Comprehensive Surgical Staging Research Articles

Laparoscopic versus laparotomic surgical treatment in apparent stage I ovarian cancer: a multi-center retrospective cohort study

BackgroundLaparoscopic treatment shows non-inferior survival outcomes and better surgical outcomes in apparent stage I ovarian cancer (OC) in some studies but has not been well defined.MethodsWe conducted a retrospective study of patients with apparent stage I OC treated in two hospitals between 2012 and 2022. The surgical and oncologic outcomes were evaluated between patients receiving laparoscopic and laparotomic surgery.ResultsWe identified 37 patients with apparent stage I OC, including 15 (40.5%) serous carcinomas, 9 (24.3%) mucinous cancers, 3 (8.1%) endometroid cancers, 2 clear cell carcinomas, and 8 (21.6%) non-epithelial cancers. Sixteen patients received laparoscopic surgery and the other 21 patients underwent laparotomic surgery. The median age (44.5 vs. 49.0 years), mean mass size (10.5 vs. 11.3 cm), and median follow-up time (43.5 vs. 75.0 months) showed no statistically significant differences between patients in laparoscopic and laparotomic groups (all P > 0.05). All the patients underwent comprehensive surgical staging surgery, and the mean surgical time (213.5 vs. 203.3 min, P = 0.507), number of lymph nodes sampling (18.6 vs. 17.5, P = 0.359), proportion of upstaging (12.5% vs. 19.0%, P = 0.680), and postoperative complications (no Accordion Severity Grading System grade ≥ 3) were comparable between two surgical groups. Moreover, patients in the laparoscopic group had significantly less intraoperative blood loss (231.3 vs. 352.4 mL, P = 0.018), shorter interval between surgery and postoperative adjuvant chemotherapy (7.4 vs. 9.5 days, P = 0.004), shorter length of hospital stay (9.9 vs. 13.8 days, P < 0.001) than those treated with laparotomic surgery. During a median follow-up of 54.0 months, 9 (24.3%) relapsed and 1 (2.7%) died, with a 5-year recurrence-free survival (RFS) and disease-specific survival (DSS) rate of 70.6% and 100%, respectively. However, the 5-year RFS (93.3% vs. 58.8%, P = 0.084) and DSS (100% vs. 100%, P = 0.637) rates did not significantly differ between the two groups.ConclusionLaparoscopic surgical treatment had less intraoperative blood loss, earlier postoperative adjuvant chemotherapy administration, shorter hospitalization time, and non-inferior survival outcomes in apparent stage I OC when compared with laparotomic surgery.

Reproductive outcomes after conservative treatment in early and advanced stage MOGCTs

BackgroundMalignant ovarian germ cell tumors usually occur in young women. The standard of care is fertility sparing surgery and comprehensive surgical staging followed by adjuvant chemotherapy with BEP (bleomycin, etoposide, cisplatin) if needed. The aim of this study was to analyze the reproductive outcomes after conservative treatment in patients diagnosed, treated and followed up in MITO (Multicenter Italian Trials in Ovarian Cancer) centers. MethodsA questionnaire concerning gynecological symptoms, reproductive outcomes and fertility treatment was administered to 164 MOGCTs survivors. Data regarding patients deceased were collected from MITO-9 database. There were 114 patients diagnosed at reproductive age between 1983 and 2019 included. Results109 patients answered the questionnaire and 5 patients decesased were included (median age 24.9 years). 78.1% were stage I,4.4% stage II, 14.9% stage III and 2.6% stage IV. 57.9% received chemotherapy, the mean number of cycles was 4.1. Median time to menstrual recovery after BEP was of 5.6 months range, only 1 case of premature ovarian failure was reported. Among the 114 patients 38 (33.3%) attempted to become pregnant, 29/38 (76.3%) got pregnant with a total of 44 conceptions. 40.9% received chemotherapy and 22.9% did not (p 0.048). Pregnancy desire was the only predictive factor associated with live births among women who attempted pregnancy after treatment. ConclusionsAs MOGCTs affect women of child-bearing age, fertility preservation represents a major treatment issue. Our results are consistent with the available evidence, confirming that adjuvant chemotherapy for MOGCT does not impact the reproductive function and fertility.

Practice patterns, time trends and quality of care of uterine cancer in Belgium: An analysis of the EFFECT database

ObjectivesTo investigate the practice patterns and quality of care for uterine cancer on a national level in Belgium, including trends in practice over the period 2012–2016. MethodsQuality indicators were measured using the EFFectiveness of Endometrial Cancer Treatment (EFFECT) database. Multivariable logistic mixed regression was used to test for associations between the quality indicators and year of diagnosis, adjusted for potential confounders and intra-cluster correlations. ResultsThe EFFECT database includes 4178 patients diagnosed with uterine cancer in the period 2012–2016. Minimally invasive surgery (laparoscopic or robotic-assisted) was applied in 61.6% of patients who had surgery for clinical stage I endometrial carcinoma (EC), increasing from 52.9% in 2012 to 66.4% in 2016. At least pelvic lymph node staging was performed in 69.0% of patients with clinical stage I, high-grade EC; and in 63.9% of patients with clinical stage I-II serous carcinoma, clear cell carcinoma or carcinosarcoma. The latter increased from 48.8% in 2012 to 77.2% in 2016. Adjuvant radiotherapy (external beam and/or brachytherapy) was offered to 33.5% of patients who had surgery without lymph node staging for pathological stage I EC at high-intermediate or high risk of recurrence. Adjuvant chemotherapy was administered to 64.4% of patients with pathological stage III-IVA EC. ConclusionsStudy results indicate an overall good quality of care for patients with uterine cancer in Belgium. Treatment areas with potential room for improvement include the use of minimally invasive surgery, comprehensive surgical staging and adjuvant therapy, which confirms the remaining controversies in uterine cancer treatment and the need for further research.

