Confirmatory Diagnostics Research Articles

2024 The Guidelines from the Polish Society forLaboratory Diagnostics on the diagnostic of the HumanImmunodeficiency Virus infection

These recommendations of the Polish Society for Laboratory Diagnostics concern thediagnostic strategy for detecting infection with the Human Immunodeficiency Virus (HIV),implemented with the participation of medical laboratories in Poland. A medical diagnosticlaboratory should ensure that the diagnostic process is performed completely, includingconfirmatory test if needed. The use of 4th generation immunoassay tests is recommendedfor screening testing. For confirmatory diagnostics, it is recommended to apply nucleicacid amplification tests, using specific molecular probes with real-time detection of theluminescent signal. Particular attention should be paid to obtaining the appropriate amountand type of biological material used in the entire diagnostic process. The document considersthe different profiles of medical facilities doing tests, the diverse needs of clients and theanalytical differences of diagnostic tests available on the market. Considering currentknowledge in prevention, diagnosis, and treatment of HIV infection, it constitutes guidelinesfor unifying the diagnostic process in the country.

Diagnosis and classification of portosystemic shunts: a machine learning retrospective case-control study.

Diagnosis of portosystemic shunts (PSS) in dogs often requires multiple diagnostic tests, and available clinicopathologic tests have limitations in sensitivity and specificity. The objective of this study was to train and validate a machine learning model (MLM) that can accurately predict the presence of a PSS utilizing routinely collected demographic data and clinicopathologic features. Dogs diagnosed with PSS or control dogs tested for PSS but had the condition ruled out (non-PSS) were identified. Dogs were included if a complete blood count and serum chemistry panel were available from PSS diagnostic testing. Dogs with a PSS were subcategorized as having a single intrahepatic PSS, a single extrahepatic PSS, or multiple extrahepatic PSS. An extreme gradient boosting (XGboost) MLM was trained with data from 70% of the cases, and MLM performance was determined on the test set, comprising the remaining 30% of the case data. Two MLMs were created. The first was designed to predict the presence of any PSS (PSS MLM), and the second to predict the PSS subcategory (PSS SubCat MLM). The trained PSS MLM had a sensitivity of 94.3% (95% CI 90.1-96.8%) and specificity of 90.5% (95% CI 85.32-94.0%) for dogs in the test set. The area under the receiver operator characteristic curve (AUC) was 0.976 (95% CI; 0.964-0.989). The mean corpuscular hemoglobin, lymphocyte count, and serum globulin concentration were most important in prediction classification. The PSS SubCat MLM had an accuracy of 85.7% in determining the subtype of PSS of dogs in the test set, with variable sensitivity and specificity depending on PSS subtype. These MLMs have a high accuracy for diagnosing PSS; however, the prediction of PSS subclassification is less accurate. The MLMs can be used as a screening tool to increase or decrease the index of suspicion for PSS before confirmatory diagnostics such as advanced imaging are pursued.

Utilizing Point-Of-Care Ultrasound (POCUS) for Diagnosis in a Resource-Limited Setting: A Case Report of Pulmonary Embolism

Introduction: Acute pulmonary embolism (PE) is a common cause of cardiovascular-related deaths and poses diagnostic challenges due to its variable and non-specific symptoms. Computed tomography pulmonary angiography (CTPA) is the gold standard imaging method for PE diagnosis, but its availability is limited in resource-constrained settings. Point-of-care ultrasound (POCUS) has emerged as a valuable tool for emergency physicians, aiding accurate diagnoses, procedural guidance, and resuscitation efforts. Case Presentation: This case report presents a 76-year-old woman with non-specific symptoms diagnosed with PE using POCUS in the Emergency Department of the Korle Bu Teaching Hospital. The POCUS findings included an enlarged right ventricle with a flattened septum (D sign), poor cardiac contractility, thrombi in the right ventricle and a plethoric Inferior Vena Cava (IVC). Prompt diagnosis facilitated timely management, leading to improved patient outcomes. Conclusion: POCUS has proven to be indispensable in resource-constrained settings where confirmatory diagnostics are limited. Incorporating POCUS training into emergency medicine residency programs and establishing emergency ultrasound fellowships in under-resourced regions like Africa can enhance its utilization and empower clinicians in such environments. Equipping emergency room clinicians with POCUS skills enables timely diagnosis, early interventions, shorter Emergency Department stays, and improved patient outcomes. This approach can contribute to building an African faculty proficient in emergency ultrasound, facilitating the education and training of more clinicians in POCUS, and ultimately enhancing healthcare outcomes in resource-limited environments.

