Cm Of Soil Research Articles

Pennycress reduces potential for nutrient loss in Illinois.

Nutrient export of nitrogen and phosphorus from row crop agriculture in the Upper US Midwest is a threat to the structure and function of aquatic systems. To meet Environmental Protection Agency (EPA) nutrient reduction goals, the Upper US Midwest needs to implement strategies to reduce nutrient export from agriculture. Studies demonstrate the potential of cover crops to reduce the export of nitrate-nitrogen from the Upper US Midwest. We investigated the impact of the economically viable winter cash cover crop pennycress (Thlaspi arvense) on soil porewater nutrients and soil nutrients and characteristics. We used nine replicated 0.8ha plots (n=3 per treatment) at a production scale research farm over 4 years with pennycress and fertilized pennycress (56kg ha-1 of urea) treatments compared to a fallow reference. Over the study period, soil porewater nitrate-nitrogen was reduced by 53% in pennycress plots and 34% in fertilized pennycress plots relative to the fallow reference at a depth of 45cm. Early season establishment was crucial in providing nutrient reduction potential. In 2021, poor pennycress establishment resulted in porewater nitrate-nitrogen concentrations 141% higher than in 2022 with excellent pennycress establishment. Following pennycress termination, soil nitrate-nitrogen was reduced by 24% in pennycress and 26% in fertilized pennycress compared to the fallow reference in the top 30cm of soil. Following 4 years of pennycress planting, nitrate-nitrogen concentrations were significantly reduced with no broad effect on soil characteristics. We conclude that the novel pennycress crop has potential to reduce nutrient loss from row crop agriculture in the Upper US Midwest.

The Impact of Beneficial Microorganisms on Soil Vitality: A Review

The paper summarizes the literature on the critical impact of beneficial microorganisms on soil vitality. Common soil microorganisms, including bacteria, fungi, algae, protozoa, and viruses contribute significantly to enhancing soil fertility through processes such as nitrogen fixation, phosphorus solubilization and mobilization, sulfur cycle, composting, and heavy metal remediation. Their abundance and biomass vary significantly across taxa within the uppermost 15 cm of soil, with bacteria dominating numerically and fungi contributing substantially to biomass. These microorganisms mediate essential biogeochemical cycles in soil, including carbon, nitrogen, and phosphorus cycles, by facilitating the decomposition of organic matter and recycling soil nutrients. Nitrogen-fixing bacteria like Rhizobium are prevalent symbionts capable of biologically fixing nitrogen. Additionally, bacteria such as Micrococcus spp., Enterobacter aerogens, Pseudomonas capacia, fungi including Aspergillus niger, A. flavus, A. japonicas, Penicillum spp., and actinomycetes like Streptomyces play crucial roles in phosphorus solubilization, making phosphorus available for plant uptake. This synthesis underscores the critical role of beneficial microorganisms in maintaining soil vitality. These organisms interact with plants through beneficial relationships, influencing soil fertility dynamics by enhancing nutrient availability, promoting plant growth, and controlling pathogens. The use of biofertilizers has emerged as a sustainable strategy to improve crop yields and restore soil fertility, reducing environmental impacts linked to chemical fertilizers. Understanding the intricate dynamics of soil-beneficial microorganism and their interactions with Plants are pivotal for optimizing agricultural practices, ensuring long-term soil health, and enhancing productivity in sustainable farming systems.

The Distribution of Reniform Nematode (Rotylenchulus reniformis) in Cotton Fields in Central Queensland and Population Dynamics in Response to Cropping Regime.

Reniform nematode (Rotylenchulus reniformis) causes significant yield loss in cotton worldwide. In 2012, its detection in the Dawson-Callide region of Central Queensland prompted extensive surveys of cotton fields. The nematode was confirmed in 68% of sampled fields, with populations ranging from 2 to 3870 R. reniformis/200 mL of soil. Soil monitoring revealed increasing populations associated with consecutive cotton crops. However, when corn or sorghum replaced cotton, soil nematode populations significantly decreased. A two-year replicated field trial demonstrated that growing a non-host crop (such as biofumigant sorghum 'Fumig8tor', grain sorghum, or corn) significantly reduced nematode populations in the top 15 cm of soil compared to cotton. Unfortunately, when cotton was replanted the following season, nematode populations rebounded regardless of the previous crop. Only the 'Fumig8tor'-cotton rotation resulted in significantly lower nematode populations than continuous cotton. Vertical soil sampling showed that rotating with a non-host crop significantly reduced nematode densities to a depth of 100 cm compared to cotton. However, when the field was replanted with cotton, nematode populations recovered, unaffected by cropping or soil depth. This study emphasises the importance of monitoring reniform nematodes in cotton soils for early detection and defining distribution patterns within a field, which may improve the effectiveness of management practices. These results suggest that one rotation out of cotton is not sufficient, as populations return to high levels when cotton is grown again. Therefore, two or more rotations out of cotton should be considered to manage this nematode.

