Co-infecting Viruses Research Articles

Prevalence of Co-Infections in Primary Care Patients with Medically Attended Acute Respiratory Infection in the 2022/2023 Season.

In the post-pandemic period, an endemic circulation of respiratory viruses has been re-established. Respiratory viruses are co-circulating with SARS-CoV-2. We performed a retrospective analysis of co-infections in primary care patients with medically attended acute respiratory infections (MAARI) who consulted from week 40/2022 to week 39/2023 and were tested for a panel of respiratory viruses. Out of 2099 samples tested, 1260 (60.0%) were positive for one virus. In 340 samples, co-infection was detected: two viruses in 281 (13.4%), three viruses in 51 (2.4%), and four viruses in eight (0.4%) samples. Respiratory viruses co-infected the patients with MAARI at very different rates. The lowest rates of co-infections were confirmed for influenza B (13.8%) and influenza A (22.9%) and the highest for human bocaviruses (84.0%) and human parechoviruses (82.1%). Co-infections were detected in 28.2% of SARS-CoV-2 positive samples. SARS-CoV-2 has never been co-infected with influenza B virus, enterovirus or adenovirus, although the latter was found as a co-infecting virus with all other respiratory viruses tested. The rate of co-infections decreased significantly with increasing age (p-value 0.000), and no difference was found regarding gender (p-value 0.672). It is important to understand the epidemiology of respiratory co-infections for prevention and management decisions in patients with MAARI.

Molecular characterization of human astrovirus infection in children under 5 years of age with acute gastroenteritis in Tehran, Iran, 2021-2022: co-infection with rotavirus.

Human astroviruses (HAstVs) are considered important causative pathogens of acute gastroenteritis (AGE) in children under 5 years of age worldwide, along with group A rotavirus (RVA), norovirus (NoV), and enteric adenovirus (EAdV). The present study was aimed to both detect HAstV and its co-infections and investigate genetic analysis of circulating HAstV and co-infected virus in hospitalized children under 5 years of age with AGE in Iran. Accordingly, a sum of 200 stool specimens were screened by PCR for HAstV during 2021-2022. The HAstV was found in 0.5% of 200 specimens (n = 1) while was co-infected with RVA. The genetic and phylogenetic analysis indicated HAstV1 genotype, which clustered with viruses from lineage 1b, which has not been previously reported in Iran. The detected RVA strain belonged to G1 lineage II/P[8]-lineage III, which has been reported previously in Iran as the most common strain. The further genetic analysis of RVA VP6 and NSP4 demonstrated an atypical genotype pattern G1P[8]-I1-E2, as a mono-reassortant of a Wa-like genogroup, which appeared to be reassorted with the NSP4 gene of E2 genotype of the G2P[4] DS-1 genogroup. Although the clinical outcomes of the AGE-causing viruses co-infection is not yet entirely clear, it seems that future studies will be helpful to merge clinical and epidemiological data of co-infecting viruses for a more accurate medical and clinical relevance in symptomatic children.

Co-infecting viruses of species Bovine rhinitis B virus (Picornaviridae) and Bovine nidovirus 1 (Tobaniviridae) identified for the first time from a post-mortem respiratory sample of a sheep (Ovis aries) in Hungary

In this study, a picornavirus and a nidovirus were identified from a single available nasopharyngeal swab (NPS) sample of a freshly deceased sheep, as the only vertebrate viruses found with viral metagenomics and next-generation sequencing methods. The sample was originated from a mixed feedlot farm in Hungary where sheep and cattle were held together but in separate stalls. Most of the sheep had respiratory signs (coughing and increased respiratory effort) at the time of sampling. Other NPS were not, but additional enteric samples were collected from sheep (n = 27) and cattle (n = 11) of the same farm at that time. The complete/nearly complete genomes of the identified viruses were determined using RT-PCR and Nanopore (MinION-Flonge) / Dye-terminator sequencing techniques. The results of detailed genomic and phylogenetic analyses indicate that the identified picornavirus most likely belongs to a type 4 genotype of species Bovine rhinitis B virus (BRBV-4, OR885914) of genus Aphthovirus, family Picornaviridae while the ovine nidovirus (OvNV, OR885915) – as a novel variant – could belong to the recently created Bovine nidovirus 1 (BoNV) species of genus Bostovirus, family Tobaniviridae. None of the identified viruses were detectable in the enteric samples using RT-PCR and generic screening primer pairs.Both viruses are well-known respiratory pathogens of cattle, but their presence was not demonstrated before in other animals, like sheep. Furthermore, neither BRBV-4 nor BoNVs were investigated in European cattle and/or sheep flocks, therefore it cannot be determined whether the presence of these viruses in sheep was a result of a single host species switch/spillover event or these viruses are circulating in not just cattle but sheep populations as well.Further studies required to investigate the spread of these viruses in Hungarian and European sheep and cattle populations and to identify their pathogenic potential in sheep.