КЛИНИЧЕСКИЙ СЛУЧАЙ ВРОЖДЕННОГО ГИПОТИРЕОЗА

The article presents a clinical case of congenital hypothyroidism. A child (girl) was born from a mother who was diag-nosed with hypothyroidism. The child is from dichorionic diamniotic twins. During intrauterine development, growth retardation of the second fetus was observed. The child was born by Caesarean section, with low body weight; the condition after birth was severe due to respiratory distress syndrome and prematurity. According to the result of neonatal screening, the level of thyroid-stimulating hormone was 305.75 µIU/ml, and ultrasound examination revealed thyroid gland agenesis. A diagnosis of hypothyroidism was made. A slight valvular stenosis of the pulmonary artery, an aneurysm of the interatrial septum with a defect, an incomplete vascularization of the retina of both eyes, and an inguinal hernia were revealed. The presence of dysembryogenesis stigma (hernia, aneurysm of the interatrial septum, low ears, macroglossia, moderate marbled cyanosis, flat-bridged nose, moderate hypotension) indicates the hereditary nature of the disorders. A theoretical analysis of possible candidate genes for the development of hypothyroidism was carried out. It was shown that the TSHR, NKX2-5, THRA, TSHB, TRHR, TBL1X, IRS4, PAX8, FOXE1, NKX2-1 genes are responsible for congenital hypothyroidism. It is noted that these genes are the regulators of the development and maturation of the thyroid gland or encode thyroid hormone receptors. Conclusion. For better understanding the etiopathogenetic mechanisms of the formation of congenital hypothyroid-ism, it is necessary to consider the possibility of confirmatory DNA diagnostics.

КЛИНИЧЕСКИЙ СЛУЧАЙ БОЛЕЗНИ КУГЕЛЬБЕРГА-ВЕЛАНДЕРА (СПИНАЛЬНОЙ МЫШЕЧНОЙ АТРОФИИ III ТИПА)

Background. Differential diagnosis of neuromuscular diseases is one of the most difficult areas in neurology. Molecular genetic research in these patients is of particular importance. The article presents a clinical case of 5q spinal muscular atrophy type III (Kugelberg – Welander disease), confirmed by molecular genetic testing. Description of the clinical case. The article presents the clinical observation of a patient with an initial diagnosis of Erb – Roth myopathy. A genetic study was carried out. The analysis of the presence of exon 7 of the SMN1/SMN2 genes showed the absence of a signal corresponding to exon 7 of the SMN1 gene. A search for deletions in the SMN1 gene showed the homozygous deletion of exons 7–8 of the SMN1 gene in the proband. Homozygous deletion of exons 7–8 of the SMN1 gene causes 5q proximal spinal muscular atrophy. As a result of determining the num-ber of copies of the SMN1 and SMN2 genes, 0 copies of exons 7–8 of the SMN1 gene and 4 copies of exons 7–8 of the SMN2 gene were registered, which confirms the diagnosis of 5q spinal muscular atrophy type III. Conclusion. Adult patients suffering from neuromuscular diseases are recommended to undergo confirmatory DNA diagnostics to prescribe pathogenetic treatment, which increases their chances of survival. In young people with a clinical diagnosis of neuromuscular disease, genetic testing is required to clarify the diagnosis and further treatment tactics.

Newborn screening for aromatic l-amino acid decarboxylase deficiency – Strategies, results, and implication for prevalence calculations