Survey of Heterodera glycines Population Abundance and Virulence Phenotypes During 2021 to 2022 in Heilongjiang Province.

Soybean cyst nematode (SCN), Heterodera glycines, poses a significant threat to global soybean production. Heilongjiang, the largest soybean-producing province in China, contributes more than 40% to the country's total yield. This province has much longer history of SCN infestation. To assess the current situation in Heilongjiang, we conducted a survey to determine the SCN population density and virulence phenotypes during 2021 to 2022 and compared the data with a previous study in 2015. A total of 377 soil samples from 48 counties representing 11 major soybean-planting regions were collected. The prevalence of SCN increased from 55.4% in 2015 to 59% in the current survey. The population densities ranged from 80 to 26,700 eggs and juveniles per 100 cm3 of soil. Virulence phenotypes were evaluated for 60 representative SCN populations using the H. glycines (HG) type test, revealing nine different HG types. The most common virulence phenotypes were HG types 7 and 0, accounting for 56.7 and 20% of all SCN populations, respectively. The prevalence of populations with a female index (FI) greater than 10% on PI 548316 increased from 64.5% in 2015 to 71.7%. However, the FI on the commonly used resistance sources PI 548402 (Peking) and PI 437654 remained low at 3.3%. These findings highlight the increasing prevalence and changing virulence phenotypes of SCN in Heilongjiang. They also emphasize the importance of rotating soybean varieties with different resistance sources and urgently identifying new sources of resistance to combat SCN.

Leveraging a decade of Landsat-8 spectral records for mapping blue carbon storage in tidal salt marshes

Tidal salt marsh ecosystems are known to accumulate and store large amounts of “blue” carbon, making them an important component of regional carbon cycle processes and a potential target for ecosystem-based carbon crediting efforts. However, blue carbon content in salt marshes can vary substantially at relatively small spatial scales. Understanding spatial variations of blue carbon storage at the landscape or local scale is important for developing carbon inventories, guiding ecological restorations, and informing habitat management strategies. We investigated the potential of spectral index records from the Landsat-8 Operational Land Imager spanning from 2014 to 2023 for mapping blue carbon storage in the soils of two tidal salt marsh systems in the Mid-Atlantic United States. The decadal mean of a non-photosynthetic vegetation index and standard deviations of a normalized difference vegetation index and a modified normalized difference water index were identified as predictors of blue carbon. These predictors were used to train a gradient boosted trees model for predicting soil organic matter content that achieved a testing set r-squared value of 0.67. We estimated that the two study marshes stored a combined 133-208 gigagrams of organic carbon in the top 30 cm of soil. We emphasize the need for better quantification of deep soil carbon in tidal salt marsh systems, which is likely quite high, and demonstrate the potential for satellite-based mapping of blue carbon within individual tidal wetland systems.

Resilience underground: Understanding earthworm biomass responses to land use changes in the tropics