Epidemiological Characteristics of Human Parainfluenza Viruses Infections - China, 2019-2023.

A retrospective study based on sentinel surveillance was conducted in 10 provincial-level administrative divisions (PLADs) in China to enhance the understanding of the epidemiological characteristics of human parainfluenza viruses (HPIVs). From January 2019 to June 2023, respiratory specimens were collected from individuals with acute respiratory infections (ARIs) and screened for four HPIVs serotypes and other common respiratory viruses using multiplex real-time polymerase chain reaction (PCR). This study analyzed the association of HPIVs infections with seasonal patterns, geographical distribution, demographic profiles, clinical features, and co-infection status. During the study period, a total of 12,866 ARIs were included. The overall detection rate of HPIVs was 6.15%, varying from 5.04% in 2022 to 9.70% in 2020. The median age of HPIVs-infected patients was 3 years. HPIV2 was more prevalent among individuals aged 5-17 years (42.57%), while HPIV4 was more common in those over 65 years (12.24%). HPIV3 (54.16%) and HPIV1 (27.18%) were the predominant serotypes, and their prevalence exhibited significant seasonal fluctuations post- coronavirus disease 2019 (COVID-19) pandemic. The peak of HPIV3 shifted three months later in 2020 compared to 2019 and returned to a summer peak thereafter. Two peaks of HPIV1 were observed in 2021 following the peak of HPIV3. Additionally, co-infections were frequent in HPIVs cases (overall rate: 22.12%), with human rhinovirus being the most common co-infecting virus. The prevalence of HPIVs in China was predominantly due to HPIV3 and HPIV1, and their seasonal patterns were altered by pandemic restrictions. Hence, continuous surveillance of HPIVs is essential.

Rapid and sensitive Cas13a/Cas12a-based one-pot dual-target strategy to detect monkeypox virus and its co-infected viruses

Rapid and sensitive Cas13a/Cas12a-based one-pot dual-target strategy to detect monkeypox virus and its co-infected viruses

The genomic and epidemiological investigations of enteric viruses of domestic caprine (Capra hircus) revealed the presence of multiple novel viruses related to known strains of humans and ruminant livestock species.

In this study, the enteric virome of diarrheic caprine was investigated using next-generation sequencing, reverse transcription PCR methods, and bioinformatics analyses. The complete or nearly complete genomes of seven novel viruses including (i) a caprine astrovirus (OQ758025) of family Astroviridae, four picornaviruses in genera (ii) Boosepivirus (OQ758026), (iii) Enterovirus (OQ758028), (iv) Kobuvirus (OQ758029), and (v) an unassigned picornavirus provisionally called as capripivirus (from the term caprine picornavirus) of the family Picornaviridae (OQ758027), as well as (vi) a tusavirus of family Parvoviridae (OL692339.2) and an (vii) unassigned CRESS DNA virus (OQ758030) have been identified. Structural analyses of the internal ribosomal entry sites revealed the presence of unique motifs and suggest the modular exchange of certain elements between co-infecting viruses. Epidemiological investigations and genotyping PCR reactions of identified RNA virus groups were also conducted using multiple "in-house" developed SYBRgreen-based screening quantitative PCR (qPCR) assays and generic capsid primers on additional fecal samples from ruminant livestock species (n = 62 caprine, n = 32 ovine, and n = 94 cattle) of three different age groups from n = 12 geographically distant sampling sites in Hungary. The results of qPCR screening assays as well as K-means cluster and phylogenetic analyses of the determined sequences suggest that diverse members of the above RNA virus groups were found in all age groups, but mostly in <1-year-old ruminants. Members of the analyzed virus groups were found frequently (37.2%) in multiple (even in quintuple) co-infections, while strains related closely to the identified index viruses were detectable only in certain caprine and ovine samples indicating a wide range of viral diversity. IMPORTANCE Compared with other domestic animals, the virome and viral diversity of small ruminants especially in caprine are less studied even of its zoonotic potential. In this study, the enteric virome of caprine was investigated in detail using next-generation sequencing and reverse transcription PCR techniques. The complete or nearly complete genomes of seven novel viruses were determined which show a close phylogenetic relationship to known human and ruminant viruses. The high similarity between the identified caprine tusavirus (family Parvoviridae) and an unassigned CRESS DNA virus with closely related human strains could indicate the (reverse) zoonotic potential of these viruses. Others, like astroviruses (family Astroviridae), enteroviruses, or novel caripiviruses (named after the term caprine picornavirus) of family Picornaviridae found mostly in multiple co-infections in caprine and ovine, could indicate the cross-species transmission capabilities of these viruses between small ruminants.