BackgroundAromatic l-amino acid decarboxylase deficiency (AADCD) is a rare, autosomal-recessive neurometabolic disorder caused by variants in dopa decarboxylase (DDC) gene, resulting in a severe combined deficiency of serotonin, dopamine, norepinephrine, and epinephrine. Birth prevalence of AADCD varies by population. In pilot studies, 3-O-methyldopa (3-OMD) was shown to be a reliable biomarker for AADCD in high-throughput newborn screening (NBS) allowing an early diagnosis and access to gene therapy. To evaluate the usefulness of this method for routine NBS, 3-OMD screening results from the largest three German NBS centers were analyzed. MethodsA prospective, multicenter (n = 3) NBS pilot study evaluated screening for AADCD by quantifying 3-OMD in dried blood spots (DBS) using tandem mass spectrometry (MS/MS). ResultsIn total, 766,660 neonates were screened from January 2021 until June 2023 with 766,647 with unremarkable AADCD NBS (766,443 by 1st-tier analysis and 204 by 2nd-tier analysis) and 13 with positive NBS result recalled for confirmatory diagnostics (recall-rate about 1:59,000).Molecular genetic analysis confirmed AADCD (c.79C > T p.[Arg27Cys] in Exon 2 und c.215 A > C p.[His72Pro] in Exon 3) in one infant. Another individual was highly suspected with AADCD but died before confirmation (overall positive predictive value 0.15). False-positive results were caused by maternal L-Dopa use (n = 2) and prematurity (30th and 36th week of gestation, n = 2). However, in 63% (n = 7) the underlying etiology for false positive results remained unexplained. Estimated birth prevalence (95% confidence interval) was 1:766,660 (95% CI 1:775,194; 1:769,231) to 1:383,330 (95% CI 1:384,615; 1:383,142). The identified child remained asymptomatic until last follow up at the age of 9 months. ConclusionsThe proposed screening strategy with 3-OMD detection in DBS is feasible and effective to identify individuals with AADCD. The estimated birth prevalence supports earlier estimations and confirms AADCD as a very rare disorder. Pre-symptomatic identification by NBS allows a disease severity adapted drug support to diminish clinical complications until individuals are old enough for the application of the gene therapy.

First report of Pseudocerradoa paullula causing aroid leaf rust on Swiss cheese plant Monstera deliciosa in South Carolina, USA.

In February 2023, two Monstera deliciosa Liebm. (Araceae) plants with typical symptoms of leaf rust disease were detected at a grocery store in Oconee Co., South Carolina. Symptoms included chlorotic leaf spots and abundant brownish uredinia, mainly on the adaxial surface of more than 50% of leaves. The same disease was detected on 11 out of 481 M. deliciosa plants in a greenhouse at a plant nursery located in York Co., South Carolina, in March 2023. The first plant sample detected in February was used for morphological characterization, molecular identification, and pathogenicity confirmation of the rust fungus. Urediniospores were densely aggregated, globose, golden to golden brown in color, and measured 22.9 to 27.9 µm (aver. 26.0 ± 1.1 µm; n=50) in diameter with wall thickness at 1.3 to 2.6 µm (aver. 1.8 ± 0.3 µm; n=50). Telia were not observed. These morphological traits aligned with those of Pseudocerradoa paullula (basionym: Puccinia paullula; Ebinghaus et al. 2022; Sakamoto et al. 2023; Sydow and Sydow 1913; Urbina et al. 2023). Genomic DNA was extracted from urediniospores collected from the naturally infected plant sample and used for PCR amplification and DNA sequencing of the large subunit (LSU) genetic marker with primers LRust1R and LR3 (Vilgalys and Hester 1990; Beenken et al. 2012). The LSU sequence of the rust fungus in South Carolina (GenBank accession: OQ746460) is 99.9% identical to that of Ps. paullula voucher BPI 893085 (763/764 nt.; KY764151), 99.4% identical to that of voucher PIGH 17154 in Florida, USA (760/765 nt.; OQ275201), and 99% identical to that of voucher TNS-F-82075 in Japan (715/722 nt.; OK509071). Based on its morphological and molecular characteristics, the causal agent was identified as Ps. paullula. This pathogen identification was also corroborated by the U.S. Department of Agriculture, Animal and Plant Health Inspection Service, Plant Pathogen Confirmatory Diagnostics Laboratory in Laurel, Maryland. To confirm the fungus's pathogenicity on M. deliciosa and M. adansonii Schott (Sakamoto et al. 2023), three plants of each Monstera species were inoculated by spraying with a suspension of urediniospores collected from the original plant sample (1 × 106 spores per ml; approx. 40 ml per plant). Three non-inoculated control plants of each host species were treated with deionized water in the same manner. Plants were placed in a plastic tray with wet paper towels to maintain moisture. The tray was placed at 22C for an 8-h photoperiod and covered for five days to facilitate infection. On 25 days after inoculation, abundant spots bearing urediniospores were produced on all leaves of inoculated M. deliciosa plants. A few uredinia were observed on two of the three inoculated M. adansonii plants. All non-inoculated control plants remained asymptomatic. Morphological features of urediniospores collected from inoculated plants matched those of Ps. paullula used as the inoculum. Aroid leaf rust on Monstera plants was officially reported in Australia, China, Japan, Malaysia, Philippines, and Florida, USA (Shaw 1991; Sakamoto et al. 2023; Urbina et al. 2023). This is the first report of Ps. paullula causing this disease on M. deliciosa in South Carolina, USA. Monstera species are popular indoor and landscape plants. Potential impact and regulatory responses regarding Ps. paullula, a newly introduced and rapidly spreading pathogen in the USA, warrant further evaluation and discussion.