Soil biodiversity, like terrestrial biodiversity, is currently under threat by changes in land use. Intensively managed farming activities with agrochemicals have degraded both soil biodiversity and health. However, little is known about how these changes in land use affect the distribution of earthworm biomass in Southeast Asia. We conducted earthworm sampling across multiple habitats, including lowland forests, exotic monoculture plantations (e.g., oil palm and rubber tree), and agroforestry orchards. To survey earthworm populations, we excavated the top 30 cm of soil at 18 sites encompassing 399 plots distributed across natural and human-modified ecosystems in Selangor and Negeri Sembilan, Peninsular Malaysia. We found that earthworm abundance was negatively related to increasing soil compaction, leaf litter weight, soil pH, and undergrowth height, whereas it was positively associated with increasing undergrowth and canopy cover. Our findings demonstrated that agroforestry orchards, rubber tree plantations, and mature oil palm plantations had higher earthworm abundance than those in logged lowland forests. Earthworm abundance in unlogged lowland forests and young oil palm plantations, on the other hand, was lower than in logged lowland forests. Overall earthworm weight was greater in rubber tree plantations, agroforestry orchards, mature oil palm plantations, and unlogged lowland forests than those in logged lowland forests, while young oil palm plantations exhibited lower earthworm weight than logged lowland forests. Our data indicate that increases in soil compaction and leaf litter weight were associated with decreased earthworm weight. These results demonstrate the importance of site-level habitat management for maintaining healthy earthworm populations and soil biodiversity.

Comparison of two gamma-ray datasets measured with different methods and assessment of their performance to predict soil properties

ABSTRACT Terrain mobility is directly dependent on soil properties, i.e. stoniness, soil particle size and peat depth. Gamma-ray spectrometry has been widely used in soil mapping as gamma-rays can penetrate up to 50 cm of soil. The method has proven to be effective in gathering information on various soil properties, such as clay and silt content, organic carbon content, soil pH, and soil stoniness. The intensity of gamma radiation decreases with increasing soil moisture content, which is important when assessing the load-bearing capacity of forest terrain, which affects the quality and planning of mechanized wood harvesting. In this study, we compared two gamma-ray datasets that were acquired from the same plots but measured with different methods: airborne gamma-ray spectrometry and a handheld gamma-ray spectrometer. Regression analyses were used to examine whether the gamma-ray datasets have significant similarities. Linear discriminant analysis was then used to study the performance of the two gamma-ray datasets when predicting different soil properties (stoniness index classes (SIC), soil depth, and peat depth). Our correlation analysis produced R2 values of 0.18–0.29 and root mean square error (RMSE%) values of 0.48–0.55. Prediction of SIC was 67.1% accurate with ground gamma and 45.9% accurate with air gamma. For soil depth predictions, the accuracies were 64.7–70.0% for ground gamma and 61.7–63.5% for air gamma. Our findings showed that ground gamma-ray spectrometry is better at predicting soil properties than air gamma-ray spectrometry.

Soil Formation on Loamy Deposits in Technogenic Landscapes of the Taiga Zone in the North-Eastern Part of European Russia

The paper highlights the influence of moisture on the soil formation process on loamy deposits during the primary vegetation succession. The study was carried out in the north-eastern part of European Russia (Komi Republic) in the middle taiga subzone. The authors analyzed young soils on the territory of a quarry for extraction of loamy grounds and background soils in the vicinity of it. Planting the Siberian spruce cultures on the territory of the quarry activated formation of the tree layer and thereby accelerated formation of the zonal type soils. The third succession decade in drained conditions saw formation of organic soil horizons (litters), a decrease in soil density in the upper profile part, a tendency to redistribute and differentiate the silty fraction by one-and-a-half oxides, indicating the beginning of selective podzolization. The rise in soil moisture content increased conservation of organic residues (peat formation) and made gley formation active. The quarry soils, like background soils, increased in acidity, carbon and nitrogen reserves along with the soil moisture content increase. In automorphic soil formation conditions, the rate of organic carbon accumulation in the upper 0–20-cm layer is 0.4 t· ha–1·year1; the excessive soil moisture content further increased it (1.0–1.2 t·ha–1·year1). The reserves of Corg in the upper 20-cm soil layer of young soils are by 2–4 times less than those in background soils.

An ensemble estimate of Australian soil organic carbon using machine learning and process-based modelling

