CML Samples Research Articles

Validation of a novel NGS based BCR::ABL1 kinase domain mutation detection assay in Indian cohort

The efficacy and treatment outcome of a CML patient are heavily dependent on BCR::ABL1 kinase domain (KD) mutation status. Next-generation sequencing technology is a bright alternative to the previously used sanger sequencing method due to its global presence in diagnostic setups, massive parallel sequencing ability, and far better sensitivity. In the present study, we have demonstrated a new protocol for kinase domain mutation analysis using the next-generation sequencing (NGS) method using the ion torrent sequencing platform. This protocol uses RNA as the starting material, followed by nested PCR to amplify the fusion transcript, which is subsequently used as a template for NGS. Initial validation and comparison of this assay with the sanger sequencing (SS) method yielded 95.23% agreement. CML samples (n = 121) with a failure to TKI response were subjected to this newly developed NGS-based assay to detect KD mutations, from which samples were found to have mutations with a sensitivity ranging from 2.32 to 93.41%. A total of 34.71% of samples (n = 42) were found to be positive for one or more KD mutations, whereas 65.29% of samples (n = 81) were found to be negative. Nine samples out of 42 positive samples, i.e., 21.42%, were found to have compound mutations. This is one of the first studies from India, which includes more than 160 samples and is analyzed by the NGS approach for KD mutation analysis.

Identification and validation of hub genes and molecular classifications associated with chronic myeloid leukemia.

Chronic myeloid leukemia (CML) is a kind of malignant blood tumor, which is prone to drug resistance and relapse. This study aimed to identify novel diagnostic and therapeutic targets for CML. Differentially expressed genes (DEGs) were obtained by differential analysis of the CML cohort in the GEO database. Weighted gene co-expression network analysis (WGCNA) was used to identify CML-related co-expressed genes. Least absolute shrinkage and selection operator (LASSO) regression analysis was used to screen hub genes and construct a risk score model based on hub genes. Consensus clustering algorithm was used for the identification of molecular subtypes. Clinical samples and in vitro experiments were used to verify the expression and biological function of hub genes. A total of 378 DEGs were identified by differential analysis. 369 CML-related genes were identified by WGCNA analysis, which were mainly enriched in metabolism-related signaling pathways. In addition, CML-related genes are mainly involved in immune regulation and anti-tumor immunity, suggesting that CML has some immunodeficiency. Immune infiltration analysis confirmed the reduced infiltration of immune killer cells such as CD8+ T cells in CML samples. 6 hub genes (LINC01268, NME8, DMXL2, CXXC5, SCD and FBN1) were identified by LASSO regression analysis. The receiver operating characteristic (ROC) curve confirmed the high diagnostic value of the hub genes in the analysis and validation cohorts, and the risk score model further improved the diagnostic accuracy. hub genes were also associated with cell proliferation, cycle, and metabolic pathway activity. Two molecular subtypes, Cluster A and Cluster B, were identified based on hub gene expression. Cluster B has a lower risk score, higher levels of CD8+ T cell and activated dendritic cell infiltration, and immune checkpoint expression, and is more sensitive to commonly used tyrosine kinase inhibitors. Finally, our clinical samples validated the expression and diagnostic efficacy of hub genes, and the knockdown of LINC01268 inhibited the proliferation of CML cells, and promoted apoptosis. Through WGCNA analysis and LASSO regression analysis, our study provides a new target for CML diagnosis and treatment, and provides a basis for further CML research.

ASXL1 MUTATION ANALYSIS IN CHRONIC MYELOID LEUKAEMIA PATIENTS

BackgroundIn recent years, additional sex comb-like 1 (ASXL1) gene mutations have recently been linked to several myeloid cancers.
 Objectives To characterize ASXL1 mutation prevalence, determine if these abnormalities might constitute a significant event in CML prognosis, and establish the correlations if these mutations are associated with CML transformation and/or imatinib (IM) resistance, Here we designed a study to investigate ASXL1 gene that is frequently mutated in myeloid malignancies and evaluated their occurrence in a well-defined group of CML patients.
 Patients and MethodsThe study population consists of 80 patients diagnosed with CML under treatment with TKI (Imatinib 400,600,800 mg/day and Nilotinib). Ten healthy subjects were checked as controls. Depending on their molecular and/or cytogenetic response, CML patients will either be classified into imatinib-resistant or imatinib-good responders. Then the DNA was extracted depending on the Salting-Out protocol. Then genome amplification was performed on exon 12 and in the HOT spot region for the detection of somatic mutations, using conventional PCR.
 ResultsNine out of 80 CML samples (11.25%) were determined to have mutations with the ASXL1 gene. We identified a novel Mutation (c.1808_1820delCCTCCTGCCGGGG S603Ffs*96) in one of the patients that has not been reported before. We also identified three other mutations (c.1933_1934del G p.G645Wfs*12, c.2047A>G p.T683A, c.1900_1922 delAGAGAGGCGGCCACCACTGCCAT E635Rfs*15).
 ConclusionOur discovery of an ASXL1 mutation, a potential tumour suppressor gene, is a significant genetic aberration in CML. Our findings suggest that ASXL1 mutations are common in patients with late stages of the disease and imatinib therapy resistance.

Three-dimensional nuclear telomere architecture and differential expression of aurora kinase genes in chronic myeloid leukemia to measure cell transformation

BackgroundTelomere dysfunction results in aneuploidy, and ongoing chromosomal abnormalities. The three-dimensional (3D) nuclear organization of telomeres allows for a distinction between normal and tumor cells. On the other hand, aurora kinase genes (AURKA and AURKB) play an important role regulating the cell cycle. A correlation between overexpression of aurora kinase genes and clinical aggressiveness has been demonstrated in different types of neoplasias. To better understand cellular and molecular mechanisms of CML evolution, it was examined telomere dysfunction (alterations in the 3D nuclear telomere architecture), and the expression levels of AURKA and AURKB genes in two clinical distinct subgroups of CML samples, from the same patient.MethodsEighteen CML patients, in total, 36 bone marrow samples (18 patients, chronic vs. accelerated/blast phase) were eligible for 3D telomeric investigations. Quantitative 3D imaging, cytologic diagnosis and cytogenetic determination of additional chromosomal abnormalities were assessed according to standard protocols.ResultsUsing TeloView software, two CML subgroups were defined based on their 3D telomeric profiles, reflecting the different stages of the disease (chronic vs. accelerated/blast phase). Statistical analyses showed significant differences between the CML subgroups (p < 0.001). We also found that AURKA and AURKB mRNA were expressed at significantly higher levels in both CML subgroups, when compared with healthy donors. Our findings suggest that the evolution of CML progresses from a low to a high level of telomere dysfunction, that is, from an early stage to a more aggressive stage, followed by disease transformation, as demonstrated by telomere, additional chromosomal abnormalities, and gene expression profile dynamics.ConclusionsThus, we demonstrated that 3D telomere organization, in accordance with the genomic instability observed in CML samples were able to distinguish subgroup CML patients. Classifying CML patients based on these characteristics might represent an important strategy to define better therapeutic strategies.

CD26/DPP-4 in Chronic Myeloid Leukemia.