Viral Interference During Influenza A-SARS-CoV-2 Coinfection of the Human Airway Epithelium and Reversal by Oseltamivir.

To gain insight into interactions among respiratory viruses, we modeled influenza A virus (IAV)-severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) coinfections using differentiated human airway epithelial cultures. Replicating IAV induced a more robust interferon response than SARS-CoV-2 and suppressed SARS-CoV-2 replication in both sequential and simultaneous infections, whereas SARS-CoV-2 did not enhance host cell defense during influenza infection or suppress IAV replication. Oseltamivir, an antiviral targeting influenza, reduced IAV replication during coinfection but also reduced the host antiviral response and restored SARS-CoV-2 replication. These results demonstrate how perturbations in one viral infection can impact its effect on a coinfecting virus.

Emerging, re‐emerging and/or atypically behaving infectious diseases

Emerging, re‐emerging and/or atypically behaving infectious diseases

What Can Be Learned by a Synoptic Review of Plant Disease Epidemics and Outbreaks Published in 2021?

A synoptic review of plant disease epidemics and outbreaks was made using two complementary approaches. The first approach involved reviewing scientific literature published in 2021, in which quantitative data related to new plant disease epidemics or outbreaks were obtained via surveys or similar methodologies. The second approach involved retrieving new records added in 2021 to the CABI Distribution Database, which contains over a million global geographic records of organisms from over 50,000 species. The literature review retrieved 186 articles, describing studies in 62 categories (pathogen species/species complexes) across more than 40 host species on six continents. Pathogen species with more than five articles were Bursaphelenchus xylophilus, 'Candidatus Liberibacter asiaticus', cassava mosaic viruses, citrus tristeza virus, Erwinia amylovora, Fusarium spp. complexes, F. oxysporum f. sp. cubense, Magnaporthe oryzae, maize lethal necrosis co-infecting viruses, Meloidogyne spp. complexes, Pseudomonas syringae pvs., Puccinia striiformis f. sp. tritici, Xylella fastidiosa, and Zymoseptoria tritici. Automated searches of the CABI Distribution Database identified 617 distribution records new in 2021 of 283 plant pathogens. A further manual review of these records confirmed 15 pathogens reported in new locations: apple hammerhead viroid, apple rubbery wood viruses, Aphelenchoides besseyi, Biscogniauxia mediterranea, 'Ca. Liberibacter asiaticus', citrus tristeza virus, Colletotrichum siamense, cucurbit chlorotic yellows virus, Erwinia rhapontici, Erysiphe corylacearum, F. oxysporum f. sp. cubense Tropical race 4, Globodera rostochiensis, Nothophoma quercina, potato spindle tuber viroid, and tomato brown rugose fruit virus. Of these, four pathogens had at least 25% of all records reported in 2021. We assessed two of these pathogens-tomato brown rugose fruit virus and cucurbit chlorotic yellows virus-to be actively emerging in/spreading to new locations. Although three important pathogens-'Ca. Liberibacter asiaticus', citrus tristeza virus, and F. oxysporum f. sp. cubense-were represented in the results of both our literature review and our interrogation of the CABI Distribution Database, in general, our dual approaches revealed distinct sets of plant disease outbreaks and new records, with little overlap. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Replication Protein Rep Provides Selective Advantage to Viruses in the Presence of CRISPR-Cas Immunity.