Abstract. Spatially explicit prediction of soil organic carbon (SOC) serves as a crucial foundation for effective land management strategies aimed at mitigating soil degradation and assessing carbon sequestration potential. Here, using more than 1000 in situ observations, we trained two machine learning models (a random forest model and a k-means coupled with multiple linear regression model) and one process-based model (the vertically resolved MIcrobial-MIneral Carbon Stabilization, MIMICS, model) to predict the SOC stocks of the top 30 cm of soil in Australia. Parameters of MIMICS were optimised for different site groupings using two distinct approaches: plant functional types (MIMICS-PFT) and the most influential environmental factors (MIMICS-ENV). All models showed good performance with respect to SOC predictions, with an R2 value greater than 0.8 during out-of-sample validation, with random forest being the most accurate; moreover, it was found that SOC in forests is more predictable than that in non-forest soils excluding croplands. The performance of continental-scale SOC predictions by MIMICS-ENV is better than that by MIMICS-PFT especially in non-forest soils. Digital maps of terrestrial SOC stocks generated using all of the models showed a similar spatial distribution, with higher values in south-eastern and south-western Australia, but the magnitude of the estimated SOC stocks varied. The mean ensemble estimate of SOC stocks was 30.3 t ha−1, with k-means coupled with multiple linear regression generating the highest estimate (mean SOC stocks of 38.15 t ha−1) and MIMICS-PFT generating the lowest estimate (mean SOC stocks of 24.29 t ha−1). We suggest that enhancing process-based models to incorporate newly identified drivers that significantly influence SOC variation in different environments could be the key to reducing the discrepancies in these estimates. Our findings underscore the considerable uncertainty in SOC estimates derived from different modelling approaches and emphasise the importance of rigorous out-of-sample validation before applying any one approach in Australia.

Influence of herbaceous litter thickness on bacterial community structure and physicochemical properties of aeolian sand.

The change and mechanism of soil and soil bacterial diversity during the change of herbaceous litter thickness in desert areas is crucial to understand. In the study, the dominant herbaceous litter mixture in Baijitan National Nature Reserve was selected as the research material, and an experiment was established by adjusting the litter depth. The results showed that the measured values of soil physicochemical factors (total nitrogen, total protein, total potassium, available phosphorus, available potassium, pH, and soil water content) increased with the increase of herbaceous litter mixture thickness in 0-5cm soil layer. Actinobacteria, Proteobacteria, Acidobacteria, Chloroflexi, and Gemmatimonadetes were the dominant bacterial phyla under different thicknesses of herbaceous litter in 0-5 and 5-10cm soil layers. Balneimonas, Rubrobacter, and Geodermatophilus were the dominant bacterial genera under different thicknesses of herbaceous litter in 0-5 and 5-10cm soil layers. There was no obvious change in the α-diversity index of bacterial community the same soil layer, but the α-diversity index in the 0-5cm soil layer was lower compared to the 5-10cm soil layer. The results of this study revealed that the change of herbaceous litter thickness had no significant effect on soil bacterial community structure in desert areas.

Initial soil moisture and soil texture control the impact of storm surges in coastal forests

Flooding and salinization triggered by storm surges threaten the survival of coastal forests. The forest root zone (top 40 cm of soil) is the most affected by surge flooding. Determining the effect of a storm surge on edaphic conditions is essential to estimate vegetation response. Pre-storm soil hydrology could mitigate or enhance the salinization effect, ultimately determining the resilience of the forest. Here we assess the influence of pre-storm soil water content and salinity on storm surge effects in coastal vegetated areas. A 1D model (HYDRUS-1D) is used to simulate saltwater infiltration from above through the unsaturated zone. Different water content and concentration scenarios, along with scenarios with variable storm surge salt concentration, storm surge height and storm surge flooding duration are considered. In soils characterized by silt and clay, the maximum salinized soil depth increases as water content increases, affecting the top 40 cm of soil, except for clay loam soil, for which only the top 20 cm are salinized. In sandy soils, the salinization process involves the entire soil column. The contribution of water content to salinization varies from 12 % to 30 % along the top 40 cm in fine soils. In fine soils, the storm-surge height also becomes relevant. A study case is presented to support the numerical results. Field data confirm that soil water content controls the salinization of the root zone in clay and silt soils. Overall, we conclude that the root zones of coastal forests with clay and silt soils and low water content are the most at risk during storm surges. These events have the potential to radically change edaphic conditions and affect ecosystems.