Simple SummaryCD26/dipeptidylpeptidase IV (DPP-4) is a membrane-bound multifunctional protein expressed in many primary solid tumors and in hematological diseases. Recent investigations demonstrated its specific expression on leukemic stem cells (LSCs) of Chronic Myeloid Leukemia (CML) bone marrow (BM) and peripheral blood (PB) samples. Thanks to this evidence, CD26 has been considered a novel exclusive stem cell marker of CML. The aim of this review is to describe and analyze the role of CD26 in the context of hematological malignancies and specifically of CML and to highlight its potential clinical application for the management of this disease.CD26 expression is altered in many solid tumors and hematological malignancies. Recently, it has been demonstrated that it is a specific marker expressed on LSCs of CML, both in BM and PB samples, and absent on CD34+/CD38− stem cells in normal subjects or on LSCs of other myeloid neoplasms. CD26+ LSCs have been detected by flow-cytometry assays in all PB samples of Chronic-Phase CML patients evaluated at diagnosis. Additionally, it has been demonstrated that most CML patients undergoing Tyrosine Kinase Inhibitors (TKIs) treatment still harbored circulating measurable residual CD26+ LSCs, even when displaying a consistent deep molecular response without any significant association among the amounts of BCR-ABL transcript and CD26+ LSCs. Preliminary data of our Italian prospective multicenter study showed that CML patients with a poorer response presented with a higher number of CD26+ LSCs at diagnosis. These data confirmed that CD26 is a specific marker of CML and suggest that it could be considered for the monitoring of therapeutic responses.

Abstract 3792: Imetelstat inhibits RNA-editing mediated myeloproliferative neoplasm stem cell self-renewal

Abstract Introduction: Myeloproliferative neoplasms (MPN) including blast crisis (BC) CML and myelofibrosis (MF) are characterized by the clonal proliferation of hematopoietic cell lineages, mostly in the marrow. BC CML gives rise to TKI resistant myeloid progenitors that activate Wnt/β-catenin signaling pathway. However, BCR-ABL TKI resistant BC CML exhibits a robust telomerase activity and presents at very low or undetectable level in normal cells, and telomerase plays a pivotal role in cancer cell growth and may serve as an ideal target for anticancer therapeutics. In addition, β-catenin had been reported to transcriptionally regulate human telomerase reverse transcriptase (TERT). Telomerase is composed of the enzymatic reverse transcriptase protein TERT and the RNA template TERC. Thus, we investigated the capacity of imetelstat, a telomerase inhibitor, which binds to the TERC subunit with high affinity to prevent self-renewal of malignant progenitors. Recent clinical trials showed early signs of efficacy in MF. But, it's role in selectively inhibiting leukemia stem cell (LSC) self-renewing in CML has not been elucidated. Methods and Results: Progenitors from BC CML were compared with chronic phase (CP) CML and primary normal samples, RNA-seq results revealed upregulation of TERT suggesting a role for TERT activation in BC CML progenitor transformation. Human MPN progenitor co-culture experiments revealed that combined treatment with dasatinib at 1 nM, and imetelstat at 1 or 5 uM significantly inhibited (p &amp;lt; 0.001, ANOVA) in vitro replating of BC CML compared with aged bone marrow progenitors. Also, imetelstat (5 mM) significantly reduced replating of MF compared with normal progenitor samples. Treatment of humanized MPN mouse models, established with 5 different BC CML and 4 different MF samples, at 30 mg/kg of imetelstat, three times a week for 4 weeks resulted in a significant reduction of malignant progenitors and human CD45+ cells (p &amp;lt; 0.001, t test) in BC CML, and a significant reduction of human CD45+ cells (p&amp;lt;0.01, t test) in MF in both marrow and spleen, when compared with vehicle controls. FACS analysis revealed a significant reduction of activated β-catenin protein in BC CML engrafted human progenitors after imetelstat treatment (p &amp;lt; 0.01, t test) compared with vehicle control. In addition, a significant inhibition of TERT (p = 0.03) and TERC (p = 0.02) was observed in BC CML LSC isolated from imetelstat treated mouse marrow when compared with vehicle control. Notably, imetelstat treatment spares normal human cells in humanized normal stem cell mouse models. Recent RNA-sequencing analysis showed an increase in ADAR1 expression during MPN progression, and our RNA-seq analysis demonstrated a decreased ADAR1 gene expression (p &amp;lt; 0.005) as well as overall adenosine to inosine editing rates as measured by edits per million reads (p &amp;lt;0.005) following imetelstat treatment of BC CML engrafted mice when compared to mismatch control. Conclusions: Niche responsive interactions between the telomerase complex and the Wnt/β-catenin self-renewal pathway sensitize β-catenin activated MPN progenitors to imetelstat treatment in both the in vitro co-culture and in vivo humanized MPN mouse models thereby providing a strong rationale for studies assessing eradication of malignant progenitors using imetelstat. Citation Format: Wenxue Ma, Larisa Balaian, Cayla Mason, Raymond Diep, Jessica Pham, Qingfei Jiang, Jeremy Lee, Sheldon Morris, Phoebe Mondala, Ping Chen, Thomas Whisenant, Mary Donohoe, Benjamin Heyman, Edward Ball, Fei Huang, Catriona Jamieson. Imetelstat inhibits RNA-editing mediated myeloproliferative neoplasm stem cell self-renewal [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 3792.

Inhibition of Skp2 Sensitizes Chronic Myeloid Leukemia Cells to Imatinib.

IntroductionSkp2 is an E3 ubiquitin ligase that plays an important role in modulating tumor progression. The mechanisms underlying Skp2 in the promotion of proliferation and its function in the primary resistance to tyrosine kinase inhibitors (TKIs) in human CML remain to be determined. This study aimed to investigate the function of Skp2 in CML progression as well as its effects on TKI sensitivity.MethodsExpression of Skp2 in leukocytes from patients with CML and normal blood samples was analyzed by qRT-PCR. Cell proliferation was analyzed by EdU incorporation and cell counting assays. Luciferase reporter and chromatin immunoprecipitation assays were used for examination of the effects of CREB on Skp2 expression. The apoptosis in vitro of K562 cells was analyzed by MTT and caspase 3/7 activity assays.ResultsThe present study demonstrates that Skp2 was expressed at a higher level in patients with CML compared with healthy donors, and the elevated expression of Skp2 is critical for CML cell proliferation. Mechanistically, Skp2 was transcriptionally upregulated by CREB responsive to the PI3K/Akt signaling pathway. Furthermore, inhibition of Skp2 expression by shRNAs or blocking the PI3K/Akt/CREB pathway greatly enhances the sensitivity of CML cells to Imatinib treatment.ConclusionWe conclude that the PI3K/Akt/CREB axis regulates the sensitivity of K562 cells to Imatinib via mediating Skp2 expression. The present study revealed an unknown role of Skp2 in CML progression and provided new aspects on the Skp2-modulated TKI sensitivity in CML, contributing to the development of potential therapeutic anticancer drugs.