Evaluation of the Zybio EXS3000 mass spectrometry in routine identification of Clinical isolates

The matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has been widely applied in routine clinical microbiology laboratories as an efficient and reliable technique for diagnostic purpose. In this work, we evaluated the performance of the newly developed Zybio EXS3000 (Zybio Inc., China) in microbial identification and compared it with VITEK MS (bioMérieux, France). For this study, a total of 1340 isolates from various clinical specimens were collected. These isolates were analyzed simultaneously on both EXS3000 and VITEK MS. The inconsistent or unidentifiable data were further identified using the help of either 16S rRNA gene or ITS region sequencing. During the study, we observed that EXS3000 and VITEK MS provided positive confirmatory diagnostics for 95.0% and 96.5% of the isolates, respectively, which were consistent with the sequencing results. However, it is worth noting that the EXS3000 system needs to improve the identification performance of Candida albicans in the follow-up. There are no significant differences between the two devices in terms of microbial identification performance. The advantage of EXS3000 over VITEK MS is in its ability to perform in significantly lesser time period. In conclusion, the results of this investigation showed that EXS3000 can be used to identify microorganisms in clinical microbiology laboratories.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Is Our Newborn Screening Working Well? A Literature Review of Quality Requirements for Newborn Blood Spot Screening (NBS) Infrastructure and Procedures.

Newborn screening using dried blood spots (NBS) is widely acknowledged as a highly successful procedure in secondary prevention. For a number of congenital disorders, severe disability or death are impressively prevented by early detection and early treatment through NBS. However, as with any other screening, NBS can also cause harm, and the principle that "the overall benefits of screening should outweigh the harms" must be considered when introducing and implementing NBS programmes. This publication compiles the results of a systematic literature research on requirements for NBS infrastructure and procedures which was conducted as part of a research project on the quality and shortcomings of the NBS pathway in Germany. The compilation contains the requirements and recommendations for realising the principle of "maximise benefits and minimise harms" in relevant NBS pathway components such as parental education and information, coverage, timeliness, laboratory quality assurance, follow-up of abnormal results, confirmatory diagnostics, documentation, and evaluation. The results reflect the complexity of NBS infrastructure, and thus, they illustrate the importance of considering and implementing NBS as a well-coordinated public health programme with continuous quality management. Special attention should be paid to the perspectives of parents and families. Some NBS issues can substantially benefit from digital instruments or international cooperation. The literature review presented here has contributed to a concept of proposals for the advancement of NBS in Germany, and despite different settings, it may as well be of interest for other countries to achieve the best possible course and outcome of NBS for each child.

Focus Issue Articles on Diagnostic Assay Development and Validation: The Science of Getting It Right

Focus Issue Articles on Diagnostic Assay Development and Validation: The Science of Getting It Right

Genome-Informed Multiplex Conventional PCR for Identification and Differentiation of Xanthomonas citri pv. citri Subpathotypes, the Causal Agents of Asiatic Citrus Canker

Asiatic citrus canker, one of the most important diseases of citrus, is caused by Xanthomonas citri pv. citri. It has high economic impact and can spread easily, and the disease is difficult to manage; it is a quarantine organism in many citrus-producing countries. X. citri pv. citri has been separated into three subpathotypes (A, A*, Aw) that differ in host range and geographical distribution, thus creating a need to differentiate subpathotypes for surveillance and disease management. Availability of useful diagnostic tools is the cornerstone of successful surveillance, quarantine, and eradication measures. In this study, a multiplex conventional PCR (cPCR) assay was developed for detection and subpathotype determination of X. citri pv. citri. Assay specificity was assessed by four different labs on a total of 146 X. citri pv. citri and 58 other Xanthomonas isolates. The assay demonstrated high analytical sensitivity, specificity, and selectivity. False negatives were observed with A Lineage 2 strains, and potential false positives were observed for X. citri pv. bilvae. Combined with a simple extraction protocol, the assay has been deployed successfully at the Plant Protection and Quarantine Plant Pathogen Confirmatory Diagnostics Laboratory. This assay has proven useful for differentiating Asiatic citrus canker subpathotypes from symptomatic citrus tissue. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Non-invasive identification of combined salinity stress and stalk rot disease caused by Colletotrichum graminicola in maize using Raman spectroscopy

