Comparative Nucleotide Sequence Analysis Research Articles

A new genus of alphasatellites associated with banana bunchy top virus in Southeast Asia.

Autonomously replicating alphasatellites (family Alphasatellitidae) are frequently associated with plant single-stranded (ss)DNA viruses of the families Geminiviridae, Metaxyviridae, and Nanoviridae. Alphasatellites encode a single replication-initiator protein (Rep) similar to Rep proteins of helper viruses and depend on helper viruses for encapsidation, movement, and transmission. Costs versus benefits of alphasatellite-helper virus association are poorly understood. Our surveys in Southeast Asia (SEA) for wild and cultivated banana plants infected with banana bunchy top virus (BBTV, Nanoviridae) and Illumina sequencing reconstruction of their viromes revealed, in addition to a six-component BBTV genome, one to three distinct alphasatellites present in sixteen of twenty-four BBTV-infected plants. Comparative nucleotide and Rep protein sequence analyses classified these alphasatellites into four distinct species: two known species falling into the genus Muscarsatellite (subfamily Petromoalphasatellitinae) previously identified in SEA and two novel species falling into the tentative genus Banaphisatellite (subfamily Nanoalphasatellitinae) so far containing a single species recently identified in Africa. The banaphisatellites were found to be most related to members of the genus Fabenesatellite of subfamily Nanoalphasatellitinae and the genus Gosmusatellite of subfamily Geminialphasatellitinae, both infecting dicots. This suggests a dicot origin of banaphisatellites that got independently associated with distinct strains of monocot-infecting BBTV in Africa and SEA. Analysis of conserved sequence motifs in the common regions driving replication and gene expression of alphasatellites and BBTV strains revealed both differences and similarities, pointing at their ongoing co-evolution. An impact of alphasatellites on BBTV infection and evasion of RNA interference-based antiviral defences was evaluated by measuring relative abundance of BBTV genome components and alphasatellites and by profiling BBTV- and alphasatellite-derived small interfering RNAs. Taken together, our findings shed new light on the provenance of alphasatellites, their co-evolution with helper viruses, and potential mutual benefits of their association.

Analysis of nucleotide sequences of the ABI3 gene coding region in pea varieties with different percentage of seed storage proteins

The main source of vegetable protein in the world are leguminous crops, among which peas are the most common in Russia. Dozens and even hundreds of genes are involved in the regulation of biological processes associated with the maturation of seeds and the accumulation of reserve nutrients in them, including proteins. The study conducted on legume species related to peas indicate that one of the genes at the highest hierarchical level in this regulatory chain is the ABI3 transcription factor gene; however, its role in the biosynthesis and accumulation of seed storage proteins remains poorly studied. The purpose of the current work is to identify high-protein pea genotypes and analyze the nucleotide sequences of the coding region of the ABI3 gene to search for possible DNA polymorphisms associated with protein percentage in their seeds. The study was carried out in 2020–2021. The objects of the study were 37 pea varieties from the collection of genetic resources of leguminous crops of VIR. Protein percentage in seeds was determined by the Bradford method. Selection of primers and comparative analysis of nucleotide sequences were performed using the PrimerSelect and MegAlign programs. Sequencing was performed according to the Sanger method. There were identified pea varieties with the highest (‘Aksaisky Usaty 55’, ‘Sakharny’) and low (‘K-8361’ (VIR), ‘Fregat’) seed protein percentage. In these variety samples, the coding region of the ABI3 gene was sequenced. Comparative analysis of their nucleotide sequences with the sequence of the ABI3 gene fragment annotated in the GenBank database revealed significant variability among them: nucleotide substitutions, deletion of 6 nucleotides. In the high protein variety ‘Sakharny’, there has been found a 9-nucleotide insertion, leading to the insertion of three additional amino acids, and in the low-protein variety Fregat, there has been found a single nucleotide insertion, causing a shift in the reading frame. The data obtained may indicate a correlation between mutations in the ABI3 gene and protein accumulation in pea seeds.