Svd-SRS: A Highly Specific Algorithm for Identifying Somatic Genomic Rearrangements in Haematological Malignancy

The detection of chromosomal rearrangements in haematological malignancies is important for providing appropriate clinical care. Many chromosomal rearrangements are detected by standard cytogenetic analysis (G-banding) but others are too subtle and evade detection by this method. Techniques such as PCR or FISH can be used to focus detection on specific rearrangements to confirm or refute their presence, but other less common but potentially significant rearrangements will be missed by gene-centric methods. Whole Genome Sequencing (WGS) has the potential to identify all possible genomic rearrangements and mutations in patients. Analysing WGS data is not trivial however, and currently available programs detect thousands of structural abnormalities in a single patient by comparison to the reference genome. Most of these abnormalities are simply not real somatic changes and have the potential to mislead and waste effort and resources in their confirmation. There is an urgent need for an analysis pipeline that is both sensitive and specific so that only the true somatic changes that cause the malignancy and influence its clinical course are detected. Here we describe SVD-SRS, a new algorithm for the detection of somatic genomic structural rearrangements in paired-end WGS data with high specificity, and without the need for a germline comparator. SVD-SRS was developed using a 64-core server to enable massively parallel data processing, but the algorithm is scalable and can be implemented on systems with fewer resources. SVD-SRS uses discordant and split reads to identify and model structural rearrangements in paired-end WGS data. SVD-SRS differs from other less specific algorithms because it performs a series of internal validation steps to identify only those discordant split reads that give reliable evidence of structural rearrangement. The orientation of reads with respect to their pairs is then used to categorise breakpoint sequences into the different types of structural rearrangement. To exclude structural polymorphisms, each putative breakpoint sequence is compared with publicly available databases of normal variants. To demonstrate the performance and utility of SVD-SRS, we analysed whole genome sequences of primary samples taken from patients with acute or chronic haematological malignancy, and compared these to that of MANTA, a commonly used structural variant caller. We also engineered 10 structural rearrangements into the reference genome at various levels to see if they would be detected. MANTA reported an average of 16,711 ± 800 structural variants in each primary sample. Using 16 cores, MANTA had a run time of 1h per sample. Filtering the output for only translocations with an allele frequency ≥30%, the output was reduced to &lt;100 events per sample but this removed clinically important validated rearrangements from the dataset. This demonstrates that filtering by read-depth is not adequate for improving the specificity of MANTA. It simply reduces the number of calls. In contrast, SVD-SRS reported &lt;10 events for each sample, with a run time of &lt;12h using 16 cores. The run time per sample is longer compared with MANTA because of the validation steps taken to select appropriate reads and exclude structural polymorphisms. Notably the massively reduced number of reported variants makes scrutiny of the data much more feasible in a clinical setting. SVD-SRS detected all rearrangements present in the initial cytogenetic report of the samples tested. This included t(9;22)(q34;q11) BCR/ ABL1, inv(3)(q21;q26) GATA2/ MECOM, and t(8;14)(q24;q32) IGH/ MYC in CML, ALL, and Burkitt's Lymphoma samples, as well as the immunoglobulin heavy chain recombination events important for ALL and CLL prognosis. SVD-SRS also detected 1 or 2 additional rearrangements of clinical importance (e.g. del(9p21) CDKN2A/ CDKN2B) in 30% of the samples analysed. All additional rearrangements were validated by PCR. For the engineered sample, SVD-SRS detected all but one event which was present at a very low level, whilst MANTA identified all events as well as an additional 20 that were not introduced into the reference genome in the first place. Based on these data, SVD-SRS has massively improved the specificity of structural variant detection compared with MANTA, and is suitably sensitive and specific to replace cytogenetic techniques in clinical practice. Disclosures No relevant conflicts of interest to declare.

Abstract 831: Hypermethylation in promoter regions of CpG islands of multiple genes is associated with disease progression and molecular response in chronic myelogenous leukemia

Abstract Chronic myelogenous leukemia (CML) has a typical progressive course with transition from a less aggressive chronic phase to a terminal more aggressive blast crisis. The molecular mechanisms leading to CML disease progression remain to be elucidated. However, it has been proposed in many studies that alterations in the methylation status of various genes may contribute to the progression of different malignancies. Hence, in this study we tried to understand the role of aberrant methylation of six tumor suppressor genes in the disease progression and molecular response in CML. We investigated 100 CML patients and 100 age and sex matched healthy controls for the methylation status of six tumor suppressor genes. The methylation status of these genes was evaluated by MS-PCR. In this study, 100 CML samples and 100 controls were analyzed for the DAPK1, RASSF1A, RIZ-1, p16, p14ARF and SOCS-1 promoter methylation status. These genes, except p14ARF and SOCS-1 showed significant differences in methylation status among CML patients and healthy controls. Also DAPK1, RASSF1A, RIZ-1, p16 and p14ARF genes were observed to be hypermethylated during progression of CML disease to advanced phases. The methylation frequencies of these five genes were seen to increase progressively during CML disease progression. This increase in hypermethylation of these five genes from was statistically significant with a p-value of &amp;lt;0.0001, 0.001, 0.009,0.002 and 0.01 respectively. Although, there was a progressive increase in the promoter methylation of SOCS1 gene during the CML disease progression (CP= 4%, AP=8% and BC=16%) but this did not reached a statistical significance (p-value 0.1). We also assessed the molecular response of these 100 CML patients after imatinib therapy and the patients were categorized into two groups; major molecular response group and loss of molecular response group. Out of 100 CML patients on imatinib therapy 52 achieved major molecular response while 48 patients showed loss of molecular response. Out of the above studied genes RASSF1 and RIZ1 promoter hypermethylation was significantly associated with loss of molecular response in CML patients receiving imatininb therapy. Out of 48 CML patients who were in loss of molecular response, 23.0% and 16.77% showed promoter hypermethylation of RASSF1 and RIZ1 genes respectively while out of 52 patients that were in major molecular response only 9.6% and 1.92% of patients showed hypermethylation in RASSF1 and RIZ1 genes respectively. These results suggest that hypermethylation of tumor suppressor genes plays a significant role in the progression and response in CML. Note: This abstract was not presented at the meeting. Citation Format: Mamta P. Sumi, Sameer A. Guru, Imtiyaz A Najar, Mariyam Zuberi, N. Gupta, Alpana Saxena. Hypermethylation in promoter regions of CpG islands of multiple genes is associated with disease progression and molecular response in chronic myelogenous leukemia [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 831.

Long Term Culture of Primary AML and CML Cells: Effects of Growth Factor Composition on Cell Expansion and Differentiation