Food security is an emerging problem that is faced by our civilization. There are millions of people around the world suffering from various kinds of malnutrition. The number of people that starve will only increase considering the continuous growth of the world’s population. The problem of food security can be addressed by timely detection and identification biotic and abiotic stresses in plants that drastically reduce the crop yield. A growing body of evidence suggests that Raman spectroscopy (RS), an emerging analytical technique, can be used for the confirmatory and non-invasive diagnostics of plant stresses. However, it remains unclear whether RS can efficiently disentangle biotic and abiotic stresses, as well as detect both of them simultaneously in plants. In this work, we modeled a stalk rot disease in corn by inoculating the plant stalks with Colletotrichum graminicola. In parallel, we subjected plants to salt stress, as well as challenging plants with both stalk rot disease and salinity stress simultaneously. After the stresses were introduced, Raman spectra were collected from the stalks to reveal stress-specific changes in the plant biochemistry. We found that RS was able to differentiate between stalk rot disease and salinity stresses with 100% accuracy, as well as predict presence of both of those stresses in plants on early and late stages. These results demonstrate that RS is a robust and reliable approach that can be used for confirmatory, non-destructive and label-free diagnostics of biotic and abiotic stresses in plants.

CTLA4 variant curation using adapted ACMG/AMP guidelines

BackgroundInborn errors of immunity (IEIs) are a group of heterogeneous diseases with broad phenotypes. Genetic testing has become the principal method of diagnosis for IEIs. However, confirmatory diagnostics rely on previous documentation of the variant, leaving clinicians and genetic counselors with a tremendous task when the variant is of uncertain significance (VUS) or with limited documentation. The American College of Medical Genetics and The Association for Molecular Pathology (ACMG/AMP) have published guidelines to determine whether a variant is pathogenic, VUS, or benign. However, in the context of IEIs, the ACMG/AMP guidelines might only fit partially due to the incomplete penetrance, high genetic heterogeneity, and extensive overlap between conditions seen in IEIs. For these reasons, the Antibody Deficiencies Variant Expert Panel (AD-VCEP, Table 1**) was created in 2021 to curate variants associated with IEIs. Each variant curated will reach FDA approval as part of the Clinical Genome Resource (ClinGen), an NIH-funded program to build a genomic knowledge base publicly available for laboratories, clinicians, and scientists.Table 1Members of the Antibody Deficiency (AD) VCEPMemberRoleAmber Begtrup, PhD, FACMGCo-Chair, ExpertAnne Puel, PhD.Co-Chair, ExpertNeil Romberg, M.D.Co-Chair ExpertAlejandro Nieto, Ph.DCoordinatorAsbjorg Stray-Pederson, MD, PhD, FACMGExpertCindy Ma, PhDExpertMichael Jordan, MDExpertMenno van Zelm, PhDExpertBertrand Boisson, PhDExpertCarrie Lucas, PhDExpertJes Maimaris, PhDExpertIlenia SimeoniExpertCharlotte Cunningham-Rundles, MD, PhDExpertLijun Wang, MD, PhDExpertWilliam Hankey, PhDBiocuratorXiao Peng, MDBiocuratorLindsay Worley, BscBiocuratorAnnapoorni Lakshmansagar, MScBiocuratorKyle Hilliard, MScBiocuratorAlex Wonnaparhown, MDBiocuratorArtem Kalinichenko, PhDBiocurator MethodsThe Antibody Deficiencies VCEP considers genes definitively associated with antibody immunodeficiencies, according to ClinGen. The first variants have been evaluated for autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency. ResultsThe AD-VCEP has developed gene-specific variant curation rules for twenty different ACMG-AMP evidence codes considered applicable to the CTLA4 gene. Thirty CTLA4 variants have been selected for a pilot study of the rule specifications, with seventeen nominated as suspected pathogenic, five as suspected benign, and eight as variants of unknown significance.Rule specifications remain in the development stage of the ClinGen approval process. Still, preliminary results indicate that gene-specific modifications to the phenotype (PP4), population frequency (BS1, BA1), and hot spot (PM1) codes have significantly impacted the variant classifications outcome for CTLA4 insufficiency.Modifications have included creating a point system to define probands with a phenotype highly specific to the disorder, setting allele frequencies in control populations, and defining potential hot spots based on functional data.In summary, the work of this AD-VCEP represents the first comprehensive adaptation of the ACMG-AMP guidelines to the IEIs and will help to standardize IEI variant curation.

