Cognate Receptor Protein Research Articles

Attenuation of quorum sensing mediated virulence factors production and biofilm formation in Pseudomonas aeruginosa PAO1 by Colletotrichum gloeosporioides HM3

Signal dependent microbial communication in Pseudomonas aeruginosa PAO1 is a typical phenomenon mediated by acyl homo-serine lactone molecules that helps in developing biofilm and enhance antibiotic resistance. Microbial sources provide insight to the hidden treasure of secondary metabolites, and these structurally diversified chemical motifs can be used as antimicrobial and anti-infective agents. In the present study, endophytic fungus, Colletotrichum gloeosporioides HM3 isolated from Carica papaya leaves was explored for anti-infective potential against P. aeruginosa PAO1. The crude extract of C. gloeosporioides HM3 displayed bacteriostatic effect on P. aeruginosa PAO1 growth at 750 μg/ml concentration. A significant decline was observed in the production of quorum sensing regulated virulence factors, i.e. 56.32%, 62.54%, and 66.67% of pyocyanin, chitinase, and elastase enzyme, respectively. A drastic reduction in pathogenic determinant behaviour after treatment with crude extract of C. gloeosporioides HM3 i.e. EPS, rhamnolipid, and HCN production was noted. Light microscopy and CLSM analysis revealed that fungal extract treatment has reduced bacterial ability to form dense biofilm architecture. In silico analysis demonstrated the binding efficiency of bioactive compound, 4-(2,3-dimethoxybenzylidene)-3-methyl-1-(4-nitrophenyl)-2-pyrazolin-5-one, which is equipotent to the natural ligand and displayed a docking score of −5.436 kcal/mol with QS transcriptional regulator (LasR). Whereas the compound Acetamide, n-[tetrahydro-3-(phenylmethyl) thieno [3,4-d]thiazol-2 (3 h)-ylidene]-, s,s-dioxide exhibits a docking score of −4.088 kcal/mol (LasR) and −1.868 kcal/mol (RhlR) with cognate receptor proteins. Henceforth, the research report suggests C. gloeosporioides HM3 derived metabolites could be considered as a potential inhibitors of QS regulated virulence factors and biofilm production in P. aeruginosa PAO1.

Quorum alleviating Molecules- A Review

The hindrance of quorum sensing is generally indicated to as quorum quenching. A few compounds have been combined to intrude on quorum sensing articulation by echoing AHL particles, N-acyl-3-amino-5H furanone, a synthetic analogue of N-AHL viably keeps the receipt of signal atom by obstructing its receptor Lux R protein. AHL controlled quorum sensing can be distressed by various methods, for example, lessening the movement of AHL cognate receptor protein or AHL synthase, hindering the creation of QS signal molecules, degradation of the AHL, and mimicking the signal atoms by utilizing their synthetic analogs. Additionally, obstruction of sensing signal transduction can be accomplished by utilizing an opponent particle equipped for contending or meddling with the local AHL motion for endorsed entry to the LUXR-type receptor. Competitive inhibitors are basically like the local AHL signal and can bind to and involve the AHL restricting site yet will fail to enact the LuxR-type receptor. The non-competitive inhibitors indicate almost no basic similarity to AHL signals and these particles bind to various locales on the receptor protein. A variety of natural Quorum quenching molecules have been identified.

The Balance Metabolism Safety Net: Integration of Stress Signals by Interacting Transcriptional Factors in Streptomyces and Related Actinobacteria.