Anti-Clustered regularly interspaced small palindromic repeat (CRISPR) (Acr) phages cooperate to establish a successful infection in CRISPR-containing host. We report here the selective advantage provided by a replication initiator, Rep, toward cooperative host immunosuppression by viruses encoding Acrs. A rep knockout mutant (Δgp16) of Sulfolobus islandicus rod-shaped virus 2 produced around fourfold less virus in a CRISPR-null host, suggesting that Rep is the major replication initiator. In addition to Rep-dependent replication initiation from the viral genomic termini, we detected Rep-independent replication initiation from nonterminal sites. Intriguingly, despite the presence of Acrs, lack of Rep showed a profound effect on virus propagation in a host carrying CRISPR-Cas immunity. Accordingly, the co-infecting parental virus (rep-containing) outcompeted the Δgp16 mutant much more quickly in the CRISPR-containing host than in CRISPR-null host. Despite the nonessentiality, rep is carried by all known members of Rudiviridae, which is likely an evolutionary outcome driven by the ubiquitous presence of CRISPR-Cas in Sulfolobales.

Capripoxviruses, leporipoxviruses, and orthopoxviruses: Occurrences of recombination.

Poxviruses are double-stranded DNA viruses with several members displaying restricted host ranges. They are genetically stable with low nucleotide mutation rates compared to other viruses, due to the poxviral high-fidelity DNA polymerase. Despite the low accumulation of mutations per replication cycle, poxvirus genomes can recombine with each other to generate genetically rearranged viruses through recombination, a process directly associated with replication and the aforementioned DNA polymerase. Orthopoxvirus replication is intimately tethered to high frequencies of homologous recombination between co-infecting viruses, duplicated sequences of the same virus, and plasmid DNA transfected into poxvirus-infected cells. Unfortunately, the effect of these genomic alterations on the cellular context for all poxviruses across the family Poxviridae remains elusive. However, emerging sequence data on currently circulating and archived poxviruses, such as the genera orthopoxviruses and capripoxviruses, display a wide degree of divergence. This genetic variability cannot be explained by clonality or genetic drift alone, but are probably a result of significant genomic alterations, such as homologous recombination, gene loss and gain, or gene duplications as the major selection forces acting on viral progeny. The objective of this review is to cross-sectionally overview the currently available findings on natural and laboratory observations of recombination in orthopoxviruses, capripoxviruses, and leporipoxviruses, as well as the possible mechanisms involved. Overall, the reviewed available evidence allows us to conclude that the current state of knowledge is limited in terms of the relevance of genetic variations across even a genus of poxviruses as well as fundamental features governing and precipitating intrinsic gene flow and recombination events.

Interactions between seasonal temperature variation and temporal synchrony drive increased arbovirus co-infection incidence.

Though instances of arthropod-borne (arbo)virus co-infection have been documented clinically, the overall incidence of arbovirus co-infection and its drivers are not well understood. Now that dengue, Zika and chikungunya viruses are all in circulation across tropical and subtropical regions of the Americas, it is important to understand the environmental and biological conditions that make co-infections more likely to occur. To understand this, we developed a mathematical model of co-circulation of two arboviruses, with transmission parameters approximating dengue, Zika and/or chikungunya viruses, and co-infection possible in both humans and mosquitoes. We examined the influence of seasonal timing of arbovirus co-circulation on the extent of co-infection. By undertaking a sensitivity analysis of this model, we examined how biological factors interact with seasonality to determine arbovirus co-infection transmission and prevalence. We found that temporal synchrony of the co-infecting viruses and average temperature were the most influential drivers of co-infection incidence. Our model highlights the synergistic effect of co-transmission from mosquitoes, which leads to more than double the number of co-infections than would be expected in a scenario without co-transmission. Our results suggest that appreciable numbers of co-infections are unlikely to occur except in tropical climates when the viruses co-occur in time and space.

Trans-Encapsidation of Foot-and-Mouth Disease Virus Genomes Facilitates Escape from Neutralizing Antibodies.