Feasibility of Sentinel Lymph Node Biopsy in Early-Stage Epithelial Ovarian Cancer: A Systematic Review and Meta-Analysis.

Sentinel lymph node biopsy (SLNB) has been widely adopted in the management of early-stage gynaecological cancers such as endometrial, vulvar and cervical cancer. Comprehensive surgical staging is crucial for patients with early-stage ovarian cancer and currently, that includes bilateral pelvic and para-aortic lymph node assessment. SLNB allows the identification, excision and pathological assessment of the first draining lymph nodes, thus negating the need for a full lymphadenectomy. We systematically searched the MEDLINE, Embase and Cochrane Central Register of Controlled Trials (CENTRAL) databases (from inception to 3 November 2022) in accordance with Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA). Our search identified 153 articles from which 11 were eligible for inclusion. Patients with clinical stage I-II ovarian cancer undergoing sentinel lymph node biopsy were included. Statistical analysis was performed in RStudio using the meta package, where meta-analysis was performed for the detection. The risk of bias was assessed using the Quality Assessment of Diagnostic Accuracy Studies C (QUADAS-C) tool. Overall, 11 observational studies met the predetermined criteria and these included 194 women. The meta-analysis showed that the detection rate of sentinel lymph nodes in early-stage ovarian cancer was 94% (95% CI of 86% to 1.00%). Significant heterogeneity was noted among the studies with Q = 47.6, p < 0.0001, I2 = 79% and τ2 = 0.02. Sentinel lymph nodes in early-stage ovarian cancer have a high detection rate and can potentially have applicability in clinical practice. However, considering the small number of participants in the studies, the heterogeneity among them and the low quality of evidence, the results should be interpreted with caution. Larger trials are needed before a change in clinical practice is recommended.

Long-term outcome of minimally invasive staging surgery for clinical stage I endometrial cancer: A single institute experience in Taiwan.

Endometrial cancer is the most common gynecological cancer in developed countries. With recent advances in equipment and knowledge, minimally invasive surgery (MIS) is widely accepted for the treatment of endometrial cancer. This study had the largest number of cases to date in Taiwan, comparing outcomes between MIS and laparotomy staging surgery using real-world data with long-term follow-up. We retrospectively reviewed patients with clinical stage 1 endometrial cancer from 2009 to 2020 in our institute. All patients underwent comprehensive surgical staging procedures by MIS or laparotomy. The safety, morbidity, progression-free survival (PFS), and overall survival (OS) rates of the two groups were compared. Clinical and pathologic factors were compared with Chi-square and Fisher Exact test. PFS and OS were estimated by the Kaplan-Meier method. Differences between survival curves were analyzed using the log-rank test. A p value of <0.05 was considered statistically significant. Using Cox proportional hazards models, all factors found to be significantly associated with risk of recurrence on univariate analyses were then assessed together through multivariable models, resulting in a final oncologic outcome between MIS and laparotomy. A total of 665 cases (412 cases in MIS group and 253 cases in laparotomy group) were enrolled for data analysis. Median operation time was shorter in MIS group (244 and 265 minutes, p < 0.001). Median blood loss was also less (75 and 430 mL, p < 0.001). Median postoperative hospitalization duration was longer in the laparotomy group (2 and 7 days, p = 0.001). After adjusting presurgery risk factors, the PFS and OS were no significant difference in MIS and laparotomy groups. Using real-world data with long-term follow-up, we could confirm excellent PFS and OS in selective patients with clinical stage 1 endometrial carcinoma who received MIS, and the surgical time, hospital day, and blood loss were also less.

Evaluation of Borderline Ovarian Tumor Recurrence Rate after Surgery with or without Fertility-Sparing Approach: Results of a Retrospective Analysis.

Borderline ovarian tumors (BOTs) comprise 15-20% of primary ovarian neoplasms and represent an independent disease entity among epithelial ovarian cancers. The present study (Clinical Trial ID: NCT05791838) aimed to report a retrospective analysis of the management and outcomes of 86 consecutive BOTs patients, 54 of which were at a reproductive age. All patients with BOTs undergoing surgical treatment from January 2010 to December 2017 were included. Data were retrospectively reviewed. High levels of Ca-125 were observed in 25.6% of the FIGO stage I patients and 58.3% of the advanced disease patients. Fertility-sparing surgery and comprehensive surgical staging were performed in 36.7% and 49.3% of the patients, respectively. Laparotomy was the most frequent surgical approach (65.1%). The most common diagnosis at frozen sections was serous BOT (50.6%). Serous BOTs have significantly smaller tumor diameters than mucinous BOTs (p < 0.0001). The mean postoperative follow-up was 29.8 months (range 6-87 months). Three patients experienced a recurrence, with an overall recurrence rate of 3.5% (10% considering only the patients who underwent fertility-sparing treatment). BOTs have low recurrence rates, with excellent prognosis. Surgery with proper staging is the main treatment. Conservative surgery is a valid option for women with reproductive potential.