Soil dwelling Streptomyces species are faced with large variations in carbon or nitrogen sources, phosphate, oxygen, iron, sulfur, and other nutrients. These drastic changes in key nutrients result in an unbalanced metabolism that have undesirable consequences for growth, cell differentiation, reproduction, and secondary metabolites biosynthesis. In the last decades evidence has accumulated indicating that mechanisms to correct metabolic unbalances in Streptomyces species take place at the transcriptional level, mediated by different transcriptional factors. For example, the master regulator PhoP and the large SARP-type regulator AfsR bind to overlapping sequences in the afsS promoter and, therefore, compete in the integration of signals of phosphate starvation and S-adenosylmethionine (SAM) concentrations. The cross-talk between phosphate control of metabolism, mediated by the PhoR–PhoP system, and the pleiotropic orphan nitrogen regulator GlnR, is very interesting; PhoP represses GlnR and other nitrogen metabolism genes. The mechanisms of control by GlnR of several promoters of ATP binding cassettes (ABC) sugar transporters and carbon metabolism are highly elaborated. Another important cross-talk that governs nitrogen metabolism involves the competition between GlnR and the transcriptional factor MtrA. GlnR and MtrA exert opposite effects on expression of nitrogen metabolism genes. MtrA, under nitrogen rich conditions, represses expression of nitrogen assimilation and regulatory genes, including GlnR, and competes with GlnR for the GlnR binding sites. Strikingly, these sites also bind to PhoP. Novel examples of interacting transcriptional factors, discovered recently, are discussed to provide a broad view of this interactions. Altogether, these findings indicate that cross-talks between the major transcriptional factors protect the cell metabolic balance. A detailed analysis of the transcriptional factors binding sequences suggests that the transcriptional factors interact with specific regions, either by overlapping the recognition sequence of other factors or by binding to adjacent sites in those regions. Additional interactions on the regulatory backbone are provided by sigma factors, highly phosphorylated nucleotides, cyclic dinucleotides, and small ligands that interact with cognate receptor proteins and with TetR-type transcriptional regulators. We propose to define the signal integration DNA regions (so called integrator sites) that assemble responses to different stress, nutritional or environmental signals. These integrator sites constitute nodes recognized by two, three, or more transcriptional factors to compensate the unbalances produced by metabolic stresses. This interplay mechanism acts as a safety net to prevent major damage to the metabolism under extreme nutritional and environmental conditions.

Insulin-like growth factor (IGF)-II- mediated fibrosis in pathogenic lung conditions.

Type 2 insulin-like growth factor (IGF-II) levels are increased in fibrosing lung diseases such as idiopathic pulmonary fibrosis (IPF) and scleroderma/systemic sclerosis-associated pulmonary fibrosis (SSc). Our goal was to investigate the contribution of IGF receptors to IGF-II-mediated fibrosis in these diseases and identify other potential mechanisms key to the fibrotic process. Cognate receptor gene and protein expression were analyzed with qRT-PCR and immunoblot in primary fibroblasts derived from lung tissues of normal donors (NL) and patients with IPF or SSc. Compared to NL, steady-state receptor gene expression was decreased in SSc but not in IPF. IGF-II stimulation differentially decreased receptor mRNA and protein levels in NL, IPF, and SSc fibroblasts. Neutralizing antibody, siRNA, and receptor inhibition targeting endogenous IGF-II and its primary receptors, type 1 IGF receptor (IGF1R), IGF2R, and insulin receptor (IR) resulted in loss of the IGF-II response. IGF-II tipped the TIMP:MMP balance, promoting a fibrotic environment both intracellularly and extracellularly. Differentiation of fibroblasts into myofibroblasts by IGF-II was blocked with a TGFβ1 receptor inhibitor. IGF-II also increased TGFβ2 and TGFβ3 expression, with subsequent activation of canonical SMAD2/3 signaling. Therefore, IGF-II promoted fibrosis through IGF1R, IR, and IGF1R/IR, differentiated fibroblasts into myofibroblasts, decreased protease production and extracellular matrix degradation, and stimulated expression of two TGFβ isoforms, suggesting that IGF-II exerts pro-fibrotic effects via multiple mechanisms.

Class II contact-dependent growth inhibition (CDI) systems allow for broad-range cross-species toxin delivery within the Enterobacteriaceae family.