First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae

A fungus isolated from mango wasp was found to be pathogenic to houseflies. The isolated fungus was identified as Aspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106, 1x107, 1x108, 2x106, 2x107, 2x108, 3x106, 3x107, and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods. The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface. Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

Optimized multilocus sequence analysis for laboratory identification of pathogens of ixodid tick-borne borreliosis

Introduction. The most common etiological agents of ixodid tick-borne borreliosis (ITBB) in Russia are Borrelia garinii, B. afzelii, B. bavariensis. Multilocus sequence typing and multilocus sequence analysis (MLSA) have been used in recent studies for Borrelia species identification. The results of using the MLSA scheme for identification of pathogens causing erythemic forms of ITBB have been presented earlier.
 The purpose of the study was to explore the possibility of MLSA optimization for laboratory identification of ITBB pathogens. Objectives: comparative analysis of nucleotide sequences of 6 conserved genes (rrs, hbb, fla, groEL, recA, ospA) and the rrfA-rrlB intergenic spacer, which are recommended by the MLSA protocol; identification of the minimum set of genes, the concatenated sequences of which are essential for species identification of Borrelia isolates.
 Materials and methods. The sequences of the above loci of 23 reference isolates collected from patients with ITBB and assigned, using MLSA, to B. bavariensis were compared with the sequences of similar genes of other Borrelia species available in international databases. The UPGMA method was used to build and analyze dendrograms based on the obtained data.
 Results. The sequences of ospA gene loci of reference species demonstrated the greatest difference (not less than 8.5%) from the sequences of the above gene in other analyzed species of Borrelia; approximately similar species-related differences (not less than 6.7%) were demonstrated by the comparison of recA gene sequences. The sequences of the identified variants of these two genes in B. bavariensis differed from the sequences of the similar genes in the most closely related species B. garinii. The dendrogram of the concatenated nucleotide sequences of recA and ospA genes demonstrated that it was totally consistent with the results of identification of the isolates based on the MLSA protocol.
 Conclusion. The optimized approach to MLSA of the B. burgdorferi sensu lato group suggests that species identification should be based on the concatenated analysis of loci of only two genes (recA and ospA) out of 7 loci recommended by the MLSA protocol.

The GP-45 Protein, a Highly Variable Antigen from Babesia bigemina, Contains Conserved B-Cell Epitopes in Geographically Distant Isolates.

In B. bigemina, the 45 kilodaltons glycoprotein (GP-45) is the most studied. GP-45 is exposed on the surface of the B. bigemina merozoite, it is believed to play a role in the invasion of erythrocytes, and it is characterized by a high genetic and antigenic polymorphism. The objective of this study was to determine if GP-45 contains conserved B-cell epitopes, and if they would induce neutralizing antibodies. The comparative analysis of nucleotide and amino acids sequences revealed a high percentage of similarity between field isolates. Antibodies against peptides containing conserved B-cell epitopes of GP-45 were generated. Antibodies present in the sera of mice immunized with GP-45 peptides specifically recognize B. bigemina by the IFAT. More than 95% of cattle naturally infected with B. bigemina contained antibodies against conserved GP-45 peptides tested by ELISA. Finally, sera from rabbits immunized with GP-45 peptides were evaluated in vitro neutralization tests and it was shown that they reduced the percentage of parasitemia compared to sera from rabbits immunized with adjuvant. GP-45 from geographically distant isolates of B. bigemina contains conserved B-cell epitopes that induce neutralizing antibodies suggesting that this gene and its product play a critical role in the survival of the parasite under field conditions.

Genetic analysis of nucleotide sequences of neuraminidase gene of highly pathogenic avian influenza A/H5N8 virus isolates recovered in the Russian Federation in 2020

Avian influenza is a highly dangerous viral disease that causes huge economic damage to poultry farming. Currently, highly virulent influenza virus with N8 neur- aminidase subtype is quite often detected in populations of domestic and wild birds in various countries of the world. The article provides data on complete nucleotide sequences of the neuraminidase gene of highly pathogenic avian influenza virus isolates recovered in the second half of 2020 from pathological material received from four regions of the Russian Federation. The conducted research showed that the subtype of the isolated virus was N8. According to the phylogenetic analysis, isolates of N8 virus belong to group 8C.4. During the phylogenetic analysis of the neuraminidase, we also took into account data on hemagglutinin classification, according to which H5N8 virus isolates belong to a widespread clade 2.3.4.4. Viruses of the clade were first registered in 2010 in China and they have been circulating up to now. The paper also provides data of a comparative analysis of nucleotide sequences of the studied isolates and the isolates from the international GenBank and GISAID databases, recovered in other countries from 2007 to 2020. During the analysis of the amino acid sequence of the studied isolates, no substitutions were found in the positions that affect resistance to neuraminidase inhibitors. The complete nucleotide sequences of the neuraminidase gene of the avian influenza virus subtype N8 (isolates A/domestic goose/OMSK/1521-1/2020, A/duck/Chelyabinsk/1207-1/2020, A/duck/Saratov/1578-2/2020, A/goose/Tatarstan/1730-2/2020) are published in the international GenBank and GISAID databases. Based on the analysis of the nucleotide sequences of the studied isolates, the article shows gradual evolution of the N8 subtype virus.