Introduction:In vitro experiments with primary acute and chronic myeloid leukemia (AML, CML) cells are widely applied for testing of anti-tumor drug activity. Several studies also documented long-term maintenance of primary cells with the support of stromal cells and growth factors. However, to our knowledge, none of these studies sufficiently analyzed the differentiation and phenotype changes occurring during the long-term culture.Aim:To evaluate the expansion and phenotype changes of primary AML and CML cells in long-term culture using different cytokine cocktails.Methods:Primary leukocytes from 6 de novo AML samples, 5×10^5 per well, (various French-American-British classification) and CD34+ cells isolated from 4 de novo CML samples, 15-50×10^3 per well, were seeded onto a confluent layer of human bone-marrow mesenchymal stromal cells (MSCs) in 24-well plates. Four culture conditions were tested: a) “stem cell” supporting condition, designated as C4, with 4 early acting cytokines SCF, TPO, FLT3-ligand and IL-6, b) myeloid cell supporting condition C6, with the C4 cytokines plus two additional late acting growth factors IL-1 and IL-3, c) myeloid cell supporting condition C7 with the same cytokines as C6 plus terminal differentiation factor GM-CSF, d) condition adopted from previous studies, designated as C3, containing cytokines TPO, IL-3, G-SCF. Additional negative control condition C-neg did not include MSCs nor any cytokines. Experiments were analyzed after 2-weeks of culture. Phenotypization was performed both pre- and post-culture by flow cytometry.Results:For all AML samples, the tested culture conditions showed successful maintenance of cells in vitro, although with highly heterogeneous expansion rates for the individual samples (0-14 fold expansion, yielding up to 3.5×10^6 cells per well). No AML cells survived in the negative control condition C-neg, for 4/6 samples. The maximum expansion (representing relative yield of 100%) was obtained with the myelo-condition C7 in 5/6 patients. The mean relative yield from all patients for C7 was 97%. The other conditions provided mean relative yields of: C6 - 79%, C4 - 43%, C3 - 44%, and C-neg - 3.5%.Comparison of pre- and post-culture phenotypes revealed differentiation of AML cells in vitro, demonstrated by the decrease of primitive CD34+ fraction and shifting of less differentiated CD33dim cells into mature CD33bright fraction (mean log2 reduction in CD34+ cells: C4 - 0.5×, p=0.4, C7 - 1.4×, p=0.01, C6 - 1.3×, p=0.01, C3 - 1.0×, p=0.03; mean log2 reduction in CD33dim cells: C4 - 0.8×, p=0.2, C7 - 2.0×, p<0.001, C6 - 2.0×, p<0.001, C3 - 1.1×, p=0.07). Expression of CD14 and also CD117 showed large intra-patient differences (both increase and decrease), without statistically significant differences between the culture conditions. CD123 expression remained stable.The CML samples were cultured only with C4, C6, C3 conditions, without the terminal differentiation C7 condition. Expansion reached 33-260 fold; yielding up to 3.3×10^6 cells per well. C3 condition provided the highest yields (mean relative yields: C4 - 29%, C6 - 68%, C3 - 93%, and C-neg - 0%). All three tested conditions produced dominant fraction of more mature myeloid CD33+ cells (mean, 86-94%). Nevertheless, the C4 condition provided the highest proportion of CD34+ cells and produced the least mature CD14+ monocytes, compared to C6 and C3 (mean, CD34+ cell fraction of leukocytes: C4 - 31.7%, C6 - 6.8%, C3 - 4.5%; mean, CD14+ cell fraction of leukocytes: C4 - 6%, C6 - 21%, C3 - 9.6%).Conclusions:All tested culture conditions were capable of maintaining both primary AML and CML cells from all samples, during the 2-week culture. The highest in vitro expansion was achieved with conditions using the late-acting cytokines which however induced the highest cell differentiation as well. The C3 condition reported in previous studies also provided insufficient conservation of the original phenotypes. In this setup, the best preservation of original phenotypes and more primitive cells was achieved using the C4 “stem cell” condition containing early acting cytokines.Supported by Ministry of Health of the Czech Republic, grant nr. 17-30397A. All rights reserved. This report was written with the support of the Specific University Research (nr. MUNI/A/0968/2017) provided by MEYS. DisclosuresMayer:Affimed: Research Funding; Eisai: Research Funding; Johnson & Johnson: Research Funding; Roche: Research Funding; Novartis: Research Funding.

Gadd45a deficiency accelerates BCR-ABL driven chronic myelogenous leukemia.

The Gadd45a stress sensor gene is a member in the Gadd45 family of genes that includes Gadd45b & Gadd45g. To investigate the effect of GADD45A in the development of CML, syngeneic wild type lethally irradiated mice were reconstituted with either wild type or Gadd45a null myeloid progenitors transduced with a retroviral vector expressing the 210-kD BCR-ABL fusion oncoprotein. Loss of Gadd45a was observed to accelerate BCR-ABL driven CML resulting in the development of a more aggressive disease, a significantly shortened median mice survival time, and increased BCR-ABL expressing leukemic stem/progenitor cells (GFP+Lin- cKit+Sca+). GADD45A deficient progenitors expressing BCR-ABL exhibited increased proliferation and decreased apoptosis relative to WT counterparts, which was associated with enhanced PI3K-AKT-mTOR-4E-BP1 signaling, upregulation of p30C/EBPa expression, and hyper-activation of p38 and Stat5. Furthermore, Gadd45a expression in samples obtained from CML patients was upregulated in more indolent chronic phase CML samples and down regulated in aggressive accelerated phase CML and blast crisis CML. These results provide novel evidence that Gadd45a functions as a suppressor of BCR/ABL driven leukemia and may provide a unique prognostic marker of CML progression.

CML Patients with Primary Resistance or Suboptimal Response to TKI Therapy Have Variants in Genes Affecting Drug Absorption and Metabolism

BACKGROUNDChronic myeloid leukemia in chronic phase (CML CP) is successfully treated with tyrosine kinase inhibitors (TKIs) but a proportion of patients show primary or secondary resistance to TKI therapy. BCR-ABL1 mutations are the primary cause for secondary resistance to TKI therapy, but the causes for primary resistance are poorly known. Putative variants in genes affecting drug absorption, distribution, metabolism and excretion (ADME) have not been comprehensively analyzed. We set out to screen CML CP patients who either had primary resistance to TKI therapy or suboptimal response with large ADME gene panel to examine if these genes play a role in poor TKI responses.METHODSWe selected samples from 21 CML CP patients treated in our institute who either had primary resistance (N=6) or responded suboptimallyto TKI treatment (n=15) but did not have BCR-ABL1 mutations. DNA samples from the time of diagnosis were sequenced with massively parallel sequencing using a comprehensive custom ADME gene panel covering exons and introns of 382 genes. Over 200 healthy volunteers who had been sequenced with the same gene panel served as population controls. Loss-of-function and novel variants were validated using capillary sequencing.We tested the differences of variant allele frequencies between CML patients and healthy controls by performing the Cochran-Armitage trend test using additive coding (0,1,2) for genotypes homozygous for the major allele, heterozygous, and homozygous for the minor allele, respectively. CML patients with optimal response (n=24) were used as a control group.RESULTSSequencing of 21 poor responding CML CP patients revealed a total of 658 nonsynonymousgene variants. Majority of the variants (94%) were missense variants whose effects on gene function are uncertain. Eigthvariants were previously unreported. 18 variants were predicted to lead to a complete loss-of-function of the genes affected. Principal component analysis did not reveal clear global differences between the CML patients and healthy controls in the frequencies of ADME gene variants. However, the Cochran-Armitage trend test showed a number of variants whose frequencies in CML samples were significantly different from the healthy controls (table 1). Two of the loss-of-function variants were in the top 10 variants, whose frequencies differed between CML patients and healthy controls. ACAD11 rs41272317 variant was observed in 14.2% of patients whereas its frequency in healthy controls was 0.5% (p=0.003). Similarly DPYD rs3918290 was observed in 14.2% of patients and 3.3% of healthy controls (p=0.006). ACAD11 encodes an acyl-CoA dehydrogenase enzyme with a preference for carbon chain lengths between 20 and 26, and has been shown to be an important metabolic target for p53 pro-survival function. DPYD codesdihydropyrimidine dehydrogenase, which is involved in the metabolism ofpyrimidines and the anticancer agent 5-fluorouracil. Sanger sequencing confirmed both variants in patient samples. From the top10 missense variants, SLC15A1 rs144553892 variant was significantly more often observed in poor responding CML patients than in healthy controls (14.2 and 0.9%, respectively, p=0.003). SLC15A1 is a solute carrier family 15 member 1 which has a known function as a co-transporter foroligopeptides. Recently solute carriers have been identified to have significant impact on cancer therapy. Screening of additional CML patients is ongoing to confirm the frequency of these variants in optimally responding CML patients.CONCLUSIONSCML patients with primary resistance or suboptimal response to TKI therapy have mutations in genes affecting drug intake and metabolism, which can be causally associated with poor therapy responses. Validation in larger patient cohorts is warranted. [Display omitted] DisclosuresPorkka:Novartis: Honoraria, Research Funding; Bristol-Myers Squibb: Honoraria, Research Funding; Pfizer: Honoraria, Research Funding. Mustjoki:Bristol-Myers Squibb: Honoraria, Research Funding; Pfizer: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; Ariad: Research Funding.