SummaryContact‐dependent growth inhibition (CDI) allows bacteria to recognize kin cells in mixed bacterial populations. In Escherichia coli, CDI mediated effector delivery has been shown to be species‐specific, with a preference for the own strain over others. This specificity is achieved through an interaction between a receptor‐binding domain in the CdiA protein and its cognate receptor protein on the target cell. But how conserved this specificity is has not previously been investigated in detail. Here, we show that class II CdiA receptor‐binding domains and their Enterobacter cloacae analog are highly promiscuous, and can allow for efficient effector delivery into several different Enterobacteriaceae species, including Escherichia, Enterobacter, Klebsiella and Salmonella spp. In addition, although we observe a preference for the own receptors over others for two of the receptor‐binding domains, this did not limit cross‐species effector delivery in all experimental conditions. These results suggest that class II CdiA proteins could allow for broad‐range and cross‐species growth inhibition in mixed bacterial populations.

FSH receptor binding inhibitor up-regulates ARID1A and PTEN genes associated with ovarian cancers in mice.

Experiments were conducted to determine if the follicle-stimulating hormone (FSH) receptor binding inhibitor (FRBI) impacts the expression levels of AT-rich interactive domain-containing protein 1A (ARID1A) and phosphatase and tensin homolog (PTEN) in ovaries and blood, as well as expressions of follicle-stimulating hormone cognate receptor (FSHR) gene and proteins. Mice in FRBI-10, FRBI-20, FRBI-30, and FRBI-40 groups were intramuscularly injected with 10, 20, 30, and 40 mg FRBI/kg, respectively, for five consecutive days. Western blotting and qRT-PCR were utilized to determine expression levels of ARID1A and PTEN proteins and mRNAs. Serum ARID1A and PTEN concentrations of the FRBI-40 group were higher than the control group (CG) and FSH group (P<0.05). FSHR mRNA levels of FRBI-20, FRBI-30, and FRBI-40 groups were lower than that of CG and FSH groups on day 15 (P<0.05 or P<0.01). Expression levels of FSHR proteins of FRBI-30 and FRBI-40 groups were lower than those of CG and FSH groups (P<0.05). Levels of ARID1A and PTEN proteins of the FRBI-30 group were greater than CG on days 20 and 30 (P<0.05). FRBI doses had significant positive correlations to levels of ARID1A and PTEN proteins. Additionally, ARID1A and PTEN had negative correlations to FSHR mRNAs and proteins. A high dose of FRBI could promote the expression levels of ARID1A and PTEN proteins in ovarian tissues. FRBI increased serum concentrations of ARID1A and PTEN. However, FRBI depressed expression levels of FSHR mRNAs and proteins in mouse ovaries.

Abstract P1-05-04: Progestin receptor content of breast cancer associated with expression of gene subsets for peptide/protein hormones and cognate receptors in LCM-procured cells that impact clinical outcomes