Identification of novel polymorphism and in silico analysis of caprine DNAJB3 gene

• DNAJB3, a molecular chaperon, was analysed first time both in vivo and in silico in goat. • In the amplified complete coding sequence of caprine DNAJB3, one nucleotide substitution at 419 th (C > A) position was identified. • In silico structural analysis predicted change in amino acid (Ala > Glu) at 140 th position with minor difference (7%) in three dimensional protein structure. • Computational analysis showed differential interaction of the wild and mutant type DNAJB3 proteins with other stress related proteins. DNAJB3 acts as a cochaperon and stimulates ATPase activity of HSP family genes through its J domain. An in vivo and in silico study was conducted to get comprehensive idea on the role of DNAJB3 gene in goat. The coding sequence of DNAJB3 gene was amplified and searched for polymorphism in three indigenous goat (i.e. Black Bengal, Ganjam and Raighar) populations. One nucleotide substitution at 419th (C > A) position (wild and mutant) with resultant change in amino acid (Ala > Glu) at 140th position was identified. The comparative nucleotide sequence analysis showed 68 variable sites that included 53 parismony informative sites and 15 singleton sites. In silico structural analysis revealed minor difference (7%) in three dimensional protein structure between mutant and wild type DNAJB3 proteins. The protein-protein interactions of DNAJB3 with HSP72, JNK stress kinase, and IKKβ stress kinase were also predicted. The mutant (Raighar) type DNAJB3 protein predicted to interact only with A chain of the JNK stress kinase. Both the wild and mutant type variants of DNAJB3 proteins predicted to interact with A and B chain of hexamer IKKβ stress kinase. This study will be helpful to use DNAJB3 as a molecular marker for thermal tolerance in future.

The Clonal Population of Trichophyton equinum from Dermatophytoses of Japanese Racehorses.

Trichophyton equinum is a zoophilic dermatophyte that is frequently isolated from horse dermatophytosis and rare infections in humans. In the present study, molecular and physiological testing were performed on T. equinum isolates from dermatophytoses of Japanese racehorses to assess genotype and phenotype patterns of these strains. Comparative nucleotide sequence analysis showed that internal transcribed spacer (ITS) region sequences amplified from all Japanese isolates were 99.5% identical to T. equinum reference strains. ITS sequences amplified among the isolates were 100% (BT2) showed that isolates were 100% identical and harbored a "T" single nucleotide polymorphism at position 18. The sequences of β-tubulin (BT2) showed that isolates were 100% identical to T. equinum reference strains. The MAT1-2 allele was detected by PCR in all seven isolates, whereas none of the isolates contained the MAT1-1 allele. All isolates grew only on Trichophyton Agar 5 and did not grow on Trichophyton Agar 1 and 4, indicating nicotinic acid requirement. These results suggest that Japanese T. equinum isolates are derived from a clonal population.

Diversification of OmpA and OmpF of Yersinia ruckeri is independent of the underlying species phylogeny and evidence of virulence-related selection