Detection rate and diagnostic accuracy of sentinel-node biopsy in early stage ovarian cancer: A prospective multicentre study (SELLY).

e17579 Background: Comprehensive surgical staging of early epithelial ovarian cancer includes systematic paraaortic and bilateral pelvic lymphadenectomy but its therapeutic role is controversial and it is associated with potential severe morbidity. The feasibility of sentinel lymph-node (SLN) identification in early stage ovarian cancer has been shown only. We did a prospective multicenter study to assess the feasibility, detection rate and diagnostic accuracy of the SLN procedure in predicting the pathological pelvic-node status in patients with early stage ovarian cancer. Methods: This is a phase II single arm study (EUDRACT 2019-001088-58) including patients with presumed stage I-II epithelial ovarian cancer planned for immediate or delayed minimally-invasive comprehensive staging. The ovarian pedicle is injected with 2 mL of a 1.25 mg/mL indocyanine green (ICG) solution. The pelvic and lumbo-aortic retroperitoneum is then accessed and inspected to identify and remove SLNs. Staging is then completed including systematic pelvic and para-aortic lymphadenectomy and an histopathological examination of all nodes is performed. The primary endpoint was estimation of the sensitivity and sensibility of SLN in predicting nodal status. Assuming a sensitivity of 98.5% in predicting positive sentinel lymph nodes at histology, a pathological lymph node prevalence of 14.2%, a precision of estimate (i.e. the maximum marginal error) d=5%, a type I error α = 0.05, a sample size of 141 patients is needed to test the general hypothesis (i.e. to answer whether SLN(s) identified with ICG can accurately predict nodal status at histology of patients with apparently early EOC). Assuming a drop-out rate of 20%, a total of 176 patients will be enrolled in the study. Results: One-hundred and seventy-six patients were included with a drop-out rate of 22%. Sentinel node was identified in 102 patients (detection rate, 58%, [95% CI: 51-65]). There were no clinical differences between patients with successful or unsuccessful mapping. Both the infundibolopelvic ligament and the legamentum ovarii proprium were injected in 29.0% of cases. Twenty-one patients had positive nodes and 71% of them showed successful mapping. Among the latter, a negative sentinel node was identified in 3 patients (Sensitivity 78.6% [95% CI: 57-100]; Specificity 100%; Accuracy 97% [95% CI: 94-100]; PPV 100%; NPV 96,6% [95% CI: 93-100]). Twenty-two (12.5%) intra- and 25 (14.2%) postoperative complications occurred (12 G1; 9 G2; 2 G3, 2 G4). Clinical trial information: EUCTR2019-001088-58 .

The clinico pathological features and survival in serous endometrial cancers

Background & IntroductionSerous cancers are a biologically aggressive variety of endometrial cancer (EC) with a high rate of recurrence and mortality among all the subtypes. Herein we describe our experience with serous endometrial cancer. ObjectiveThis study was conducted to identify the clinicopathological characteristics, treatment modalities and survival outcomes in women diagnosed with serous endometrial malignancies. MethodsThis was a retrospective descriptive analysis of data on patients diagnosed with serous endometrial tumours between January 2010 to September 2019 in our institute collected from electronic medical records. Descriptive statistics such as proportions, means and standard deviations and Cox regression hazards model on risk factors were performed. Survival was plotted by Kaplan-Meier curves. ResultsDuring the study period, 32 (5.7%) patients out of 564 diagnosed cases of endometrial cancer had serous histology. The mean age at diagnosis was 62.5 years (SD 7.6) while mean BMI was 26.4 kg/m2 (SD 4.6). Staging laparotomy was done in 27(84%) of the patients. Advanced stages (III and IV) were detected in 16 patients (50%) at primary surgery.Adjuvant chemo therapy and radiation was received by 21(65.6%) patients therapy. Out of 32 patients, 13 (40%) developed recurrence while another 13 expired. Stage at diagnosis and type of adjuvant therapy were important factors in determining the outcome. Median recurrence free and overall survival was 22(95% CI 1.4–42) and 36 months (95% CI 10.1–61.8) respectively. ConclusionSerous endometrial cancers are an intrusive subtype of EC. Comprehensive surgical staging with optimal cytoreduction should be aimed at. Adequate upfront molecular categorization of these tumors is mandated. Adjuvant therapy with chemotherapy and radiation is given in postoperative setting. Targeted therapies and immunotherapy could be considered in recurrences.