Abstract Assessing breast cancer prognosis and treatment selection was first enhanced by discovery that estrogen (ER) and progestin receptor (PR) proteins were clinically relevant biomarkers. Later reports suggested expression of certain protein hormones in breast cancer cells appear to be related to clinical behavior. We deciphered clinically relevant relationships between PR content in tissue biopsies and relative expression levels of genes directing synthesis of peptide/protein hormones and their cognate receptors in LCM-procured breast cancer cells. This global approach revealed unique relationships between both PR+ or PR- carcinomas and small subsets of genes for these peptide/protein hormones and cognate receptors as independent predictors of risk of recurrence. Methods: Expression of genes for 61 peptide/protein hormones and 81 cognate receptor proteins were measured by microarray analyses of LCM-procured carcinoma cells from de-identified primary breast carcinoma biopsies. Using an IRB-approved biorepository and database, previously total RNA was extracted from carcinoma cells to determine expression levels of ˜22,000 genes. Univariable and multivariable Cox regressions with interaction of each hormone eceptor gene, individually or paired, and use of LASSO were determined with relative gene expression values of each protein ligand and its cognate receptor. PR content and ligand binding affinity of each carcinoma were quantified by FDA approved assays. Results: Using de-identified clinical outcomes that extended up to 12 years, univariable Cox regression analyses of 142 candidates revealed AVPR1A, AVPR2, CALCR, CRH, LHB, POMC, SCT, SST, SSTR1 and TMSB10 independently predicted PFS or OS. Violin plots identified candidate genes associated with PR content. Multivariable analyses of relative gene expression of 115 hormone-receptor pairs showed IAPP-CALCR, RLN2-RXFP1, GHRH-GHRHR, CGA-TSHR, EDN1-ENDRA and POMC-MC5R exhibited statistically significant interaction for predicting OS among 145 PR+ cancers. Four gene pairs (HCRT-HCRTR2, CRH-CRHR1, HCRT-HCRTR1 and CORT-SSTR4) were associated with OS among 101 PR- lesions. Using LASSO, PR+ lesions expressing either (CGA &amp; SSTR2) or (CGA) predicted OS and PFS, respectively. Similarly, for PR- cancers, gene subsets (GRP, TMSB15, VIP2) or (AGT, GH1, GRP, TMSB15A) predicted OS and PFS, respectively. Three of four signatures were externally validated with SurvExpress. Conclusion: Different gene expression profiles for protein hormones and cognate receptors were identified in PR+ or PR- carcinomas at time of diagnosis that predict PFS and OS regardless of treatment. Combining PR content with gene expression of LCM-procured cells is likely to provide insight into alternative treatments whereby standard of care performed poorly or to identify genes that correlate with cancer progression regardless of treatment modality. Collectively, results suggest that many primary breast cancers exhibit considerable endocrine autonomy for controlling disease progression, supporting investigation of protein products of gene candidates in isolated populations of breast carcinoma cells to develop novel biomarker assays. Citation Format: Daniels MW, Brock GN, James WL. Progestin receptor content of breast cancer associated with expression of gene subsets for peptide/protein hormones and cognate receptors in LCM-procured cells that impact clinical outcomes [abstract]. In: Proceedings of the 2017 San Antonio Breast Cancer Symposium; 2017 Dec 5-9; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2018;78(4 Suppl):Abstract nr P1-05-04.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin β6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin β6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin β6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin β6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin β6.

Strigolactones redefine plant hormones.

A commonly accepted view of plant growth hormones is that their interaction with the cognate receptor protein is reversible, so that each hormone molecule can potentially interact multiple times with a receptor and so either amplify the hormone signal or maintain it over an extended period of time. The signal can be ‘cancelled’ by degrading the hormone. Strigolactones present us with a potentially new paradigm. The receptor is a serine hydrolase-type protein which attacks the strigolactone resulting in covalent modification of the receptor, while at the same time destroying the hormone. Strigolactone is apparently a one-use ‘disposable’ hormone.

Abstract P3-04-06: Expression of genes for peptide/protein hormones and their receptors in breast carcinomas as biomarkers predicting risk of recurrence