High-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex.

Citrus leprosis (CiL) is one of the destructive emerging viral diseases of citrus in the Americas. Leprosis syndrome is associated with two taxonomically distinct groups of Brevipalpus-transmitted viruses (BTVs), that consist of positive-sense Cilevirus, Higrevirus, and negative-sense Dichorhavirus. The localized CiL symptoms observed in multiple citrus species and other alternate hosts indicates that these viruses might have originated from the mites and eventually adopted citrus as a secondary host. Genetic diversity in the genomes of viruses associated with the CiL disease complex have complicated current detection and diagnostic measures that prompted the application of High-Throughput Sequencing (HTS) protocols for improved detection and diagnosis. Two cileviruses are known to infect citrus, and among them only citrus leprosis virus C2 (CiLV-C2) hibiscus strain (CiLV-C2H) has been reported in hibiscus and passion fruit in the US. Based on our current CiL disease complex hypothesis, there is a high probability that CiL disease is associated with more viruses/strains that have not yet been identified but exist in nature. To protect the citrus industry, a Ribo-Zero HTS protocol was utilized for detection of cileviruses infecting three different hosts: Citrus spp., Swinglea glutinosa, and Hibiscus rosa-sinensis. Real-time RT-PCR assays were used to identify plants infected with CiLV-C2 or CiLV-C2H or both in mixed infection in all the above-mentioned plant genera. These results were further confirmed by bioinformatic analysis using HTS generated data. In this study, we utilized HTS assay in confirmatory diagnostics to screen BTVs infecting Dieffenbachia sp. (family: Araceae), Passiflora edulis (Passifloraceae), and Smilax auriculata (Smilacaceae). Through the implementation of HTS and downstream data analysis, we detected not only the known cileviruses in the studied hosts but also discovered a new strain of CiLV-C2 in hibiscus from Colombia. Phylogenetically, the new hibiscus strain is more closely related to CiLV-C2 than the known hibiscus strain, CiLV-C2H. We propose this strain to be named as CiLV-C2 hibiscus strain 2 (CiLV-C2H2). The findings from the study are critical for citrus growers, industry, regulators, and researchers. The possible movement of CiLV-C2H2 from hibiscus to citrus by the Brevipalpus spp. warrants further investigation.

First report of rice bacterial leaf blight disease caused by Pantoea ananatis in the United States.

In August 2021, bacterial leaf blight-like symptoms were observed on 14 out of 570 rice genotypes (Oryza sativa) in research field plots of global rice germplasm grown in Arkansas (eXtra Figure S1. A & B). The disease was characterized by spreading lesions on leaves, panicle sterility and reduced yield in highly susceptible, mature rice germplasm. No spread of disease to nearby plants was observed. Isolations were performed at Colorado State University, where soakates from symptomatic leaves were spread onto nutrient agar. After 72 h at 28°C, uniform, distinct, yellow-colored bacterial colonies were observed. To screen for the presence of common rice bacterial pathogens, PCR amplification directly from colonies or from DNA isolated from symptomatic field-collected leaves was performed. Primers specific for Xanthomonas oryzae pvs. oryzae and oryzicola (Lang et al., 2010), Burkholderia glumae (Echeverri-Rico et al., 2021), and Pseudomonas fuscovaginae (Ash et al., 2014) did not amplify indicating these organisms were not present. Sequencing of 16S rRNA gene (Weisburg et al., 1991) amplicons suggested the bacteria belonged to the genera Pantoea and Sphingomonas (NCBI accession no. OP683332 and OP683333, respectively). Amplicons resulting from primers specific to the gyrB gene region of P. ananatis (Kini et al., 2021) were sequenced and the fragment was compared to the P. ananatis PA13 reference genome using a BLAST analysis. One candidate (AR358) showed 100% identity with the P. ananatis gyrB region. Primers specific for Sphingomonas sp. (Bangratz et al., 2020) confirmed the second candidate (AR359) as a Sphingomonas sp. The identity of P. ananatis was confirmed by the Plant Pathogen Confirmatory Diagnostics Laboratory (Beltsville, MD, USA). To determine pathogenicity, leaves from 7-day-old seedlings of rice (Oryza sativa) cultivar Kitaake were scissor-clip inoculated (Kauffman et al., 1973) with four different treatments and compared to control leaves inoculated with sterile water. Treatments for the experiment consisted of bacterial suspensions (108 CFU/ml) of the two candidate organisms, P. ananatis (strain AR358) or Sphingomonas sp. (strain AR359), individually or in a 1:1 ratio of P. ananatis:Sphingomonas sp., or soakate from infected field tissue. Lesions similar to those observed in the field were only detected on leaves inoculated with P. ananatis or infected field tissue soakate at 7-days post-inoculation (eXtra Figure S1. C). Bacteria were recovered from the leaves of the artificially inoculated seedlings from three treatments (P. ananatis, P. ananatis:Sphingomonas sp. and soakate from the infected field tissue) and were determined to be P. ananatis based on colony morphology, amplification of 16s rRNA, and gyrB sequence data. Our results confirm the pathogenicity of P. ananatis to rice and fulfill Koch's postulates. P. ananatis was also recovered from several similarly diseased rice breeding lines at the University of Arkansas System Division of Agriculture Rice Research and Extension Center. We conclude that P. ananatis is the causal pathogen for leaf blight-like symptoms observed in the global rice cultivars grown in Arkansas. P. ananatis was previously reported as a pathogen on rice in several rice growing regions, including China (Yu et al., 2021), India (Reshma et al., 2022), and Africa (Kini et al., 2017), however, this is the first report of P. ananatis as a pathogen of rice in the United States.