Montane evergreen forest deforestation for banana plantations decreased soil organic carbon and total nitrogen stores to alarming levels

Forest conversion to agricultural land has been shown to deplete soil organic carbon (SOC) and soil total nitrogen (STN) stocks. However, research on how soil properties respond to forest conversion to shifting cultivation has produced conflicting results. The conflicting findings suggest that the agricultural system may influence the response of SOC and STN to forest conversion to agriculture, depending on the presence of vegetative cover throughout the year. Due to the unique characteristics of montane evergreen forests (MEF) and banana plantations (BP), SOC and STN response to MEF conversion to BP may differ from existing models. Nevertheless, research on how soil properties are affected by MEF conversion to BP is scarce globally. In order to fill this research gap, the goal of this study was to evaluate how much deforestation for BP affects SOC, STN, and soil quality by analysing these soil parameters in MEF and BP fields down to 1-m depth, using standard profile-based procedures. Contrary to the specified hypothesis that SOC and STN losses would be restricted to the upper 20-cm soil layer, SOC losses were extended to the 40-cm depth layer and STN losses to the 60-cm depth layer. The soils lost 18.56 Mg ha – 1 (37%) of SOC from the upper 20 cm and 33.15 Mg ha – 1 (37%) from the upper 40 cm, following MEF conversion to BP. In terms of STN, the upper 20, 40, and 60 cm lost 2.98 (43%), 6.62 (47%), and 8.30 Mg ha – 1 (44%), respectively. Following MEF conversion to BP, the SOC stratification ratio decreased by 49%, implying a decline in soil quality. Massive exportation of nutrients, reduced C inputs due to complete removal of the arboreal component and crop residues, the erodibility of the soils on the study area’s steep hillslopes, and the potential for banana plantations to increase throughfall kinetic energy, and splash erosion through canopy dripping are thought to be the leading causes of SOC and STN losses. More research is needed to identify the extent to which each cause influences SOC and STN losses.

Achieving SOC Conservation without Land-Use Changes between Agriculture and Forests

Global land-use changes impact soil’s ability to perform essential functions. This study investigates whether soil organic carbon (SOC) can be conserved without altering land use in traditional farming systems and degraded natural forests, focusing on ‘disturbed’ agricultural soils and ‘undisturbed’ forest soils. We also examine the influence of dominant crops on SOC within the top 30 cm of soil in data-deficient regions of Nepal. Using a multi-stage cluster sampling design, we tested 12 regression models to identify the best relationships among variables such as SOC, soil bulk density (BD), pH, dominant crops, climate, topography, and management practices. Our analysis revealed similar SOC levels in both disturbed and undisturbed soils, indicating significant degradation in forested areas, whereas traditional farming systems could support SOC and preserve farm-based indigenous knowledge alongside food security. Further, SOC stocks varied significantly (p < 0.05) across different cropping systems, suggesting that managing dominant crops could be a strategy to optimize SOC, with these crops serving as indicators. Additionally, our results show that the weak linear correlation between SOC and BD in regularly disturbed soils, such as farmlands, where anthropogenic activities frequently alter soil bulk density, may be misleading when estimating bulk density-dependent SOC. This finding suggests the need for further research into varying degrees of anthropogenic disturbance in soil to confirm these results. While the site-specific nature of the findings warrants caution with respect to generalization, they provide valuable insights for carbon monitoring, climate actions, ecosystem health, and land-use management in similar traditional farming systems and degraded forests, particularly in data-poor regions.

Effect of sideral binary mixtures with sunflower on the quality and fertility of typical chernozems

In the field experiment, the effect of binary sideral mixtures with sunflower on the content of humus, mobile phosphorus and exchangeable potassium in arable and sub-arable horizons of typical heavy loamy chernozem was studied.It is shown that the use of mixed agricultural communities for sideration can be one of the sources of reproduction of potential and effective fertility of chernozems in theCentralСhernozemDistrict.It was found that the influence of the agrocenotic effect in binary mixtures of sunflower with soy, payza, buckwheat of theKrylataya variety and buckwheat of theDemeter variety led to a significant increase in the content of humus, mobile phosphorus and exchangeable potassium in the arable and sub-arable horizons of chernozems under these agricultural communities.It was shown that the effect of the agrocenotic effect on the increase in humus content was equivalent to the introduction of litter manure into the arable horizon of 15.4–25.3 t/ha, in the sub–arable–13.6–23.0 t/ha.This led to a significant improvement in the quality of the studied soils.An increase in the content of mobile phosphorus under the influence of the mixing factor could be achieved by introducing 88–200 and 88– 138 kg ofP2O5/ha into the layers of 0–25 and 25–40 cm of soil, respectively.An increase in the content of exchangeable potassium under sideral mixtures in a layer of 0–25 cm of soil by 1.0–2.4 and in a layer of 40–50 cm by 1.7–2.0 mg/100 g of soil would correspond to doses of 300–720 and 510–600 kgK2O/ha.