Abstract Background: Several reports have suggested expression of certain peptide/protein hormones in breast cancer cells appear to be related to clinical behavior. We have taken a global approach by evaluating relationships between genes for these hormones and their cognate receptor proteins as independent predictors of risk of recurrence. Methods: Expression of genes for 55 peptide/protein hormones (the ligands) and 73 of their cognate receptor proteins were measured by microarray analyses of LCM-procured carcinoma cells from 247 breast carcinoma biopsies. Using an IRB-approved biorepository and comprehensive database, total RNA was extracted from carcinoma cells to determine expression levels of 22,000 genes. Univariate and multivariate Cox regressions with interaction were determined using expression values of each ligand and its cognate receptor with an interaction term. Results: When pairs of hormone ligand and cognate receptor genes were evaluated by multivariate Cox regression with interaction, the following sets of genes were identified that predicted risk of breast cancer recurrence (INS/IGF2R, HAMP/SLC40A1, POMC/MC4R, GH1/GHR and VIP/VIPR2) and OS (CORT/SSTR5, VIP/VIPR2 and GHRH/GHRHR, based on unadjusted p-value for interaction term &amp;lt; 0.05). Since expression in situ of both hormone and receptor are necessary to elicit endocrine action, a unique alternative approach using the minimum expression value between ligand and receptor for each patient was applied. These results revealed that the complex of HAMP/SLC40A1 showed significance in both the interaction and minimum models, and was further investigated by splitting the ligand and receptor into low (below 1st quartile) and high (above 1st quartile) expression groups. The group consisting of high expression for both ligand and receptor was contrasted with the other three groups (low expression for ligand, receptor, or both). The higher expression group exhibited a better DFS (hazard ratio (HR) = 0.56 95% CI 0.37-0.84, p=0.004) and OS (HR = 0.59 95% CI 0.37-0.93, p=0.022). Conclusion: As a result of determining gene expression directly on pure populations of breast carcinoma cells procured by LCM, we have demonstrated the many lesions synthesize mRNA species for a wide variety of peptide and protein hormones as well as for their cognate receptor proteins. Using clinical follow-up that extended as much as 12 years, univariate and multivariate Cox regression analyses with and without interaction models revealed a number of noteworthy candidates of hormone-receptor complexes that predicted risk of breast cancer recurrence as well as overall survival. Collectively, our results suggests that many breast carcinomas exhibit considerable endocrine autonomy for controlling progression, which warrants investigation of the protein products of the gene candidates in isolated populations of breast carcinoma cells. Citation Format: Wittliff JL, Daniels MW, Brock GN. Expression of genes for peptide/protein hormones and their receptors in breast carcinomas as biomarkers predicting risk of recurrence. [abstract]. In: Proceedings of the Thirty-Eighth Annual CTRC-AACR San Antonio Breast Cancer Symposium: 2015 Dec 8-12; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2016;76(4 Suppl):Abstract nr P3-04-06.

Mechanistic Insights into PTS2-mediated Peroxisomal Protein Import: THE CO-RECEPTOR PEX5L DRASTICALLY INCREASES THE INTERACTION STRENGTH BETWEEN THE CARGO PROTEIN AND THE RECEPTOR PEX7

The destination of peroxisomal matrix proteins is encoded by short peptide sequences, which have been characterized as peroxisomal targeting signals (PTS) residing either at the C terminus (PTS1) or close to the N terminus (PTS2). PTS2-carrying proteins interact with their cognate receptor protein PEX7 that mediates their transport to peroxisomes by a concerted action with a co-receptor protein, which in mammals is the PTS1 receptor PEX5L. Using a modified version of the mammalian two-hybrid assay, we demonstrate that the interaction strength between cargo and PEX7 is drastically increased in the presence of the co-receptor PEX5L. In addition, cargo binding is a prerequisite for the interaction between PEX7 and PEX5L and ectopic overexpression of PTS2-carrying cargo protein drastically increases the formation of PEX7-PEX5L complexes in this assay. Consistently, we find that the peroxisomal transfer of PEX7 depends on cargo binding and that ectopic overexpression of cargo protein stimulates this process. Thus, the sequential formation of a highly stable trimeric complex involving cargo protein, PEX7 and PEX5L stabilizes cargo binding and is a prerequisite for PTS2-mediated peroxisomal import.

ChemInform Abstract: Chemical Methods to Interrogate Bacterial Quorum Sensing Pathways

AbstractReview: 101 refs.

Chemical methods to interrogate bacterial quorum sensing pathways.