German newborn screening for Cystic fibrosis: Parental perspectives and suggestions for improvements.

Cystic fibrosis (CF) was added to the German newborn bloodspot screening (NBS) panel in 2016. This study assesses parental perceptions of CF-NBS and confirmatory testing. Prospective questionnaire-based survey administered to parents of children with positive CF-NBS over 40 months after initiation of CF-NBS in Southwest Germany. Parental perceptions were compared to results from Bavaria and Switzerland. Questionnaires with 29 standardized questions were sent to 343 families with children born between October 2016 and January 2020. A total of 178 (51.9%) replied. Although required by law, only a minority were informed about CF-NBS by a physician. The information provided about NBS was sufficient for 78% of parents. Regarding the information about positive CF-NBS, 52.9% were satisfied but the majority expressed negative emotions (89.5%). While most of these were resolved after confirmatory diagnostics, 17% of parents of children with false-positive CF-NBS and 66.7% of children confirmed with CF remained anxious. Waiting time for sweat testing was >3 days in 56.1%, considerably longer than in more centralized screening systems. Parents who waited for a maximum of 3 days were significantly more satisfied. 70.7% of parents were satisfied with the information given during confirmatory diagnostics and 91.4% were satisfied with participating in CF-NBS. CF-NBS stands in high regard with parents. Smooth organization, timely initiation of confirmatory testing, and professional communication are most important to limit parental anxiety. A more centralized system of confirmatory diagnostics appears advantageous in several regards as it reduces time from positive NBS to final diagnosis and increases parental satisfaction.

Confirmatory detection and identification of biotic and abiotic stresses in wheat using Raman spectroscopy.

Wheat is one of the oldest and most widely cultivated staple food crops worldwide. Wheat encounters an array of biotic and abiotic stresses during its growth that significantly impact the crop yield and consequently global food security. Molecular and imaging methods that can be used to detect such stresses are laborious and have numerous limitations. This catalyzes the search for alternative techniques that can be used to monitor plant health. Raman spectroscopy (RS) is a modern analytical technique that is capable of probing structure and composition of samples non-invasively and non-destructively. In this study, we investigate the accuracy of RS in confirmatory diagnostics of biotic and abiotic stresses in wheat. Specifically, we modelled nitrogen deficiency (ND) and drought, key abiotic stresses, and Russian wheat aphid (Diuraphis noxia) infestation and viral diseases: wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV), economically significant biotic stresses in common bread wheat. Raman spectra as well as high pressure liquid chromatography (HPLC)-based analyses revealed drastically distinct changes in the intensity of carotenoid vibration (1185 cm-1) and in the concentration of lutein, chlorophyll, and pheophytin biomolecules of wheat, triggered in response to aforementioned biotic and abiotic stresses. The biochemical changes were reflected in unique vibrational signatures in the corresponding Raman spectra, which, in turn could be used for ~100% accurate identification of biotic and abiotic stresses in wheat. These results demonstrate that a hand-held Raman spectrometer could provide an efficient, scalable, and accurate diagnosis of both biotic as well as abiotic stresses in the field.