Assessing and Quantifying the Carbon, Nitrogen, and Enzyme Dynamics Effects of Inter-row Cover Cropping on Soils and Apple Tree Development in Orchards

Cover crops between rows in orchards can improve the development of soil resources and increase agricultural productivity. However, there have been few reports of cover crops that can act as a “green manure” in apple orchards across arid and semiarid zones. This study investigated the effects of planting interrow vegetation on soil properties and apple tree performance during a 32-month experiment. There were six treatments: clean cultivation as a control; natural grass planting; planting with ryegrass; planting with alfalfa; planting with tall fescue; and planting with villous wild pea cover crops. The treatments primarily affected the 0- to 20-cm surface soil layer. Soil carbon, nitrogen, and enzyme levels initially decreased (during the first 12–24 months); then, they increased (24–32 months). The cover crops significantly increased nutrient contents (soluble organic carbon, microbial carbon and nitrogen, alkaline dissolved nitrogen, nitrate nitrogen, and ammonium nitrogen) in the 0- to 20-cm soil layer by more than 19.6% and increased the related enzyme activities by more than 25.2%. The alfalfa and wild pea alleys had a stronger effect on the soil environment than the control, natural grass, ryegrass, and tall fescue alley treatments; however, after 32 months, the alfalfa treatment inhibited fruit tree growth and development. This was unexpected because alfalfa seemed to have a positive effect on soil fertility characteristics. Under local ecological conditions, villous wild pea had the greatest effect on apple orchard productivity and significantly increased short branching by 15.9%, fruit weight per fruit by 12.6%, yield per plant by 8.6%, and soluble sugar content by 10.5% compared with clean cultivation. The correlation analysis showed that there were significant or highly significant positive correlations between fruit tree performance and soil carbon, nitrogen, and enzyme activity levels as the soil layer depth increased. Therefore, under local ecological conditions, cover crops have a greater effect on orchard surface soil fertility than on deeper soils, and intercropping with villous wild pea potentially produces the greatest improvement in apple orchard productivity.

Impact of the Plant Growth-promoting Rhizobacterium Streptomyces saraceticus Strain 31 on Berry Quality of ‘Benifuji’ Grape: Improvements through the Reconfiguration of Fine Root Morphology and Vessel Anatomy

In an effort to mitigate the environmental impact of chemical fertilizers, plant growth-promoting rhizobacteria (PGPR) have emerged as a more sustainable alternative. Streptomyces saraceticus 31 (‘SS31’), a new strain of biocontrol bacteria, was inoculated into rhizosphere soils of ‘Benifuji’ grape to evaluate its impact on grape roots and berries. The results indicated significant improvements in soil fertility, with higher levels of organic matter, phosphorus, potassium, and nitrate nitrogen compared with those of the controls. Moreover, ‘SS31’ application elicited a notable reduction in soil pH levels, along with a substantial augmentation in the enzymatic activities of both phosphatase and invertase. The grapes treated with ‘SS31’ exhibited a notable increase in the number, length, surface area, and volume of fine roots in both 0- to 10-cm and 10- to 20-cm soil profiles. The application of ‘SS31’ resulted in the observation of greater diameter, lower density, and larger lumen area, along with increased specific hydraulic conductivity in the vessels of roots with 1- to 2-mm diameters. Despite a slight reduction in berry weight compared with that of the controls, ‘Benifuji’ grape berries displayed higher total soluble solids and lower total titratable acidity after ‘SS31’ application. Furthermore, ‘SS31’ treatment elevated the levels of volatile compounds in berries, especially fatty acid-derived compounds. A network analysis revealed a robust positive correlation between the observed improvements in grape berry quality and the morphology as well as the hydraulic conductivity of the grape fine roots. In conclusion, these findings suggest that ‘SS31’ has the potential to enhance grape root function by expanding the root absorption area and facilitating water transportation. This, in turn, may improve the flavor and aroma of ‘Benifuji’ grape berries.