Bacteria frequently manifest distinct phenotypes as a function of cell density in a phenomenon known as quorum sensing (QS). This intercellular signalling process is mediated by "chemical languages" comprised of low-molecular weight signals, known as autoinducers, and their cognate receptor proteins. As many of the phenotypes regulated by QS can have a significant impact on the success of pathogenic or mutualistic prokaryotic-eukaryotic interactions, there is considerable interest in methods to probe and modulate QS pathways with temporal and spatial control. Such methods would be valuable for both basic research in bacterial ecology and in practical medicinal, agricultural, and industrial applications. Toward this goal, considerable recent research has been focused on the development of chemical approaches to study bacterial QS pathways. In this Perspective, we provide an overview of the use of chemical probes and techniques in QS research. Specifically, we focus on: (1) combinatorial approaches for the discovery of small molecule QS modulators, (2) affinity chromatography for the isolation of QS receptors, (3) reactive and fluorescent probes for QS receptors, (4) antibodies as quorum "quenchers," (5) abiotic polymeric "sinks" and "pools" for QS signals, and (6) the electrochemical sensing of QS signals. The application of such chemical methods can offer unique advantages for both elucidating and manipulating QS pathways in culture and under native conditions.

Toxin Insertion Into Lipid Monolayers at the Air/Water Interface is Promoted by the Cognate Receptor Protein

Bacterial surfaces mediate many interactions important for health. We describe the production and analysis of a membrane protein containing lipid monolayer, at the air-water interface. Monolayers were formed by spreading a solution of outer membrane protein F (OmpF) / DPPG vesicles at the air-liquid interface. Monolayer structure was analysed parallel and perpendicular to the interface using surface pressure isotherms (SP), Brewster angle microscopy (BAM), see figure, and neutron reflectometry (NR). The domain structure of an OmpF containing monolayer was distinct from that of the protein free monolayer over all surface pressures. OmpF is the receptor for the antibacterial toxin colicin N (ColN) and, by an unknown mechanism, enables the toxin to translocate across the bacterial outer membrane barrier in order to kill E. coli cells. SP and NR data indicated that OmpF enabled ColN to penetrate deeply into the anionic lipid monolayer, and BAM showed a more selective interaction than that seen for lipid monolayers. This suite of methods including selective deuteration can thus provide membrane penetration data for a range of receptor-mediated translocation events in biology where resolution in multiple axes is required.

Cellular Uptake of Ribonuclease A Relies on Anionic Glycans

Bovine pancreatic ribonuclease (RNase A) can enter human cells, even though it lacks a cognate cell-surface receptor protein. Here, we report on the biochemical basis for its cellular uptake. Analyses in vitro and in cellulo revealed that RNase A interacts tightly with abundant cell-surface proteoglycans containing glycosaminoglycans, such as heparan sulfate and chondroitin sulfate, as well as with sialic acid-containing glycoproteins. The uptake of RNase A correlates with cell anionicity, as quantified by measuring electrophoretic mobility. The cellular binding and uptake of RNase A contrast with those of Onconase, an amphibian homologue that does not interact tightly with anionic cell-surface glycans. As anionic glycans are especially abundant on human tumor cells, our data predicate utility for mammalian ribonucleases as cancer chemotherapeutic agents.

Production of the antifungal compound pyrrolnitrin is quorum sensing‐regulated in members of the Burkholderia cepacia complex