Increasing the Sensitivity of BCR-ABL Monitoring By Digital PCR By Reducing the Background Noise

BackgroundDroplet digital PCR (dPCR) is a potentially appealing technology for quantitative detection of specific mutations with simultaneous measurement of the reference gene and without the need for standard curves. This makes dPCR particularly suitable for minimal residual disease (MRD) diagnostics in chronic myeloid leukaemia. However, a limitation of the dPCR assays compared to standard quantitative PCR (qPCR) is the background (termed lower limit of blank, LoB) of 1 or 2 positive droplets for BCR-ABL (Franke et al, ASH 2015, Cross et al, Leukemia 2016). The resulting false positive rate (FPR) limits the sensitivity and the ability of the test to detect deep molecular remissions.AimsThe aim was to establish BCR-ABL (b2/a2 and/or b3/a2 transcript) dPCR assays with a sensitivity at least equivalent to that of qPCR, in which <5% of negative controls generate a single positive drop (FPR<5%, LoB=0).MethodsOne assay (Assay 1) was developed in Leipzig and another (Assay 2) by Bio-Rad laboratories. Sample preparation was identical for both assays up to the stage of reverse transcription (RT). Assay 1 used routine local RT procedure followed by a duplex BCR-ABL / ABL dPCR reaction modified from the M-BCR-ABL PCR published by Jennings et al. 2014. We tested ABL primer combinations from exons 4, 8, 10, and 11 generating a range of product lengths and optimised quenchers and PCR conditions to maximise the separation between positive and negative droplets. Assay 2 consisted of a reverse transcriptase reaction followed by a duplex PCR specific for ABL and both the b2/a2 and b3/a2 transcripts of BCR-ABL. Digital droplet PCR was performed in both cases using the Bio-Rad QX200 system.Background noise and cross hybridisation were assessed in non-template controls (NTC), BCR-ABL negative cell lines and healthy wild-type donor samples. In addition, assay 2 was tested on 40 CML patient samples with MRD levels ranging from BCR-ABL negative to 1% BCR-ABL/ABL as defined by standard qPCR.ResultsAssay 1 yielded a FPR of 4% (4/94) in NTC with 1 positive droplet for BCR-ABL and a FPR of 3% for ABL (n = 3/94), resulting in a specificity of >95% and a LOB of 0. The BCR-ABL FPR using wild type target (HEK 293T cell line and healthy donors) was 5% (5/92 and 2/37, respectively).Assay2: The specificity was >95% for both BCR-ABL and ABL in NTC and wild type samples. Extensive NTC analysis yielded no false positives for BCR-ABL PCR (n = 0/176; LoB = 0) and 1% false positives in ABL PCR (n = 2/176; 1-2 positive droplets, LoB = 0). The BCR-ABL negative cell line was confirmed negative for BCR-ABL PCR (n = 44), while the BCR-ABL assays of healthy donors were positive in 2% (n = 5/234) with 1 positive droplet per positive sample. The BCR-ABL copy numbers of the 40 CML samples were lower by dPCR than by RT-PCR (median 3/6) with similar ABL transcripts (median 55500/54949). This resulted in lower ratios by dPCR (mean 0.0313 vs. 0.0461 by qPCR). However, after conversion of the qPCR results with our lab specific conversion factor (CF) <1, the dPCR ratios were higher (mean 0.0313 vs. 0.0134). The MR classes were concordant in 60% of the samples, but 30% had more MRD while 10% had less MRD by dPCR than by qPCR, confirming our previous results using the EAC protocol (Franke, ASH 2015). More samples were MRD positive by dPCR than by qPCR (58% vs 50%).ConclusionsAn assay with a FPR of <5% and a LoB = 0 for the detection of BCR-ABL was developed. The BIO-RAD QX 200-Dx BCR-ABL Kit is fully functional and has a high specificity for BCR-ABL and ABL with a LoB of 0. The high specificity and low FPR/LoB of both assays enables sensitive and accurate monitoring of deep molecular remissions in CML. DisclosuresFranke:Novartis: Honoraria, Research Funding. Tzonev:Bio-Rad: Employment, Equity Ownership. Shelton:Bio-Rad: Employment. Niederwieser:Amgen: Speakers Bureau; Novartis Oncology Europe: Research Funding, Speakers Bureau. Lange:Novartis: Research Funding.

Multiplex RT-PCR Assay for Detection of Common Fusion Transcripts in Acute Lymphoblastic Leukemia and Chronic Myeloid Leukemia Cases.

Acute lymphoblastic leukemia (ALL) is a heterogeneous disease which requires a risk-stratified approach for appropriate treatment. Specific chromosomal translocations within leukemic blasts are important prognostic factors that allow identification of relevant subgroups. In this study, we developed a multiplex RT-PCR assay for detection of the 4 most frequent translocations in ALL (BCR-ABL, TEL-AML1, MLL-AF4, and E2A- PBX1). A total of 214 diagnosed ALL samples from both adult and pediatric ALL and 14 cases of CML patients (154 bone marrow and 74 peripheral blood samples) were assessed for specific chromosomal translocations by cytogenetic and multiplex RT-PCR assays. The results showed that 46 cases of ALL and CML (20.2%) contained the fusion transcripts. Within the positive ALL patients, the most prevalent cryptic translocation observed was mBCR-ABL (p190) at 8.41%. In addition, other genetic rearrangements detected by the multiplex PCR were 4.21% TEL-AML1 and 2.34% E2A-PBX1, whereas MLL-AF4 exhibited negative results in all tested samples. Moreover, MBCR-ABL was detected in all 14 CML samples. In 16 samples of normal karyotype ALL (n=9), ALL with no cytogentic result (n=4) and CML with no Philadelphia chromosome (n=3), fusion transcripts were detected. Multiplex RT-PCR provides a rapid, simple and highly sensitive method to detect fusion transcripts for prognostic and risk stratification of ALL and CML patients.