Placenta accreta spectrum into the parametrium, morbidity differences between upper and lower location

Objective To demonstrate the surgical and morbidity differences between upper and lower parametrial placenta invasion (PPI). Materials and methods Forty patients with placenta accreta spectrum (PAS) into the parametrium underwent surgery between 2015 and 2020. Based on the peritoneal reflection, the study compared two types of parametrial placental invasion (PPI), upper or lower. Surgical approach to PAS follows a conservative-resective method. Before delivery, surgical staging by pelvic fascia dissection established a final diagnosis of placental invasion. In upper PPI cases, the team attempted to repair the uterus after resecting all invaded tissues or performing a hysterectomy. In cases of lower PPI, experts performed a hysterectomy in all cases. The team only used proximal vascular (aortic occlusion) control in cases of lower PPI. Surgical dissection for lower PPI started finding the ureter in the pararectal space, ligating all the tissues (placenta and newly formed vessels) to create a tunnel to release the ureter from the placenta and placenta suppletory vessels. Overall, at least three pieces of the invaded area were sent for histological analysis. Results Forty patients with PPI were included, 13 in the upper parametrium and 27 in the lower parametrium. MRI indicated PPI in 33/40 patients; in three, the diagnosis was presumed by ultrasound or medical background. The intrasurgical staging categorizes 13 cases of PPI performed and finds diagnosis in seven undetected cases. The expertise team completed a total hysterectomy in 2/13 upper PPI cases and all lower PPI cases (27/27). Hysterectomies in the upper PPI group were performed by extensive damage of the lateral uterine wall or with a tube compromise. Ureteral injury ensued in six cases, corresponding to cases without catheterization or incomplete ureteral identification. All aortic vascular proximal control (aortic balloon, internal aortic compression, or aortic loop) was efficient for controlling bleeding; in contrast, ligature of the internal iliac artery resulted in a useless procedure, resulting in uncontrollable bleeding and maternal death (2/27). All patients had antecedents of placental removal, abortion, curettage after a cesarean section, or repeated D&C. Conclusions Lower PAS parametrial involvement is uncommon but associated with elevated maternal morbidity. Upper and lower PPI has different surgical risks and technical approaches; consequently, an accurate diagnosis is needed. The clinical background of manual placental removal, abortion, and curettage after a cesarean or repeated D&C could be ideally studied to diagnose a possible PPI. For patients with high-risk antecedents or unsure ultrasound, a T2 weight MRI is always recommended. Performing comprehensive surgical staging in PAS allows the efficient diagnosis of PPI before using some procedures.

Somatic BAP1 Loss in Ovarian Serous Borderline Tumor and Recurrent Low-grade Serous Carcinoma From a Germline BAP1 Mutation Carrier.

To the Editor: In a recent issue, Dr. Oliva and colleagues proposed the use of the immunohistochemical markers, Claudin-4 and BAP1, to distinguish between low-grade serous neoplasms and peritoneal mesothelioma 1. This article is of particular interest to us, as we have recently published on a cohort of 119 clinically annotated low-grade serous carcinomas, confirmed by central pathology review, with molecular profiling by targeted next-generation sequencing 2. In this cohort, we encountered 1 patient who represents an unusual exception to relying on loss of BAP1 expression to exclude the diagnosis of a low-grade serous neoplasm. This was a 59-yr-old female who underwent comprehensive surgical staging for bilateral ovarian masses. Final pathology revealed a stage IIIC serous borderline tumor involving bilateral ovaries (Fig. 1A), associated with noninvasive peritoneal implants and involvement of pelvic lymph nodes. After 7 yrs, she developed recurrent disease involving the sigmoid colon, in the form of metastatic low-grade serous carcinoma (Fig. 1B). Both primary and recurrent tumors showed a similar immunophenotype, characterized by strong diffuse expression of epithelial/Mullerian markers, including Claudin-4 (Fig. 1C), BerEP4, PAX8, ER, and PR, while negative for markers of mesothelial differentiation, namely, calretinin, and D2-40. Somatic mutational profiling by targeted next-generation sequencing revealed the low-grade serous carcinoma to harbor a BAP1 frameshift mutation (Y241Lfs*2). Germline testing further revealed a heterozygous BAP1 germline mutation (c.1110dupC, p.Met371Hisfs*27). Loss of BAP1 expression by immunohistochemistry in the low-grade serous carcinoma, as well as the prior serous borderline tumor (Fig. 1D), was consistent with bi-allelic inactivation of BAP1 as an early event in the molecular pathogenesis of this case.FIG. 1: Low-grade serous neoplasms associated with germline BAP1 mutation. (A) Ovarian serous borderline tumor showing characteristic hierarchical branching papillae lined by stratified columnar epithelium (inset: ciliated cells observed at high-magnification, consistent with tubal differentiation). (B) Recurrent invasive low-grade serous carcinoma involving muscularis propria of the sigmoid colon, showing infiltrating nests and micropapillae composed of tumor cells with small monotonous nuclei, and scattered psammoma bodies. Immunohistochemical analysis of the serous borderline tumor showing (C) diffuse expression of Claudin-4 and (D) loss of BAP1 expression in tumor cells with retained nuclear staining in non-neoplastic stromal cells.To our knowledge, this represents the first reported case of a BAP1-deficient low-grade serous neoplasm. It illustrates how genetic alterations of oncogenes and tumor suppressor genes are not tissue or disease-specific and emphasizes the importance of applying several cell lineage markers, along with morphologic correlation, for appropriate diagnostic classification of tumor type.