Yersinia ruckeri is the causative agent of enteric redmouth disease (ERM) which causes economically significant losses in farmed salmonids, especially Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss, Walbaum). However, very little is known about the genetic relationships of disease-causing isolates in these two host species or about factors responsible for disease. Phylogenetic analyses of 16 representative isolates based on the nucleotide sequences of 19 housekeeping genes suggests that pathogenic Atlantic salmon and rainbow trout isolates represent distinct host-specific lineages. However, the apparent phylogenies of certain isolates has been influenced by horizontal gene transfer and recombinational exchange. Splits decomposition analysis demonstrated a net-like phylogeny based on the housekeeping genes, characteristic of recombination. Comparative analysis of the distribution of individual housekeeping gene alleles across the isolates demonstrated evidence of genomic mosaicism and recombinational exchange involving certain Atlantic salmon and rainbow trout isolates. Comparative nucleotide sequence analysis of the key outer membrane protein genes ompA and ompF revealed that the corresponding gene trees were both non-congruent with respect to the housekeeping gene phylogenies providing evidence that horizontal gene transfer has influenced the evolution of both these surface protein-encoding genes. Analysis of inferred amino acid sequence variation in OmpA identified a single variant, OmpA.1, that was present in serotype O1 and O8 isolates representing typical pathogenic strains in rainbow trout and Atlantic salmon, respectively. In particular, the sequence of surface-exposed loop 3 differed by seven amino acids to that of other Y. ruckeri isolates. These findings suggest that positive selection has likely influenced the presence of OmpA.1 in these isolates and that loop 3 may play an important role in virulence. Amino acid sequence variation of OmpF was greater than that of OmpA and was similarly restricted mainly to the surface-exposed loops. Two OmpF variants, OmpF.1 and OmpF.2, were associated with pathogenic rainbow trout and Atlantic salmon isolates, respectively. These OmpF proteins had very similar amino acid sequences suggesting that positive evolutionary pressure has also favoured the selection of these variants in pathogenic strains infecting both species.

Characterization of the Complete Mitochondrial Genomes of Two Sibling Species of Parasitic Roundworms, Haemonchus contortus and Teladorsagia circumcincta.

Haemonchus contortus and Teladorsagia circumcincta are among the two most pathogenic internal parasitic nematodes infecting small ruminants, such as sheep and goats, and are a global animal health issue. Accurate identification and delineation of Haemonchidae species is essential for development of diagnostic and control strategies with high resolution for Trichostrongyloidea infection in ruminants. Here, we describe in detail and compare the complete mitochondrial (mt) genomes of the New Zealand H. contortus and T. circumcincta field strains to improve our understanding of species- and strain-level evolution in these closely related roundworms. In the present study, we performed extensive comparative bioinformatics analyses on the recently sequenced complete mt genomes of the New Zealand H. contortus NZ_Hco_NP and T. circumcincta NZ_Teci_NP field strains. Amino acid sequences inferred from individual genes of each of the two mt genomes were compared, concatenated and subjected to phylogenetic analysis using Bayesian inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP). The AT-rich mt genomes of H. contortus NZ_Hco_NP and T. circumcincta NZ_Teci_NP are 14,001 bp (A+T content of 77.4%) and 14,081 bp (A+T content of 77.3%) in size, respectively. All 36 of the typical nematode mt genes are transcribed in the forward direction in both species and comprise of 12 protein-encoding genes (PCGs), 2 ribosomal RNA (rrn) genes, and 22 transfer RNA (trn) genes. The secondary structures for the 22 trn genes and two rrn genes differ between H. contortus NZ_Hco_NP and T. circumcincta NZ_Teci_NP, however the gene arrangements of both are consistent with other Trichostrongylidea sequenced to date. Comparative analyses of the complete mitochondrial nucleotide sequences, PCGs, A+T rich and non-coding repeat regions of H. contortus NZ_Hco_NP and T. circumcincta NZ_Teci_NP further reinforces the high levels of diversity and gene flow observed among Trichostrongylidea, and supports their potential as ideal markers for strain-level identification from different hosts and geographical regions with high resolution for future studies. The complete mt genomes of H. contortus NZ_Hco_NP and T. circumcincta NZ_Teci_NP presented here provide useful novel markers for further studies of the meta-population connectivity and the genetic mechanisms driving evolution in nematode species.

LRF/ZBTB7A conservation accentuates its potential as a therapeutic target for the hematopoietic disorders.

Conserved sequences across species have always provided valuable insights to improve our understanding on the human genome's entity and the interplay among different loci. Lymphoma/leukemia related factor (LRF) is encoded by ZBTB7A gene and belongs to an evolutionarily conserved family of transcription factors, implicated in vital cellular functions. The present data, demonstrating the wide-spread and the high overlap of the LRF/ZBTB7A recognition sites with genomic segments identified as CpG islands in the human genome, suggest that its binding capacity strongly depends on a specific sequence-encoded feature within CpGs. We have previously shown that de-methylation of the CpG island 326 lying in the ZBTB7A gene promoter is associated with impaired pharmacological induction of fetal hemoglobin in β-type hemoglobinopathies patients. Within this context we aimed to investigate the extent of the LRF/ZBTB7A conservation among primates and mouse genome, focusing our interest also on the CpG island flanking the gene's promoter region, in an effort to further establish its epigenetic regulatory role in human hematopoiesis and pharmacological involvement in hematopoietic disorders. Comparative analysis of the human ZBTB7A nucleotide and amino acid sequences and orthologous sequences among non-human primates and mouse, exhibited high conservation scores. Pathway analysis, clearly indicated that LRF/ZBTB7A influences conserved cellular processes. These data in conjunction with the high levels of expression foremost in hematopoietic tissues, highlighted LRF/ZBTB7A as an essential factor operating indisputably during hematopoiesis.

