

Introduction: Congenital neutropenia (CN) is characterized by chronic neutropenia caused by a constitutional genetic defect and can be considered an orphan disease. Nationwide estimations of its incidence and prevalence are poorly documented but would provide key information to better follow-up of CN patients. Notably, orphan-drug status also is accorded based on such epidemiological parameters. Methods: The French Severe Chronic Neutropenia Registry (FSCNR) has prospectively enrolled CN patients since 1993, with multiple source verifications in France of that information: pediatric and adult hemato-immunology units, diagnostic labs... We also actively collect all cases followed in France, regardless of the healthcare facility monitoring the patient. To calculate incidence at birth, we considered subjects born between 1/1/1995 and 12/31/2017, because information completeness has been validated for this 22-year period. Number of births per year was provided by the French National Institute of Statistics and Economic Studies (INSEE). We used American College of Medical Genetics class 4 and 5 variants for genetic classification and the overall CN classification developed elsewhere.1 To estimate expected prevalence, we assumed 50-year life expectancy for these patients and compared ongoing enrolment to the prevalence estimation and calculated FNSCR coverage. A Poisson distribution was assumed. Results: On 15 July 2020, the FSCNR had identified 3205 patients. Reasons for non-enrolment of 2096 were, mainly: autoimmune neutropenia (n=501), foreign residency (n=214), other diagnosis (n=882) and diagnostic work-up not completed (n=249). Among the 1109 patients who fulfilled Chronic Neutropenia criteria, 242 had idiopathic neutropenia2 and 867 patients were considered to have CN1. Global results are presented in Table 1. In France, the CN incidence at birth (all subtypes combined) was 2.6×10-5 (95% CI: 2.04-2.8×10-5), which represents a mean of 23 new cases/year in a country with ~870,000 births/year. For all CN combined, the expected prevalence, assuming 50-year life expectancy, would be 1131 cases in a country of 65×106 inhabitants while the FCSNR currently has 867 cases enrolled or an estimated 77% nationwide coverage. Based on our results and our assumptions for life expectancy, estimated prevalence of CN for 10 millions inhabitants is therefore 174 CN. Genetic subtype representation is as follows: 20% SBDS, 17% ELANE (8% cyclic, 9% permanent), 9% GATA2, 7% SLC37A4, ~4-5% each of TAZ and CXCR4 and VPS13B, while the other subtypes are even rarer. At present, no cause has been identified for 25% of the cases. Conclusion: The results of this analysis provide an estimation of the major CN-descriptive epidemiological parameters and the relative frequencies of several subtypes. Despite the FSCNR's quite large registry, we estimate that about a quarter of the prevalent cases in France were missed, mainly those followed as adults. References 1 Donadieu J, Beaupain B, Fenneteau O, Bellanne-Chantelot C. Congenital neutropenia in the era of genomics: classification, diagnosis, and natural history. Br.J.Haematol. 2017; 179(4): 557-574. 2 Sicre De Fontbrune F, Moignet A, Beaupain B et al. Severe chronic primary neutropenia in adults: report on a series of 108 patients. Blood 2015; 126(14): 1643-1650. Acknowledgments: The French SCN registry is supported by grants from Amgen, Chugai, Prolong Pharma, X4 Pharma, Inserm, the Association 111 les Arts, the Association RMHE, the Association Sportive de Saint Quentin Fallavier. The authors thank the association IRIS and Mrs Grosjean and Mr Gonnot(ASSQF), the association Barth France for their support. Disclosures Sicre de Fontbrune: Alexion Pharmaceuticals Inc.: Honoraria, Research Funding. cohen Beaussant:X4 Pharmaceuticals, Inc.: Current Employment.