Comprehensive surgical staging for placenta accreta spectrum

Objective To analyze how precise the surgical staging is after prenatal diagnosis of patients with placenta accreta spectrum (PAS). Material and methods This was a retrospective cohort study that included 622 women diagnosed with placenta accreta spectrum who underwent surgery between 1 January 2000, and 1 January 2020, in public, private, and university hospitals in Buenos Aires, Argentina. Prenatal diagnosis included abdominal and transvaginal ultrasounds and T2-weighted MRI scans. Comprehensive surgical staging (CSS) was performed by dissecting the coalescence spaces of the pelvic fasciae, including the broad ligament and the colpouterine and retrouterine spaces. Once the compromised uterine wall (lateral, anterior or posterior) was identified, the characteristics of the lesion were evaluated. The lateral invasion was classified as type A when there was no placental tissue in the parametrial zone; type B when the placental tissue protruded laterally and was covered by serosa, and type C when the placental tissue included neoformed vessels. Involvement of the retrovesical space (anterior uterine wall) was classified as type A when no neoformed vessels and no firm adherence between nearby organs were present, type B when the retrovesical area partially adhered but the planes could be dissected, and type C when the lower dissection of the vesicouterine space was extremely adhered or impossible. The posterior uterine aspect was classified after exteriorizing the organ, with the placenta still inside. It was determined as type A when there was no evidence of placental invasion, type B when there was organ adherence or it showed a heterogeneous appearance of the posterior uterine wall above the peritoneal reflection, and type C when there was adherence to other organs or when the invasion or neovascularization was below the peritoneal reflection. Results CSS increases the efficacy of prenatal studies, including ultrasound and MRI, by up to 50%. The diagnosis of type 2 (parametrial) PAS or low retrovesical invasion implied an immediate modification of the surgical tactics, vascular control, or a specific type of surgery. Additionally, deep interfacial dissection allowed the identification of healthy uterine tissue, modifying the initial indication of hysterectomy for a conservative reconstructive procedure. Conclusions Comprehensive surgical staging of PAS proved to be an excellent tool for determining the extent and specific topography of placental invasion

Highly specific selenium nanosystems for fluorescent image-guided rapid diagnosis and pathological grading of ovarian malignant tumors

Comprehensive surgical staging or optimal tumor cytoreductive surgery of malignant ovarian cancer directly affects disease prognosis. Therefore, a fluorescent selenium nanoparticle (Se@RGD/S2.2) decorated with cancer-targeting Arg-Gly-Asp (RGD) peptides and GCAGTTGATCCTTTGGATACCCTGG aptamer (S2.2) was developed for use as a diagnostic agent to achieve rapid, noninvasive diagnosis and visualization of microinvasive lesions during surgery for malignant ovarian cancer.

Endometrial cancer molecular profiling in a Caribbean-Black patient population (404)