Comparative Nucleotide Sequence Analysis of Glycoprotein B, C, and G of Infectious Laryngotracheitis Virus Isolated in Egypt During 2016-2018

Infectious Laryngotracheitis (ILT) is an economically important disease of poultry, causing a high mortality rate and /or reduced egg production. Tracheas from sever morbid and recently died unvaccinated household chicken were subjected to PCR assay to detect the presence of the virus through amplification of the glycoprotein B gene. All tested samples gave positive ct ranging from 13.32 to 25.53. Virus isolation was performed by inoculation—the processed tracheal swaps onto the chorioallantoic membrane. Positive pock lesion has been developed within 7 days post-inoculation. The pock lesions were subjected to PCR assay for amplification of both the full-length glycoprotein B, C, and G for sequencing analysis. Positive amplicons migrating about 2600, 1250, and 890 bp were amplified corresponding to the orf of gpB, gpC and gpG genes. Sequence alignment and phylogenetic tree revealed that all sequenced isolates gave a high degree with wild type isolate of ILT and a high degree of genetic stability was clearly evident among strains isolated in different periods (2016-2018), indicating that these glycoproteins could be used as a vaccine candidate.

Coxiella burnetii in camels (Camelus dromedarius) from Algeria: Seroprevalence, molecular characterization, and ticks (Acari: Ixodidae) vectors

Q fever is a widespread zoonotic disease caused by Coxiella burnetii that most commonly infects not only a variety of mammals but also arthropods and in particularly ticks. The aim of this study was to detect C. burnetii infection in camels including ixodid ticks using serological and molecular assays. Between July 2018 to June 2019, blood samples from 184 male and female camels (Camelus dromedarius) were collected from 3 regions of South–East Algeria and serum samples were tested for antibodies against Coxiella burnetii using indirect enzyme-linked immunosorbent assay (ELISA) kit. The positive sera and a total of 60 ticks were tested by quantitative PCR (qPCR) for detection of C. burnetii with primers and probes specific to the transposon-like repetitive region (IS1111 gene). Positive samples were genotyped by amplification and sequencing of partial sequences based on the IS1111 gene.The seroprevalence of antibodies against C. burnetii was 75.5%. Statistical analysis pointed out three potential risk factors associated with Q fever infection: geographic location, age class and season. No positive DNA of camel blood sample was observed. However, five Hyalomma dromedarii, one H. impeltatum and one H. excavatum tick species were detected positive for Coxiella burnetii DNA by qPCR, with an overall prevalence rate of 11.66% (7/60). The revealed Algerian strains by phylogenetic and comparative analysis of the IS1111 nucleotide sequences were clustered with several pathogenic C. burnetii strains isolated from ticks, human, and cattle located in Tunisia, Greece and in some Mediterranean countries, respectively. The study results clearly indicate that camels and their ticks in Algeria may play an important role as a reservoir for C. burnetii and can be considered as a significant source of Q fever transmission to other animal species and humans.

Identification of a candidate gene underlying qKRN5b for kernel row number in Zea mays L.

A quantitative trait locus for kernel row number, qKRN5, was dissected into two tightly linked loci, qKRN5a and qKRN5b. Fine mapping, comparative analysis of nucleotide sequences and gene expression established the endonuclease/exonuclease/phosphatase family protein-encoding gene Zm00001d013603 as a causal gene of qKRN5b. Maize grain yield is determined by agronomically important traits that are controlled by interactions among and between genes and environmental factors. Considerable efforts have been made to identify major quantitative trait loci (QTLs) for yield-related traits; however, few were previously isolated and characterized in maize. In this study, we divided a QTL for kernel row number (KRN), qKRN5, into two tightly linked loci, qKRN5a and qKRN5b, using advanced backcross populations derived from near-isogenic lines. KRN was greater in individuals that were homozygous for the NX531 allele, which showed coupling-phase linkage. The major QTL qKRN5b had an additive effect of approximately one kernel row. Furthermore, fine mapping narrowed qKRN5b within a 147.2-kb region. The upstream sequence Zm00001d013603 and its expression in the ear inflorescence showed obvious differences between qKRN5b near-isogenic lines. In situ hybridization located Zm00001d013603 on the primordia of the spikelet pair meristems and spikelet meristems, but not in the inflorescence meristem, which indicates a role in regulating the initiation of reproductive axillary meristems of ear inflorescences. Expression analysis and nucleotide sequence alignment revealed that Zm00001d013603, which encodes an endonuclease/exonuclease/phosphatase family protein that hydrolyzes phosphatidyl inositol diphosphates, is the causal gene of qKRN5b. These results provide insight into the genetic basis of KRN and have potential value for enhancing maize grain yield.