A Patient-Derived EZH2 Mutant Induces MDS-like Diseases with Derepressed ABCG2 Expression in Mice

Abstract A histone H3 Lysine 27 (H3K27)-methyltransferase, enhancer of zeste homolog 2(EZH2) is known as a tumor-associated gene. Physiological role of EZH2 is an enzymatic component of polycomb repressive complex 2 (PRC2) to inhibit expression of target genes. While EZH2 plays oncogenic roles by repressing the expression of tumor suppressors in solid tumors and some lymphomas, it plays rather tumor-suppressive roles in myeloid malignancies. We have generated a short-form EZH2 that lacks the catalytic SET domain (EZH2-dSET). Using this EZH2 mutant we could produce serially transplantable MDS-like diseases. Microarray analysis using the MDS-like bone marrow cells enabled us to identify novel targets of EZH2 in MDS tumorigenesis, including ATP-binding cassette (ABC) transporters. Derepression of Abcg2 via decreased H3K27-trimethylation was confirmed. Retroviral transduction of EZH2-dSET to MDS-like cell lines increased surface ABCG2-high populations and those cells functioned to exclude anticancer drugs as expected. Intriguingly, with Abcg2 expression alone, primary bone marrow cells could produce an MDS-like cytopenic disease in our BMT model. In our clinical specimens, ABCG2 high expressions were observed in MDS samples but not in de novo AML and CML samples. In two MDS patients, ABCG2 expression decreased along with leukemic transformation. Interestingly, two out of 33 MDS patients with extremely high expression of ABCG2 harbored the same U2AF1 mutation (Q157P). In addition, somatic mutations of EZH2 and those of either U2AF1 or SRSF2 were mutually exclusive in all investigated cases. Interestingly, U2AF1 mutants (S34F and Q157P) reduced EZH2 expression, leading the derepression of ABCG2 via decreased H3K27-trimethylation. These results indicate a link between U2AF1 mutations and ABCG2 expression via disrupted EZH2. In conclusion, different mechanisms are supposed to converge at dysregulated EZH2 in MDS. And a short form of EZH2 upregulates ABCG2 expression resulting in MDS advancing to secondary leukemia. Thus, either mutations affecting the EZH2 function or mutations of EZH2 itself could play an important role in MDS, and one of the downstream targets of EZH2 suppression in MDS pathogenesis is aberrant expression of ABCG2. Disclosures No relevant conflicts of interest to declare.

Identification and Characterization of New Microrna Biomarkers and Target Genes in Drug-Insensitive CD34+ CML Stem/Progenitor Cells Using Global Comparative RNA-Seq Analyses

Therapeutic targeting of BCR-ABL with selective ABL tyrosine kinase inhibitors (TKIs) has led to a significant survival benefit for early phase CML. However, TKI monotherapies are rarely curative, with persistence of leukemic stem cells, emergence of resistance and relapses remaining as challenges. To identify differentially expressed and new miRNAs in CD34+ CML stem/progenitor cells that might serve as potential biomarkers and/or therapeutic targets, we have performed Illumina Deep Sequencing to obtain absolute miRNA expression profiles of highly purified CD34+ cells obtained at newly diagnosed stage from six CML patients. Three of the patients were classified retrospectively, after imatinib (IM) therapy, as IM-responders and three as IM-nonresponders. CD34+ cells isolated from five normal bone marrow (NBM) samples were similarly analyzed as controls. Bioconductor DESeq2 analysis revealed 63 differentially expressed miRNAs between CML and NBM samples (adjusted P<0.05). Most differentially expressed miRNAs identified were down-regulated in CML compared to NBM, while 17 were up-regulated. Interestingly, 12 miRNAs were found to be differentially expressed between the IM-responders and IM-nonresponders. In addition, 34 novel miRNAs were identified in the CD34+ CML stem/progenitor cells. We next validated the sequencing data in a larger cohort of samples. CD34+ cells from IM-responders (n=12), IM-nonresponders (n=10) and normal individuals (n=11) were analyzed using a high-throughput qPCR microfluidics device. These studies confirmed the differential expression in CD34+ CML cells of 32 of the 63 miRNAs (adjusted P<0.05), including an increased level of oncomirs miR-155 and miR-17-92, and a decreased level of tumor suppressors miR-145, miR-151, and miR-452. Importantly, significant changes in some of these miRNAs were detected in CD34+ cells from CML patients (n=60) after three months of nilotinib (NL) treatment compared to the same patient samples before the treatment: expression of 18 miRNAs were normalized after NL therapy, whereas 10 showed little change. To further identify potential miRNA target genes, RNA-seq analysis was performed on the same RNA samples to correlate miRNA profiles with corresponding mRNA expression changes. Bioconductor RmiR analysis was performed to match miRNA target genes whose expression was inversely correlated with the expression of deregulated miRNAs based on three of six prediction algorithms (mirBase, TargetScan, miRanda, tarBase, mirTarget2, and PicTar). We have identified 1,210 differentially expressed mRNAs that are predicted targets of the deregulated miRNAs in the comparison of CML and NBM data. Interestingly, only seven differentially expressed genes were predicted targets of the deregulated miRNAs identified in a comparison of IM-responders and IM-nonresponders. Most of the predicted target genes are involved in cell cycle regulation, MAPK signaling and TGF-beta signaling pathways according to DAVID Bioinformatics Resources analysis, which clusters predicted target genes to known KEGG pathways. To elucidate the biological significance of the differentially expressed miRNAs in TKI-insensitive CML stem/progenitor cells, a number of functional assays were performed. An initial screen of eight miRNAs, selected for their novelty and CML-related potential target genes, was performed by transiently transfecting CML cells with miRNA mimics or inhibitors, and chemically synthesized RNAs which mimic or inhibit mature endogenous miRNAs. Four of the eight miRNA mimics/inhibitors transfected cells displayed significant growth disadvantages and enhanced sensitivity to TKI treatments based on trypan-blue exclusion, thymidine incorporation, apoptosis, and colony-forming cell assays. Q-RT-PCR analysis further showed reduced expression of their predicted target genes in cells transfected with miRNA mimics. Taken together, we have identified aberrant, differentially expressed miRNAs and their target genes in TKI-insensitive CML stem/progenitor cells that may serve as useful biomarkers to predict clinical response of CML patients to TKI therapy and ultimately lead to identification of new therapeutic targets for improved treatment options in CML. DisclosuresNo relevant conflicts of interest to declare.

Rare and Common Germline Variants Contribute to Occurrence of Myelodysplastic Syndrome