Objectives: To characterize the molecular profiles of endometrial cancer (EC) and correlate with clinical outcomes in a Caribbean- Black patient population. Methods: A multi-center retrospective analysis of Caribbean-Black patients with surgically staged EC from 2015-2021 was conducted. All patients underwent comprehensive surgical staging and/or tumor debulking and molecular tumor profiling performed on pathologic specimens via next-generation sequencing (NGS). Tumors were classified based on TCGA/ProMisE classification: MMR deficient (MMR-d/ MSI-H), p53 abnormal (p53abn), p53 wild type (p53wt), and POLE mutated (POLEmut). Differences in the frequencies of histologic subtypes, stage distribution, and adjuvant therapy were compared using Pearson’s Chi-square test. Progression-free survival (PFS) and overall survival (OS) rates were calculated between p53abn versus other mutational profiles (p53wt and MMR-d/MSI-H) using Kaplan- Meier estimates. Multivariate analysis (MVA) was performed using Cox proportional hazards model. Results: Of the 119 patients meeting inclusion criteria, the final analysis included 76 patients with complete follow-up data. Tumors were classified as MMR-d/MSI-H (n=11, 14.5%), p53abn (n=43, 56.6%), p53wt (n=21, 27.6%), and POLEmut (n=1, 1.3%). The median age at diagnosis was 64 years (range: 26-82). Histology included 44.0% endometrioid, 47.5% uterine serous (USC), 14.5% carcinosarcoma, and 8.5% clear cell adenocarcinomas. There was no significant difference in the stage distribution between different mutation profiles (p=0.725). USC tumors were associated with p53abn, and endometrioid tumors were associated with MMR-d/MSI-H (p<0.01). All carcinosarcoma patients were p53abn. Patients with p53abn tumors were significantly more likely to receive chemotherapy alone or in combination with radiotherapy versus all other cohorts (p<0.01). One patient with stage IA endometrioid tumor demonstrated POLEmut; this patient remains recurrence-free without adjuvant therapy and was excluded from survival analyses. When compared to all other mutational profiles, p53abn tumors trended towards poorer PFS (29 vs 22 months, respectively; p=0.209) and OS (not reached vs 43 months respectively; p=0.102). On MVA, USC histology and p53abn were significant independent predictors of survival (p=0.03 and p=0.05, respectively). Conclusions: Tumors with p53abn are found in more than half of Caribbean-Black EC patients, with an overrepresentation of aggressive type II histologies in this population compared to those previously reported in the general population. Although not reaching statistical significance, there is a trend towards worse survival outcomes in these p53abn tumors. Further studies are warranted to evaluate EC adjuvant therapy in the context of molecular profiles to improve outcomes for this high-risk patient population. Objectives: To characterize the molecular profiles of endometrial cancer (EC) and correlate with clinical outcomes in a Caribbean- Black patient population. Methods: A multi-center retrospective analysis of Caribbean-Black patients with surgically staged EC from 2015-2021 was conducted. All patients underwent comprehensive surgical staging and/or tumor debulking and molecular tumor profiling performed on pathologic specimens via next-generation sequencing (NGS). Tumors were classified based on TCGA/ProMisE classification: MMR deficient (MMR-d/ MSI-H), p53 abnormal (p53abn), p53 wild type (p53wt), and POLE mutated (POLEmut). Differences in the frequencies of histologic subtypes, stage distribution, and adjuvant therapy were compared using Pearson’s Chi-square test. Progression-free survival (PFS) and overall survival (OS) rates were calculated between p53abn versus other mutational profiles (p53wt and MMR-d/MSI-H) using Kaplan- Meier estimates. Multivariate analysis (MVA) was performed using Cox proportional hazards model. Results: Of the 119 patients meeting inclusion criteria, the final analysis included 76 patients with complete follow-up data. Tumors were classified as MMR-d/MSI-H (n=11, 14.5%), p53abn (n=43, 56.6%), p53wt (n=21, 27.6%), and POLEmut (n=1, 1.3%). The median age at diagnosis was 64 years (range: 26-82). Histology included 44.0% endometrioid, 47.5% uterine serous (USC), 14.5% carcinosarcoma, and 8.5% clear cell adenocarcinomas. There was no significant difference in the stage distribution between different mutation profiles (p=0.725). USC tumors were associated with p53abn, and endometrioid tumors were associated with MMR-d/MSI-H (p<0.01). All carcinosarcoma patients were p53abn. Patients with p53abn tumors were significantly more likely to receive chemotherapy alone or in combination with radiotherapy versus all other cohorts (p<0.01). One patient with stage IA endometrioid tumor demonstrated POLEmut; this patient remains recurrence-free without adjuvant therapy and was excluded from survival analyses. When compared to all other mutational profiles, p53abn tumors trended towards poorer PFS (29 vs 22 months, respectively; p=0.209) and OS (not reached vs 43 months respectively; p=0.102). On MVA, USC histology and p53abn were significant independent predictors of survival (p=0.03 and p=0.05, respectively). Conclusions: Tumors with p53abn are found in more than half of Caribbean-Black EC patients, with an overrepresentation of aggressive type II histologies in this population compared to those previously reported in the general population. Although not reaching statistical significance, there is a trend towards worse survival outcomes in these p53abn tumors. Further studies are warranted to evaluate EC adjuvant therapy in the context of molecular profiles to improve outcomes for this high-risk patient population.

Different Surgical Approaches for Early-Stage Ovarian Cancer Staging. A Large Monocentric Experience

IntroductionOvarian cancer is the third most frequent gynecological cancer. In early stage ovarian cancer (ESOC) comprehensive surgical staging is recommended. Surgical staging is traditionally approached by laparotomy, although minimally invasive surgery can be a valid alternative in selected patients. This study aims to analyze the surgical and oncological outcomes of three different surgical approaches in a large series of patients.MethodsWe retrospectively included all histologically proven ESOC cases treated between January 2014 and December 2017. ESOC was defined as stage IA to IIB according to the 2018 FIGO staging system. Subjects were divided into groups 1, 2, and 3, based on the surgical approach (open abdominal, laparoscopic, or robotic, respectively).ResultsWithin patients enrolled during the study period, 455 met the inclusion criteria. No difference in intraoperative complications was recorded in the three groups (p = 0.709). Conversely, a significant difference occurred in postoperative complications (16.2 vs. 3.8 vs. 11.1%, in groups 1, 2, and 3 respectively, p = 0.004). No difference was found in overall survival (OS) (32 vs. 31 vs. 25 months, p = 0.481) and disease-free survival (DFS) (26 vs. 29 vs. 24 months, p = 0.178) in groups 1, 2, and 3, respectively. At univariate analysis FIGO stage I (p = 0.004) showed a lower recurrence rate compared to FIGO stage II.ConclusionNo significant difference was found in OS and DFS among the three groups (open, laparoscopic, and robotic). The minimally invasive approach showed lower rate of complications than the laparotomic approach.