Genetic diversity of Legionella pcs and pmtA genes and the effect of utilization of choline by Legionella spp. on induction of proinflammatory cytokines.

Legionella species synthesize phosphatidylcholine (PC) in two independent pathways: the three-step methylation of phosphatidylethanolamine PMT pathway and the one-step PCS pathway, in which the Pcs enzyme catalyzes the reaction between choline and CDP-diacylglycerol to form PC. Legionella pcs genes encode highly hydrophobic proteins with phosphatidylcholine synthase activity, which contain up to eight transmembrane helices with N- and C-termini located inside the bacterial cell. The comparative analysis of nucleotide sequences of pcs showed that these genes share high sequence identity among members of the Legionellaceae family. Legionella pmtA genes involved in the PMT pathway encoded small cytosolic proteins with putative phosphatidylethanolamine N-methyltransferase activity. The pmtA genes identified in Legionella species had lower sequence identity to each other than the pcs genes. The phylogenetic tree constructed based on the pcs and pmtA gene sequences showed phylogenetic relatedness between Legionella spp. and other bacteria. The utilization of extracellular choline by the four Legionella species leads to changes not only in the lipid components but also in proteins, and the interactions between these components lead to changes in cell surface properties, which result in a decline in induction of proinflammatory cytokines (TNF-α and IL-6).

Genetic identification of bovine leukaemia virus

Molecular genetic research methods make it possible to evaluate the genetic diversity of bovine leukemia virus (BLV) and are the most informative approaches to its genetic identification. Molecular genetic research methods work well for the phylogenetic analysis of sequenced nucleotide DNA sequences of the provirus, as well as for the polymerase chain reaction-restriction fragment length polymorphism analysis (PCR-RFLP) according to the phylogenetic classification of the pathogen. The purpose of the research was to study the scientific and methodological approaches to the genetic identification of bovine leukemia virus, integrated into the molecular monitoring of infection of cattle with BLV genotypes. The authors used PCR-RFLP-genotyping and comparative phylogenetic analysis of aligned nucleotide sequences of the env gene fragment of the BLV provirus isolates to detect the genotypic affiliation of the cattle from twenty-one livestock farms of the Republic of Tatarstan. As a result, isolates of four out of ten BLV genotypes were found in the Tatarstani cattle, namely genotypes 1, 4, 7, and 8. The research involved a comparative analysis of 505 nucleotide sequences of a fragment of the BLV env gene, including those deposited in GenBank NCBI. The analysis confirms the inconsistency of several earlier PCR-RFLP typing strategies with the current approach in assessing the genotypic diversity by phylogenetic analysis. The improved strategy of PCR-RFLP genotyping of BLV corresponds with its modern phylogenetic classification. The strategy makes it possible to identify all the known genotypes of the viral pathogen. Its validity has been proved by in silico modelling of restrictogrammes and a phylogenetic analysis of the env gene fragment of 57 reference isolates of ten BLV genotypes that generate 57 genotype-associated combinations of diagnostically significant PCR-RFLP profiles.