Background: Majority of MDS cases appear to be sporadic in nature, but 10-15% have clear familial basis due to predisposing mutations in genes such as RUNX1, GATA2, CEBPA and DDX41. Contribution of germline variants in sporadic MDS is not studied. This study attempts to address the contribution of germline variants in MDS pathogenesis.Methods: We performed amplicon-based massively parallel sequencing (AmpliSeq custom panel adapted for Illumina HiSeq2500 sequencing) on all coding regions of 29 myeloid genes for 144 MDS samples. After identifying the variants in five genes (TET2, MET, GATA2, ASXL1, NOTCH1), we tested an additional 96 MDS samples including therapy-related myeloid neoplasm (T-MN) using a Sequenom assay. We also analyzed WES data for these variants in 178 AML samples and 758 normal controls and AmpliSeq data for ASXL1 and TET2 variants in 655 CML samples.Results: Collation of all coding variants in the 29 myeloid genes sequenced identified germline variants occurring in primary MDS at frequencies significantly higher than expected when compared to the normal population (ExAC and matched cohort were similar) (Table 1). These variants occurred in 5 genes (TET2, MET, GATA2, ASXL1 and NOTCH1) at increased frequencies of 1.5-16.6 fold. Numerous MDS samples had multiple variants (4 with 4 variants, 4 with 3 variants, 18 with 2 variants) while 70 had 1 variant.The 3 germline MET variants have been previously investigated in solid tumorigenesis and likely generate MET variant proteins that contribute to numerous cancer types including MDS. Interestingly, 7/17 (41%) MDS cases with germline MET variants also had other cancers including pancreatic, gastric and laryngeal cancers. Of the TET2 variants, Y867H and P1723S were concurrent in 5 MDS, 5 AML and 6 CML samples indicative of them being on the same allele (i.e. a haplotype). They were seen at higher than normal frequency in MDS and AML, but were not significantly enriched in CML. We are currently confirming their coexistence on the same allele and assaying for decreased TET2 activity to determine whether one or both variants contribute to the phenotype.Other variants identified in MDS include the rare GATA2 (P161A) variant which is present in 1% of the population and the nearby common GATA2 (A164T) allele (~20%). These were mutually exclusive in our cohort and were seen at 3.9 and 1.5-fold, respectively, above the expected population frequency. We generated the P161A variant using site-directed mutagenesis and assayed for GATA2 transactivation activity in HEK293 cells with a GATA2-responsive LYL1 promoter-Luciferase construct (Figure 1). We also included empty vector (EV), wildtype (WT) GATA2 and T354M which is the most common highly penetrant autosomal dominant mutation leading to familial MDS/AML. As expected, T354M displayed a marked decrease in transactivation ability when compared to WT. The P161A variant similarly displayed loss-of-function in this assay, but not to the same magnitude as T354M. This is consistent with the hypothesis that reduced GATA2 function predisposes to myeloid malignancy where decreasing GATA2 activity correlates with increasing risk of developing malignancy. In our study 10/36 (28%) cases harboring these variants were T-MN cases.Apart from MET (E168D) (11.4-fold), the 2 rare variants with highest frequency in MDS versus controls were ASXL1 (N986S) (16.6-fold) and NOTCH1 (R912W) (6.5-fold). ASXL1 is an epigenetic regulator often mutated in hematopoietic malignancy and aberrant NOTCH1 function has been associated with myeloid and lymphoid malignancies.Conclusions: We have identified common and rare germline variants in genes involved in myeloid malignancy that may contribute to MDS pathogenesis. It remains to be seen whether they contribute to initiation, maintenance and/or progression of MDS and other hematopoietic malignancies. This is the first study reporting higher frequency of germline variants in sporadic MDS cases. [Display omitted] [Display omitted] DisclosuresHiwase:Celgene Corporation: Research Funding.

High Peroxisome Proliferator-Activated Receptor-Gamma (PPARγ) Transcriptional Activity Reduces Active Influx of Imatinib and Kinase Inhibition in CML Cells

▪The human organic cation transporter-1 (hOCT-1) is the primary active influx protein for imatinib in BCR-ABL1+ cells. A low functional OCT-1 activity (OA) in peripheral blood mononuclear cells (MNCs) at diagnosis is associated with poorer subsequent molecular response and inferior outcomes in chronic phase chronic myeloid leukaemia (CP-CML) patients. We have previously demonstrated that diclofenac, an antagonist of peroxisome proliferator-activated receptor-γ (PPARγ), can significantly increase OA in BCR-ABL1+ cells. In the current study, we systematically assess the correlation between PPARγ and OA using leukemic cell lines and primary MNCs from untreated de novo CP-CML patients. Given the critical role of PPARγ in cell differentiation and the varying levels of PPARγ expression in different cell types, the present study also explored the relationship between the OA and myeloid-specific markers (CD14, CD15 and CD16) in CP-CML patient MNCs.Our results demonstrate that OA in BCR-ABL1 positive and negative leukemic cell lines (KU812, HL60 and HL60-BCRABL1) were significantly decreased with PPARγ agonists (GW1929, rosiglitazone) and increased with antagonists (GW9662, T0070907) (Table 1). Similarly, OA in PPARγ-transduced K562 cells (16.03 ng/200,000 cells) was significantly reduced when compared with empty vector control (22.73 ng/200,000 cells, p=0.028). In primary MNCs isolated from untreated CP-CML patients with high OA, a consistent inhibitory effect on OA was observed following the treatment with PPARγ agonists in all 5 cases. The average OA was significantly reduced by GW1929 (from 7.88 to 5.21 ng/200,000 cells, p=0.0075) or rosiglitazone (to 4.65 ng/200,000 cells, p<0.0001). In contrast, following treatment with PPARγ antagonists, OA was increased in all but one of the low OA patient samples (n=6). The average OA in these patients was increased from 2.71 to 5.07 ng per 200,000 cells by GW9662 (p=0.0129) and to 4.71 ng per 200,000 cells by T0070907 (p=0.0155). In addition, in combination with imatinib, these effects on OA resulted in corresponding changes in Bcr-Abl kinase inhibition and cell viability. While there was no correlation between OA and the expression of the PPARG gene or total PPARγ protein, there was a negative association between OA and PPARγ transcriptional activity in MNCs samples isolated from 84 untreated CP-CML patients (r=-0.5677, p<0.0001, Figure 1). Interestingly, in primary CML samples, the percentage of CD15+ CD14- CD16high MNC cells was significantly higher in patients with low OA (41.70%, n=10) than those with high OA (21.74%, n=11, p=0.0126), which may contribute to the higher PPARγ activity observed in these cases.In summary, the findings presented in this study highlight for the first time the association between active influx of imatinib and PPARγ. The consistent OA changes in both in BCR-ABL1 positive and negative leukemic cell lines indicate that treatment with PPARγ ligands significantly alter OA via a likely Bcr-Abl independent mechanism. In CP-CML patients at diagnosis, there is a strong negative correlation between OA and PPARγ activity. By up-regulating OA, PPARγ antagonists significantly increased intracellular imatinib and Bcr-Abl kinase inhibition, that subsequently resulted in increased imatinib induced apoptosis. Therefore, reagents repressing PPARγ activity may improve responses for de novo CP-CML patients with low OA. In addition, the CD15+ CD14- CD16high subset of MNCs is significantly enriched in low OA samples providing a potential readily translatable biomarker for a patientÕs molecular response to imatinib.Table 1OCT-1 activity changes in cell lines and MNC from CP-CML patients after treatment with PPARγ ligands (percentage of vehicle control)PPARγ agonistsPPARγγ antagonistGW1929RosiglitazoneGW9662T0070907KU81267%**49%**139%**151%**HL6075%**77%*123%*123%*HL60-BCRABL174%*79%*118%*136%***, p<0.05; **, p<0.01; compared with vehicle control. [Display omitted] DisclosuresHughes:ARIAD: Honoraria, Research Funding; Bristol-Myers Squibb: Honoraria, Research Funding; Novartis: Honoraria, Research Funding. White:Novartis: Honoraria, Research Funding; BMS: Honoraria, Research Funding.