Foot-and-mouth disease is an economically devastating disease of livestock caused by foot-and-mouth disease virus (FMDV). Vaccination is the most effective control measure in place to limit the spread of the disease; however, the success of vaccination campaigns is hampered by the antigenic diversity of FMDV and the rapid rate at which new strains emerge that escape pre-existing immunity. FMDV has seven distinct serotypes, and within each serotype are multiple strains that often induce little cross-protective immunity. The diversity of FMDV is a consequence of the high error rate of the RNA-dependent RNA polymerase, accompanied by extensive recombination between genomes during co-infection. Since multiple serotypes and strains co-circulate in regions where FMDV is endemic, co-infection is common, providing the conditions for recombination, and also for other events such as trans-encapsidation in which the genome of one virus is packaged into the capsid of the co-infecting virus. Here, we demonstrate that the co-infection of cells with two FMDVs of different serotypes results in trans-encapsidation of both viral genomes. Crucially, this facilitates the infection of new cells in the presence of neutralizing antibodies that recognize the capsid that is encoded by the packaged genome.

Distribution of Viral Respiratory Pathogens During the COVID-19 Pandemic: A Single-Center Pediatric Study from Turkey.

ObjectiveTo evaluate the distribution and characteristics of respiratory viral pathogens and to assess the epidemiological data, clinical features, and prognoses of infected children in a pediatric emergency department during the COVID-19 pandemic.Materials and MethodsBetween September 1, 2020, and April 30, 2021, patients aged between 0 and 18 years arrived at the pediatric emergency department and were tested by nasopharyngeal/tracheal specimen polymerase chain reaction for both SARS-CoV-2 and other viral respiratory pathogens. Demographics, symptoms, laboratory and radiologic investigations, respiratory viruses detected by PCR, presence of co-infection and co-infecting viruses, need for respiratory support, hospitalization, length of hospital stay, and prognosis were recorded.ResultsThere were 327 patients for whom PCR tests were performed and 118 (36.0%) of them had positive results for SARS-CoV-2 and/or other respiratory viruses. Rhinovirus was the most commonly detected pathogen with 74 (62.7%) cases, followed by enterovirus with 38 (32.2%) and adenovirus with 20 (16.9%) cases. There was no detection of influenza virus or respiratory syncytial. SARS-CoV-2 PCR results were positive in 14 (11.9%) cases and there was only 1 co-infection of SARS-CoV-2 occurring together with rhinovirus. For 43 (36.4%) patients, there was co-infection, and among co-infections, the most common was that of rhinovirus and enterovirus, seen in 37 (86.0%) cases.ConclusionA decrease was observed in the positivity rate of respiratory viral pathogens, while no cases of influenza virus or respiratory syncytial virus were observed in our study. Circulating viruses may change due to multifactorial approaches during the COVID-19 pandemic.

Detection and Simultaneous Differentiation of Three Co-infected Viruses in Zanthoxylum armatum.

Green Sichuan pepper (Zanthoxylum armatum) is an important economic fruit crop, which is widely planted in the southwest region of China. Recently, a serious disease, namely flower yellowing disease (FYD), broke out, and the virus of green Sichuan pepper nepovirus (GSPNeV) was identified to be highly correlated with the viral symptoms. Meanwhile, green Sichuan pepper idaeovirus (GSPIV) and green Sichuan pepper enamovirus (GSPEV) were also common viruses infecting green pepper. In our research, specific primers were designed according to the reported sequences of the three viruses, and a multiplex reverse transcription-polymerase chain reaction (RT-PCR) method for the simultaneous detection of GSPNeV, GSPIV, and GSPEV was established. The annealing temperature, extension time, and cycle number affecting the multiplex RT-PCR reaction were adjusted and optimized. Sensitivity analysis showed that the system could detect the three viruses simultaneously from the complementary deoxyribonucleic acid (cDNA) samples diluted by 10−3. The results of the ten samples detected by the multiplex RT-PCR system were consistent with the results of a single PCR, indicating that the method can be successfully used for rapid detection of field samples.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Demonstration of Co-Infection and Trans-Encapsidation of Viral RNA In Vitro Using Epitope-Tagged Foot-and-Mouth Disease Viruses.