Members of the genus Burkholderia are known for their ability to suppress soil-borne fungal pathogens by the production of various antibiotic compounds. In this study we investigated the role of N-acylhomoserine lactone (AHL)-dependent quorum sensing (QS) in the expression of antifungal traits. Using a quorum quenching approach, that is, by heterologous expression of the Bacillus sp. AiiA lactonase, we show that expression of antifungal activities is AHL-dependent in the large majority of the investigated strains belonging to various Burkholderia species. We demonstrate that in certain strains of Burkholderia ambifaria, Burkholderia pyrrocinia and Burkholderia lata, one of the QS-regulated antifungal agents is pyrrolnitrin (prn), a common broad-spectrum antibiotic that is also produced by some Pseudomonas and Serratia species. To investigate the underlying molecular mechanisms of AHL-dependent prn production in better detail, we inactivated the AHL synthase cepI as well as cepR, which encodes the cognate AHL receptor protein, in B. lata 383. Both QS mutants no longer produced prn as assessed by gas chromatography-mass spectrometry analysis and as a consequence were unable to inhibit growth of Rhizoctonia solani. Using fusions of the lacZ gene to the promoter of the prnABCD operon, which directs the synthesis of prn, we demonstrate that expression of prn is positively regulated by CepR at the level of transcription.

Cross Talk between the Cardiovascular and Nervous Systems:Neurotrophic Effects of Vascular Endothelial Growth Factor (VEGF) and Angiogenic Effects of Nerve Growth Factor (NGF)-Implications in Drug Development

Both blood vessels and nerves are guided to their tissue targets by "specific" growth factors such as vascular endothelial growth factor (VEGF) and nerve growth factor (NGF), originally discovered as growth factors specific for endothelial and neuronal cells, respectively. While the eminent role of VEGF in the formation of new blood vessels (angiogenesis) is unquestioned, recent studies indicate that VEGF also has direct effects on the nervous system in terms of neuronal growth, survival (neurotrophic), axonal outgrowth (neurotropic), and neuroprotection. Conversely, NGF, a neurotrophin that plays a crucial role in promoting neurotrophic and neurotropic effects in sympathetic neurons, has recently been identified as a novel angiogenic molecule exerting a variety of effects on endothelial cells and in the cardiovascular system in general. VEGF and NGF have also been implicated in both neurodegenerative and vascular diseases. The pleiotropic effects of these growth factors have raised interest in assessing their therapeutic potential. The challenge for the future is to unravel to what extent the effects of these growth factors are interrelated with regards to their angiogenic, and neurotrophic effects and how to design selective drugs interfering with their respective actions. Most biological actions of NGF and VEGF are mediated by their cognate receptor protein tyrosine kinases, tropomyosin related kinase (trkA for NGF) and kinase insert domain-containing receptor (KDR, VEGFR-2, flk-1 for VEGF), which activate a complex and integrated network of signaling pathways in neurons and endothelial cells. Two small molecules, K252a and SU-5416, which are antagonists of trkA and VEGFR-2, respectively, may serve as key tools in dissecting the role of NGF and VEGF in angiogenesis and neurogenesis. Development of selective drugs specific for the trkA and VEGFR-2 subtypes of receptors will provide new tools for the treatment of neurodegenerative diseases, such as Alzheimer's and Parkinson's, as well as of numerous angiogenesis-dependent diseases, such as cancer, diabetes, and arthritis.

Neurotrophin and neurotrophin receptor protein expression in the human lung.