Validation of MiROvaR, a microRNA-based predictor of early relapse in early stage epithelial ovarian cancer as a new strategy to optimise patients' prognostic assessment

AimEarly-stage epithelial ovarian cancer (eEOC) patients have a generally favorable prognosis but unpredictable recurrence. Accurate prediction of risk of relapse is still a major concern, essentially to avoid overtreatment. Our robust tissue-based miRNA signature named MiROvaR, predicting early EOC recurrence in mostly advanced-stage EOC patients, is here challenged in an independent cohort to extend its classifying ability in the early-stage EOC setting. MethodsWe retrospectively selected patients who underwent comprehensive surgical staging at our institution including stages from IA to IIB. miRNA expression profile was analysed in 89 cases and MiROvaR algorithm was applied using the previously validated cut-off for patients' classification. The primary endpoint was progression-free survival (PFS) at 5 years. Complete follow-up time (median = 112 months) was also considered as secondary analysis. ResultsMiROvaR was assessable on 87 cases (19 events of disease progression) and classified 68 (78%) low-risk and 19 (22%) high-risk patients. Recurrence rate at primary end-point was 39% for high-risk patients as compared to 9.5% for low-risk ones. Accordingly, their Kaplan–Meier PFS curves were significantly different at both primary and secondary analysis (p = 0.0006 and p = 0.03, respectively). While none of the prominent clinical variables had prognostic relevance, MiROvaR significantly predicted disease recurrence at the 5-year assessment (primary endpoint analysis; HR:5.43, 95%CI:1.82–16.1, p = 0.0024; AUC = 0.78, 95%CI:0.53–0.82) and at complete follow-up time (HR:2.67, 95%CI:1.04–6.8, p = 0.041; AUC:0.68, 95%CI:0.52–0.82). ConclusionsWe validated MiROvaR performance in identifying at diagnosis eEOC patients' at higher risk of early relapse thus enabling selection of the most effective therapeutic approach.

Predictive Score of Nodal Involvement in Endometrial Cancer Patients: A Large Multicentre Series.

Sentinel lymph node (SLN) biopsy is considered the standard of care in early-stage endometrial cancer (EC). For SLN failure, a side-specific lymphadenectomy is recommended. Nevertheless, most hemipelvises show no nodal involvement. The authors previously published a predictive score of lymphovascular involvement in EC. In case of a negative score (value 3-4), the risk of nodal metastases was extremely low. This multicenter study aimed to analyze a predictive score of nodal involvement in EC patients. The study enrolled patients with EC who had received comprehensive surgical staging with nodal assessment. A preoperative predictive score of nodal involvement was calculated for all the patients before surgery. The score included myometrial infiltration, tumor grading (G), tumor diameter, and Ca125 assessment. The STARD (standards for Reporting Diagnostic accuracy studies) guidelines were followed for score accuracy. The study analyzed 1038 patients and detected 155 (14.9%) nodal metastases. The score was negative (3 or 4) for 475 patients and positive (5-7) for 563 of these patients. The score had a sensitivity of 83.2%, a specificity of 50.8%, a negative predictive value of 94.5%, and a diagnostic value of 55.7%. The area under the curve was 0.75. The logistic regression showed a significant correlation between a negative score and absence of nodal metastasis (odds ration [OR], 5.133, 95% confidence interval [CI], 3.30-7.98; p < 0.001). The proposed predictive score is a useful test to identify patients at low risk of nodal involvement. In case of SLN failure, the application of the current score in the SLN algorithm could allow avoidance of unnecessary lymphadenectomies.

Factors associated with the involvement of lymph nodes in low‐grade serous ovarian cancer

Evaluating nodal metastases in low-grade serous ovarian cancer (LGSOC) patients. Women with LGSOC who had undergone primary cytoreductive surgery comprising systematic pelvic-paraaortic lymphadenectomy were included. Data were obtained retrospectively from 12 oncology centers. One hundred and forty-eight women with LGSOC who had undergone comprehensive surgical staging were included. Seventy-one (48.0%) patients had metastatic lymph nodes. Preoperative serum CA-125 levels of ≥170 U/ml (odds ratio [OR]: 3.84; 95% confidence interval [CI]: 1.22-12.07; p = 0.021) and presence of lymphovascular space invasion (LVSI) (OR: 13.72; 95% CI: 3.36-55.93; p < 0.001) were independent predictors of nodal metastasis in LGSOC. Sixty (40.5%) patients were classified to have apparently limited disease to the ovary/ovaries. Twenty (33.3%) of them were upstaged after surgical staging. Twelve (20.0%) had metastatic lymph nodes. Presence of LVSI (OR: 12.96; 95% CI: 1.14-146.43; p = 0.038) and preoperative serum CA-125 of ≥180 U/ml (OR: 7.19; 95% CI: 1.35-38.12; p = 0.02) were independent predictors of lymph node metastases in apparent Stage Ⅰ disease. Clinicians may consider to perform a reoperation comprising systematic lymphadenectomy in patients who had apparently limited disease to the ovary/ovaries and had not undergone lymphadenectomy initially. Reoperation may be considered particularly in patients whose preoperative serum CA-125 is ≥180 U/ml and/or whose pathological assessment reported the presence of LVSI.

Combining Clinicopathological Parameters and Molecular Indicators to Predict Lymph Node Metastasis in Endometrioid Type Endometrial Adenocarcinoma.