Foot-and-mouth disease, caused by foot-and-mouth disease virus (FMDV), is an economically devastating disease affecting several important livestock species. FMDV is antigenically diverse and exists as seven serotypes comprised of many strains which are poorly cross-neutralised by antibodies induced by infection or vaccination. Co-infection and recombination are important drivers of antigenic diversity, especially in regions where several serotypes co-circulate at high prevalence, and therefore experimental systems to study these events in vitro would be beneficial. Here we have utilised recombinant FMDVs containing an HA or a FLAG epitope tag within the VP1 capsid protein to investigate the products of co-infection in vitro. Co-infection with viruses from the same and from different serotypes was demonstrated by immunofluorescence microscopy and flow cytometry using anti-tag antibodies. FLAG-tagged VP1 and HA-tagged VP1 could be co-immunoprecipitated from co-infected cells, suggesting that newly synthesised capsids may contain VP1 proteins from both co-infecting viruses. Furthermore, we provide the first demonstration of trans-encapsidation of an FMDV genome into capsids comprised of proteins encoded by a co-infecting heterologous virus. This system provides a useful tool for investigating co-infection dynamics in vitro, particularly between closely related strains, and has the advantage that it does not depend upon the availability of strain-specific FMDV antibodies.

A plant-infecting subviral RNA associated with poleroviruses produces a subgenomic RNA which resists exonuclease XRN1 in vitro

Subviral agents are nucleic acids which lack the features for classification as a virus. Tombusvirus-like associated RNAs (tlaRNAs) are subviral positive-sense, single-stranded RNAs that replicate autonomously, yet depend on a coinfecting virus for encapsidation and transmission. TlaRNAs produce abundant subgenomic RNA (sgRNA) upon infection. Here, we investigate how the well-studied tlaRNA, ST9, produces sgRNA and its function. We found ST9 is a noncoding RNA, due to its lack of protein coding capacity. We used resistance assays with eukaryotic Exoribonuclease-1 (XRN1) to investigate sgRNA production via incomplete degradation of genomic RNA. The ST9 3’ untranslated region stalled XRN1 very near the 5’ sgRNA end. Thus, the XRN family of enzymes drives sgRNA accumulation in ST9-infected tissue by incomplete degradation of ST9 RNA. This work suggests tlaRNAs are not just parasites of viruses with compatible capsids, but also mutually beneficial partners that influence host cell RNA biology.

SARS-CoV-2 acute bronchiolitis in hospitalized children: Neither frequent nor more severe.

IntroductionEndemic coronaviruses have been found in acute bronchiolitis, mainly as a coinfecting virus. Severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) has been responsible for respiratory illness in hospitalized children. The characteristics of patients with bronchiolitis have not been extensively described.MethodsCross‐sectional study of patients with bronchiolitis and SARS‐CoV‐2 infection enrolled in a prospective multicenter cohort of children hospitalized with COVID‐19 in Spain from March 1, 2020 to February 28, 2021.ResultsTwelve of 666 children infected with SARS‐CoV‐2 who required hospital admission met the diagnostic criteria for bronchiolitis (1.8%). Median age was 1.9 months (range: 0.4–10.1). Six cases had household contact with a confirmed or probable COVID‐19 case. Main complaints were cough (11 patients), rhinorrhea (10), difficulty breathing (8), and fever (8). Eleven cases were classified as mild or moderate and one as severe. Laboratory tests performed in seven patients did not evidence anemia, lymphopenia, or high C‐reactive protein levels. Chest X‐rays were performed in six children, and one case showed remarkable findings. Coinfection with metapneumovirus was detected in the patient with the most severe course; Bordetella pertussis was detected in another patient. Seven patients required oxygen therapy. Albuterol was administered in four patients. One patient was admitted to the pediatric intensive care unit. Median length of admission was 4 days (range: 3–14). No patient died or showed any sequelae at discharge. Two patients developed recurrent bronchospasms.ConclusionSARS‐CoV‐2 infection does not seem to be a main trigger of severe bronchiolitis, and children with this condition should be managed according to clinical practice guidelines.

ICTV Virus Taxonomy Profile: Portogloboviridae.

Portogloboviridae is a family of viruses with circular, double-stranded DNA genomes of about 20 kbp. Their icosahedral virions have a diameter of 87 nm, and consist of an outer protein shell, an inner lipid layer and a nucleoprotein core wound up into a spherical coil. Portogloboviruses infect hyperthermophilic archaea of the genus Saccharolobus, order Sulfolobales and are presumably nonlytic. Portogloboviruses encode mini-CRISPR arrays which they use to compete against other co-infecting viruses. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Portogloboviridae, which is available at ictv.global/report/portogloboviridae.