Neurotrophins (NTs) promote survival and differentiation of central and peripheral neurons, and display several activities also in non-neuronal cells. Human lungs synthesize and release NTs, which are probably involved in the pathophysiology of pulmonary disturbances. In this article the expression and anatomic localization of nerve growth factor, brain-derived neurotrophic factor, and NT-3 and of corresponding high-affinity receptors TrkA, TrkB (full-length and truncated [TR-] isoforms), TrkC, and of the low-affinity p75 receptor, were assessed in surgical samples from adult human lung by reverse transcriptase-polymerase chain reaction, Western blot, and immunohistochemistry. NTs and their cognate receptor mRNA and protein transcripts were detected by reverse transcriptase-polymerase chain reaction and immunoblotting, respectively, nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) mRNA and corresponding protein transcripts being the most expressed. High levels of TrkB-[TR-] mRNA and of its protein transcript were also demonstrated, whereas a low expression of p75 mRNA and of corresponding protein transcript were found. Microanatomic analysis of immunohistochemical study revealed that bronchial epithelial cells were immunoreactive for different NTs, with a higher intensity of BDNF immune staining compared with other NTs, but did not express NT receptor immunoreactivity. Alveolar cells were immunoreactive for TrkA and TrkC receptor protein, but did not display immunoreactivity for NTs or other receptors investigated. Gland cells expressed NT and high-affinity NT receptor immunoreactivity, but not p75 receptor immunoreactivity. NT and low-affinity receptor immunoreactivity was observed within neurons and satellite cells of parasympathetic ganglia as well as in nerve fiber-like structures supplying the bronchopulmonary tree. An obvious immunoreactivity for NTs and NT receptor protein was also observed in intrapulmonary branches of pulmonary artery. Pulmonary lymphocytes and macrophages express nerve growth factor and high-affinity NT receptor immunoreactivity. The role of NTs in non-neuronal tissue including lung has not been clarified yet. The widespread expression of NTs and their receptors in different components of the lung suggests that these factors may contribute to regulate cell function in human lung.

The roles of sex steroid receptor coregulators in cancer

Sex steroid hormones, estrogen, progesterone and androgen, play pivotal roles in sex differentiation and development, and in reproductive functions and sexual behavior. Studies have shown that sex steroid hormones are the key regulators in the development and progression of endocrine-related cancers, especially the cancers of the reproductive tissues. The actions of estrogen, progesterone and androgen are mediated through their cognate intracellular receptor proteins, the estrogen receptors (ER), the progesterone receptors (PR) and the androgen receptor (AR), respectively. These receptors are members of the nuclear receptor (NR) superfamily, which function as transcription factors that regulate their target gene expression. Proper functioning of these steroid receptors maintains the normal responsiveness of the target tissues to the stimulations of the steroid hormones. This permits the normal development and function of reproductive tissues. It can be inferred that factors influencing the expression or function of steroid receptors will interfere with the normal development and function of the target tissues, and may induce pathological conditions, including cancers. In addition to the direct contact with the basal transcription machinery, nuclear receptors enhance or suppress transcription by recruiting an array of coactivators and corepressors, collectively named coregulators. Therefore, the mutation or aberrant expression of sex steroid receptor coregulators will affect the normal function of the sex steroid receptors and hence may participate in the development and progression of the cancers.

A new enzyme-linked immunosorbant assay for the measurement of human vitamin D receptor

The hormonal actions of 1α,25-dihydroxyvitamin D 3 [1,25(OH) 2D 3] are mediated by its cognate receptor protein, the vitamin D receptor (VDR). Despite the growing importance of the VDR system as a modulator of cell growth and differentiation, convenient assays for quantitative measurement of VDR are not readily available, and [ 3H]1,25(OH) 2D 3 ligand binding assays remain the standard method. In this paper, we present data to validate and characterize the usefulness of a new VDR enzyme-linked immunosorbant assay (ELISA) kit developed for the measurement of VDR in biological samples. In this assay, samples are added to microtitration wells coated with anti-VDR antibody and incubated with a second anti-VDR antibody that is biotinylated. The antibody receptor complex is then detected with streptavidin-labeled horseradish peroxidase followed by incubation with a chromogenic substrate, tetramethylbenzidine. The assay was found to be sensitive and accurate for measurements of VDR and compared favorably with the conventional radioligand binding assay (RBA). The interassay variation ranged from 5% to 25% and the intraassay variation was less than 5%. The ELISA presents several advantages over existing methodology, including the use of nonradioactive detection systems, lower protein and sample volume requirements, as well as convenience and speed. The assay can be completed in as short a time as 3 h, avoiding overnight incubations. Data are also presented to demonstrate the ability of the ELISA to detect both occupied and unoccupied VDR, making it a valuable research tool in settings where 1,25(OH) 2D 3 is present. However, the ELISA, as currently formulated, is only useful for the detection of human VDR.