Maternal Vitamin B12 Deficiency Detected by Newborn Screening-Evaluation of Causes and Characteristics.

Vitamin B12 deficiency, mostly of maternal origin in newborns, is a well-treatable condition but can cause severe neurologic sequelae in infants. Early detection of vitamin B12 deficiency allows the pre-symptomatic treatment of affected children. This evaluation assesses the characteristics of maternal vitamin B12 deficiency detected by newborn screening. In a prospective single-center study, a systematic screening strategy for vitamin B12 deficiency using a combination of two second-tier strategies was applied. In addition to confirmatory diagnostics in children, the systematic work-up of vitamin B12 status was also performed for their mothers. Maternal characteristics were assessed including ethnic origin, diet, and vitamin supplementation during pregnancy. For affected mothers, a work-up by internal medicine was recommended. In total, 121 mother–infant couples were analyzed. 66% of mothers adhered to a balanced diet including meat. The cause of maternal vitamin B12 deficiency was unknown in 56% of cases, followed by dietary causes in 32%, and organic causes in 8%. All mothers following a vegan diet and most mothers with a vegetarian diet took vitamin preparations during pregnancy, whereas only 55.8% of mothers with a balanced diet took folic acid or other vitamins. Maternal vitamin B12, folic acid, and homocysteine levels were significantly correlated with the child’s folic acid levels, and with homocysteine, methylmalonic, and methylcitric acid levels in first and second NBS dried blood spots. Most children had normal blood counts and showed normocytosis. Although 36.7% of mothers showed anemia, only one presented with macrocytosis. Adherence to vitamin supplementation in pregnancy is low despite the recommendation for supplementation of folic acid. Ideally, the evaluation of mothers for vitamin B12 levels and appropriate therapy should be initiated in early pregnancy. In infants detected through newborn screening, the multidisciplinary assessment and therapy of both children and mothers should be performed.

Smilax auriculata: A new host for Orchid fleck dichorhavirus identified in Florida, USA.

In June 2020, Orchid fleck virus (OFV) was detected in a species of Liriope in Leon and Alachua County, Florida (Fife et al; 2021). In October of the same year, four adjacent dune/ear-leaf greenbrier vines, Smilax auriculata (Smilaceae: Liliales), showed yellowing and mottling symptoms (Figure 1). Infected and healthy S. auriculata leaves samples were collected in Alachua County by the Florida Department of Agriculture and Consumer Services, Gainesville, Florida. OFV primers successfully detected in four Smilax samples by conventional RT-PCR assay. Amplicon sequences (Acc. No. MZ645935 and MZ645938) shared 99% nucleotide identity with OFV infecting orchids (LC222629) and citrus (MK522804). The OFV subgroup I (OFV-Orc1) and subgroup II (OFV-Orc2) specific primers (Kondo et al 2017) were utilized to confirm the presence of OFV type strains infecting Smilax. Sanger sequencing of subgroup I specific amplicons (MZ645934) shared 99% nucleotide identity with OFV-Orc1 (LC222629) whereas subgroup II specific amplicon sequence (MZ645930) shared 98-99 % nucleotide identity with OFV-Orc2 (AB244417). Further confirmation was done by USDA-APHIS-PPQ-Plant Pathogen Confirmatory Diagnostics Laboratory utilizing optimized conventional RT-PCR protocols (Roy et al. 2020) and deep sequencing on a on a NextSeq550 Illumina platform. Assembled reads identified seven non-overlapping viral contigs. Five RNA1 and two RNA2 contigs covered more than 97% of the bipartite OFV genome with average coverage depth of 5297.61 and 5186.04, respectively. Contigs of RNA1 and RNA2 shared 98-99% nt identity to OFV-Orc2-RNA1 (AB244417) and OFV-Orc-RNA2 (AB244418 and LC222630). No other pathogen sequences were identified. This is the first time the genus Smilax has been identified as a natural host of OFV. Very recent findings of OFV-Orc in Florida in Liriope, Aspidistra, and Ophiopogon among the Asparagaceae family members (Fife et al; 2021) and now in the Smilacaceae suggest a broader host range of the virus than previously known; further research should be conducted to better characterize the potential risk of introduction into citrus in Florida.