Suppression of cellular immunity factors by toxic fraction of supernatant of broth culture Pasteurella haemolytica

In the etiology of many infectious animal diseases, Pasteurella haemolytica belongs to a specific place. An important factor in the pathogenicity of this microorganism, like the Pasteurella multocida serotype D, is the thermostable exotoxin. It can be obtained from bacterial-purified culture fluid. Although the study of toxin formation among microorganisms is quite popular, however, the features of toxin formation in hemolytic pasteurals, depending on the virulence of the pathogen, the nature of the toxic effects of these objects in vivo remain unclear. Materials for research were 16 isolates of Pasteurella haemolytica, isolated from pathological and biological material obtained during the outbreaks of respiratory pathology in farm animals. Initially, the nature of the research concerned the establishment of the potential for toxin formation in the isolates obtained. The method provided for a comparative analysis of the DNA nucleotide sequences of each of the investigated isolates P. haemolytica and information obtained from the international database. Another part of the work concerned the actual allocation of the major groups of toxic components of Pasteurella haemolytica by extraction to determine their biochemical nature. Exotoxin isolation was carried out from the Pasteurella spp. The components of the sediment and supernatant were separated by ion exchange chromatography on TSK gels. In order to detect the harmful effects of toxin hemolytic pasteurals on the body, they used the method of determining the opsonic index (the ratio of the phagocytic number in the mixture without the products of toxic fractions to the mixture with the toxin-containing fraction). It has been established that an important factor of the pathogenetic effect in Pasteurella haemolytica is the toxic fraction. Electrophoregram analysis of the results of DNA amplification in a comparative aspect with the data of standard samples helped to determine the presence of elements of the genome, which indicate the potential for toxin formation in isolated hemolytic pasteurized isolates from the test material. Toxic fractions isolated from Pasteurella haemolytica broth culture supernatant are substances of protein-carbohydrate nature. The isolated peak toxicogenic fractions of dialysate of a bacterial culture sieve contained protein and carbohydrates within the limits of 12.5–20 μg / ml and 0–20 μg/ml, respectively. In the dialysate of the broth culture supernatant, where 5 groups of toxigenic fractions were identified, the content of protein and carbohydrates in them varied, respectively, in the range from 20 to 95 μg/ml and from 3.3 to 26.62 μg/ml. At reproduction of opsono-phagocytic reaction with participation of toxigenic fractions of hemolytic pasteurel, a sufficiently expressed immunosuppressive effect of these complexes on the body of warm-blooded substances with an opsonic index of 3 ± 0.03 was established. During further research it is planned to determine the dermal necrotic and lethal effects of the isolated toxicogenic fractions of hemolytic pasteuride on the body of warm-blooded ones.

HPeV-3 predominated among Parechovirus A positive infants during an outbreak in 2013–2014 in Queensland, Australia

BackgroundParechoviruses (HPeV) are endemic seasonal pathogens detected from the respiratory tract, gut, blood and central nervous system (CNS) of children and adults, sometimes in conjunction with a range of acute illnesses. HPeV CNS infection may lead to neurodevelopmental sequelae, especially following infection by HPeV-3, hence screening and genotyping are important to inform epidemiology, aetiology and prognosis. ObjectivesTo identify and characterise HPeVs circulating during an outbreak between November 2013 and April 2014 in Queensland, Australia. Study designTo perform PCR-based screening and comparative nucleotide sequence analysis on samples from children with clinically suspected infections submitted to a research laboratory for HPeV investigations. ResultsHPeVs were detected among 25/62 samples, identified as HPeV-3 from 23 that could be genotyped. These variants closely matched those which have occurred worldwide and in other States of Australia. ConclusionsThe inclusion of PCR-based HPeV testing is not systematically applied but should be considered essential for children under 3 months of age with CNS symptoms as should long-term follow-up of severe sepsis-like cases.

The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences

The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.

Genetic and pathogenic characterisation of 11 avian reovirus isolates from northern China suggests continued evolution of virulence.

Avian reovirus (ARV) infections characterised by severe arthritis, tenosynovitis, pericarditis, and depressed growth have become increasingly frequent in recent years. In this study, we isolated and identified 11 ARV field strains from chickens with viral arthritis and reduced growth in northern China. Comparative analysis of the σC nucleotide and amino acid sequences demonstrated that all isolates, except LN05 and JS01, were closely related to ARV S1133 and clustered in the first genetic lineage. LN05 and JS01 strains were clustered in the third lineage with the ARV 138 strain. Using S1133 as a reference, five isolates were selected to infect specific-pathogen-free chickens, and we found that the recent isolated Chinese ARV strains had higher replication ability in vivo and caused enhanced mortality than the S1133 strain. These findings suggest that the pathogenicity of Chinese ARVs has been changing in recent years and disease control may become more difficult. This study provides genetic and pathogenic characterisations of ARV strains isolated in northern China and calls for a sustained surveillance of ARV infection in China in order to support a better prevention and control of the disease.