Abstract 676: Axitinib targets gatekeeper-mutant BCR-ABL1(T315I)-driven leukemia in a distinct and selective fashion

Abstract The T315I gatekeeper mutation confers resistance to majority of approved ABL1 inhibitors, with only ponatinib demonstrating efficacy in BCR-ABL1(T315I)-driven disease. However, vascular adverse events and selection of resistant compound mutations limit its clinical utility. Hence, there is an unmet need for novel therapies for patients with gatekeeper-mutated Ph+ leukemia. In this study we integrated comprehensive drug sensitivity testing with structural analysis to characterize the tyrosine kinase inhibitor axitinib as a putative novel therapy for BCR-ABL1(T315I)-driven leukemias. To address this we profiled BCR-ABL1(T315I)-driven CML/Ph+ ALL patient samples against 300 anti-cancer compounds (approved and investigational drugs). Ex vivo drug sensitivity testing of primary cells derived from a Ph+ ALL patient revealed a marked and cancer-selective response to the VEGFR inhibitor axitinib. Strikingly, axitinib exhibited higher sensitivity in T315I positive Ph+ patient samples in comparison to T315I negative CML and ALL patient samples. In line with the ex vivo drug response data, axitinib inhibited the kinase activity of ABL1(T315I) with similar potency as its primary target VEGFR2, while the potency to non-mutated ABL1 was 30-fold lower. Analogously, in engineered Ba/F3 cells, axitinib showed a 10-fold higher inhibition of T315I than non-mutated ABL1-driven autophosphorylation and cell growth. To better understand the molecular mechanisms of the BCR-ABL1(T315I) selectivity, we solved the crystal structure of axitinib in complex with ABL1(T315). The structure revealed that axitinib bound to a mutation induced active conformation of ABL1(T315I), different than the binding mode in non-mutated ABL1, likely explaining the increased potency towards ABL1(T315I). Moreover, axitinib occupied a distinct binding space than all approved ABL1 inhibitors, signifying that axitinib will have a unique mutation vulnerability profile. Compassionate two week treatment of a CML patient harboring the T315I mutation with axitinib, resulted in a 5-fold reduction of T315I transcript levels in the bone marrow, further suggesting that axitinib can produce specific and effective responses in patients with BCR-ABL1(T315I)-driven leukemia. In conclusion, we demonstrate that axitinib potently inhibits BCR-ABL1(T315I) via a gatekeeper mutant-selective mechanism. Since axitinib is in clinical use for treatment of refractory renal cell carcinoma with a manageable safety profile, our data provide a sound basis for readily repurposing axitinib for BCR-ABL1(T315I)-driven leukemia. Finally, the distinct mechanism of inhibition by axitinib serves as an exemplar for development of even more effective gatekeeper-mutant selective inhibitors targeting ABL1 as well as other clinically important kinases, such as EGFR and KIT. Citation Format: Tea Pemovska, Eric Johnson, Mika Kontro, Gretchen A. Repasky, Jeffrey Chen, Peter Wells, Ciarán N. Cronin, Michele McTigue, Olli Kallioniemi, Kimmo Porkka, Brion W. Murray, Krister Wennerberg. Axitinib targets gatekeeper-mutant BCR-ABL1(T315I)-driven leukemia in a distinct and selective fashion. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 676. doi:10.1158/1538-7445.AM2015-676

Odk-1201, One-Step RT-qPCR Major BCR-ABL/ABL mRNA Kit for the International Scale, with High Sensitivity to Detect Deeper MR

Abstract Background: Molecular monitoring by the measurement of major BCR-ABL mRNA levels is important for the evaluation of the therapeutic efficacy of TKI in CML patients. However, there is no commercial kit easily available in each laboratory or hospital, which can estimate deeper responses below MR4.5that is 4.5-log reduction by the international scale (IS) 0.0032%. Methods: An ODK-1201 kit (Otsuka Pharmaceutical Co. Japan) is based on a HawkZ05 Fast One-Step RT-PCR Kit (Roche, Indianapolis, IN, USA). In this kit, reverse transcription and quantitative PCR (RT-qPCR) are performed in one tube, of which products are measured by ABI 7500 fast Dx (Life Technologies Japan, Japan). To isolate enough amount of RNA for the evaluation of molecular responses below MR4.5in CML patients, 7 ml of peripheral blood is required for this kit. To get the conversion factor (CF) for the IS, the panel of WHO International Standard was obtained from NIBSC, which comprises four ampoules each containing freeze-dried BCR-ABL-positive and -negative cells at various ratios from 0.01% to 10%. RNAs were isolated from each ampoule with a QIAamp RNA Blood Mini Kit (QIAGEN) and were subjected to the measurement of major BCR-ABL and ABL mRNAs with an ODK-1201 kit. Since %BCR-ABL/ABL in the WHO standard panel was already defined, CF was calculated by comparing the values of %BCR-ABL/ABL obtained by ODK-1201 with those of WHO standard panel. To validate the results obtained by ODK-1201, we collected 267 peripheral blood samples from CML patients as a multicenter study, and 120 samples in these were measured by ODK-1201 and in the international reference laboratory (Adelaide Lab), respectively. In addition, we conducted another multicenter study to compare ODK-1201 with an Ipsogen BCR-ABL1 Mbcr IS-MMR DX Kit (QIAGEN) and a One-Step qRT-PCR BCR-ABL Kit (Molecular MD), in which we measured the samples from 201 CML patients, 25 patients with non-CML hematologic malignancies and 25 healthy volunteers by these methods. All of the samples were obtained after the written informed consent was given. Results: The CF of ODK-1201 determined by the WHO standard panel was 1.12. After conversion to the IS by this CF, %BCR-ABL/ABLIS determined by ODK-1201 ranged from 0.0007% to 144.6867% in CML patients. In contrast, all of the values were below 0.0007% in the samples from patients with non-CML hematologic malignancies and healthy volunteers. The overall correlation between ODK-1201 and Adelaide Lab system was very good (94% within 3-fold bias) and the evaluation of MMR was concordant in 84% of CML samples. As for 46 CML samples with %BCR-ABL/ABL IS between 0.0032% and 0.1%, IS values by ODK-1201 were similar to the ones by Adelaide Lab system (with MR4.5; 0.0032%) with 89% within 3-fold and high correlation coefficient (r=0.89). Also, the correlation between ODK-1201 and Ipsogen was r = 0.97 (n = 224) and that between ODK-1201 and Molecular MD kit was r = 0.97 (n = 221), indicating that ODK-1201 was as accurate as Ipsogen and Molecular MD kits. Together, these results indicate that ODK-1201 was capable of measuring at least MR4.5 with the lowest value detected as 0.0007% (calculated sensitivity of less than MR5.0) by the IS. Conclusions: We developed a major BCR-ABLmRNA kit, ODK-1201 with CF for the IS and confirmed its high sensitivity (0.0007%) and accuracy. The procedure is very simple and takes only 2.5 h, and it needs a small amount of blood because RT-qPCR is performed in a single tube. It will enable us to evaluate deeper molecular responses in any laboratories. Conflict of interest :received research fundinand and honoraria from Otsuka I.M. received honoraria from Otsuka during the conduct of the study. H.N. received research funding from Otsuka during the conduct of the study and received research funding and honoraria from otsuka outside the submitted work. C.Y. received research funding from Otsuka during the conduct of the study and honoraria from Novartis and Bristol Myers Squibb. S.B. received research funding and honoraria from Novartis, Bristol Myers Squibb, Otsuka and Ariad. L.F. has no conflict of interest. K.D. and T.S. are employee of Otsuka. Y.K. received honoraria from Otsuka during the conduct of the study. T.N. received grants and personal fees from Otsuka during the conduct of the study, and grants and personal fees from Otsuka outside the submitted work. Disclosures Matsumura: Otsuka: Consultancy, Honoraria. Nakamae:Otsuka : Research Funding. Yoshida:Otsuka: Research Funding. Branford:Otsuka: Research Funding. Koga:Otsuka: Employment. Sogabe:Otsuka: Employment. Kanakura:Otsuka: Consultancy. Naoe:Otsuka: Consultancy.