BackgroundLymph node metastasis (LNM) is a critical unfavorable prognostic factor in endometrial cancer (EC). At present, models involving molecular indicators that accurately predict LNM are still uncommon. We addressed this gap by developing nomograms to individualize the risk of LNM in EC and to identify a low-risk group for LNM.MethodsIn all, 776 patients who underwent comprehensive surgical staging with pelvic lymphadenectomy at the First Affiliated Hospital of Chongqing Medical University were divided into a training cohort (used for building the model) and a validation cohort (used for validating the model) according to a predefined ratio of 7:3. Logistics regression analysis was used in the training cohort to screen out predictors related to LNM, after which a nomogram was developed to predict LNM in patients with EC. A calibration curve and consistency index (C-index) were used to estimate the performance of the model. A receiver operating characteristic (ROC) curve and Youden index were used to determine the optimal threshold of the risk probability of LNM predicted by the model proposed in this study. Then, the prediction performance of different models and their discrimination abilities for identifying low-risk patients were compared.ResultLNM occurred in 87 and 42 patients in the training and validation cohorts, respectively. Multivariate logistic regression analysis showed that histological grade (P=0.022), myometrial invasion (P=0.002), lymphovascular space invasion (LVSI) (P=0.001), serum CA125 (P=0.008), Ki67 (P=0.012), estrogen receptor (ER) (0.009), and P53 (P=0.003) were associated with LNM; a nomogram was then successfully established on this basis. The internal and external calibration curves showed that the model fits well, and the C-index showed that the prediction accuracy of the model proposed in this study was better than that of the other models (the C-index of the training and validation cohorts was 0.90 and 0.91, respectively). The optimal threshold of the risk probability of LNM predicted by the model was 0.18. Based on this threshold, the model showed good discrimination for identifying low-risk patients.ConclusionCombining molecular indicators based on classical clinical parameters can predict LNM of patients with EC more accurately. The nomogram proposed in this study showed good discrimination for identifying low-risk patients with LNM.

Three Different Ways to Miss a Granulosa Cell Tumor – A Lesson to be Learne

Granulosa cell tumours (GCTs) account for approximately 70% of malignant sex-cord stromal tumors but are still uncommon and comprise only 2–5% of all ovarian neoplasms. They are classified as adult and juvenile GCTs. These are often low grade malignancies and are usually diagnosed in early stages, but with an potential for late recurrence. Case 1: A 51-year woman with c/o PMB with biopsy showing endometrial polyp. She underwent a total abdominal hysterectomy and a bilateral salpingo-oophorectomy (TAH BSO) with omental biopsy after intraoperative pathology confirmation of a Adult granulosa cell tumor (AGCT) of the ovary. She had a good post-operative recovery and was advised for regular and long term follow up. Case 2: A 63-year woman c/o PMB with an adult granulosa cell tumor that initially presented as endometrial hyperplasia on biopsy. She underwent a TAH BSO and omental biopsy after intraop frozen section confirmed of AGCT of the ovary. She had an uneventful post-operative recovery. Case 3: A 68-year womanwith an AGCT that was initially treated as endometrial carcinoma. She underwent a Comprehensive Surgical Staging due to initial misdiagnosis of endometrial carcinoma. Her final biopsy report showed it to be a granulosa cell tumor of the ovary and adenocarcinoma of the endometrium. She had a good post-operative recovery and is being followed up till now. The multifaceted presentations with its erratic biological behaviour coupled with late recurrences are diagnostic pitfalls necessitating a high degree of suspicion for accurate clinical diagnosis.

Factors associated with an increased risk of recurrence in patients diagnosed with high-grade endometrial cancer undergoing minimally invasive surgery: A study of the society of gynecologic oncology of Canada (GOC) community of practice (CoP)

BackgroundMinimally invasive surgery (MIS) is a standard surgical approach for comprehensive surgical staging in women with endometrial cancer. As rates and complexity of MIS are steadily increasing, it is important to identify potential risk factors which may be associated with this approach. This study evaluates the impact of local factors on the risk of disease recurrence. MethodsA retrospective cohort study was conducted of patients diagnosed with high grade endometrial cancer (HGEC) who underwent MIS between 2012 and 2016 at eight Canadian centers. Data was collected from medical records. The 75th percentile was calculated for estimated uterine volume and weight. All recurrences were categorized into two groups; intra-abdominal vs. extra-abdominal. To search for significant covariates associated with recurrence-free survival a Cox proportional hazard model was performed. ResultsA total of 758 patients were included in the study. Intra-uterine manipulator was used in 497 (35.8%) of patients. Vaginal lacerations were documented in 9.1%. Median follow-up was 30.5 months (interquartile range 20–47). There were 157 who had disease recurrence (20.71%), including 92 (12.14%) intra-abdominal and 60 (7.92%) extra-abdominal only recurrences. In univariate analysis myometrial invasion, LVI, stage, uterine volume and weight > 75th percentile and chemotherapy were associated with increased risk of intra-abdominal recurrence. In multivariable analysis only stage, and specimen weight > 75th percentile (OR 2.207, CI 1.123–4.337) remained significant. Uterine volume, and weight were not associated with increased risk of extra-abdominal recurrences. ConclusionFor patients diagnosed with HGEC undergoing MIS, extracting a large uterus is associated with a significantly increased risk for intra-abdominal recurrence.