A comparative analysis of soil organic carbon stock and soil aggregation in two crop sequences in the Rolling Pampa (Argentina)

Understanding how farming practices affect soil organic carbon (SOC) accumulation is essential for sustainable agriculture. Agronomic decisions, such as crop sequence, significantly influence various soil properties. However, the overall benefits of crop rotation on soil structure and SOC storage remain uncertain. We compared the effects of soybean (Glycine max L.) monocropping with a three-year crop rotation comprising wheat (Triticum aestivum L.)/soybean double crop, maize (Zea mays L.), and soybean on the vertical distribution of SOC up to one metre depth. Additionally, we examined carbon accumulation as particulate organic matter-carbon (POM-C), soil aggregation, and structural stability in the topsoil. Compared to monocropping, crop rotation increased SOC concentrations (19 vs. 16 gC kg soil⁻¹), stock (12 vs. 10.7 MgC ha⁻¹), and POM-C content (6 vs. 3.2 gC kg soil⁻¹) in the first 5 cm of soil. At 20–65 cm depth, rotation showed a marginal increment of SOC stock with respect to soybean monocropping. The increased surface SOC content in the rotation positively affected the POM-C content and macro-aggregation. However, soil structural stability showed a tendency to be higher in the monocropping, especially at a depth of 5–20 cm. Overall, crop rotation demonstrated potential for enhanced carbon sequestration in temperate agroecosystems within three years, despite not significantly improving soil structural stability.

Effect of Lime Source, Fineness and Granulation on Soil Permeation with Contrasting Textures under Simulated Mediterranean Climate Rainfall Conditions

ABSTRACT Granulated micro-fine limes have recently been introduced as liming materials which are purportedly more effective than conventional agricultural limes in terms of rapidly correcting subsoil acidity in no-tillage systems. Hydrated limes are known to react more quickly in soils than calcitic limes, yet their soil permeability has not been evaluated under Mediterranean climate growing conditions. Therefore, the aim of this controlled study was to compare soil permeation and pH neutralization of different liming materials (hydrated lime, calcitic agricultural lime, micro-fine lime and molasses-granulated micro-fine lime) in two contrasting (sand and sandy loam) acid (pHKCl < 4.1) topsoils under simulated Mediterranean climate conditions. Limes were surface applied to 40 cm soil columns and then rainfall (350 mm) was simulated. Subsequently, soil chemical properties (pH, exchangeable cations, available P) were measured in 5 cm increments. Application of all liming materials increased soil pH 1–2 pH units above target pHKCl of 5.5 in the top 5 cm of both soils. Only hydrated lime was able to increase soil pHKCl (5.7–6.8) below 5 cm up to a depth of 15 cm on the sand soil. Hydrated lime, however, resulted in substantial over-liming (pHKCl 7.3–8.7) of the top 5 cm of soil compared to the other materials. Granulated micro-fine lime reacted more slowly than the agricultural limes and is therefore not a suitable quick-fix for subsoil acidity in rain-fed no-till systems under Mediterranean climate rainfall conditions. Whereas hydrated lime showed potential in ameliorating subsoil acidity in the sand soil within one season of rainfall.

First report of Helicotylenchus dihystera parasitizing Lady Tankerville orchids (Phaius tankervilleae) in Vietnam.

Lady Tankerville, a rare orchid species (Phaius tankervilleae (Banks ex L'Hér.) Blume) in Vietnam, not only enhances the aesthetic value of the surroundings with its enchanting blooms but also holds high economic value (Aver'janov & Averyanova, 2003). Investigating the necrosis symptom on the root system and declined Lady Tankerville in the market in Hai Duong province in Vietnam from 11/2020 to 12/2021, we discovered a substantial infestation (24/24 plants were infected) of a spiral nematode, Helicotylenchus sp. The nematode population was extracted from the rhizosphere soil, roots, and stems of a single orchid using the modified Baermann tray technique (Whitehead & Hemming, 1965), for thorough characterization. The average nematode density was measured at 525±85 (350-670) nematodes/250 cm3 of soil, 202±56 (198-264) nematodes/15 g of roots, and 80±15 (72-95) nematodes/15 g of stem. Two hundred nematodes from the same population were inoculated into another healthy orchid for preservation and further infection tests. This species was morphologically identified as Helicotylenchus dihystera according to the key of Fotedar and Kaul (1985) and the description of Sher (1966). Morphometric measurements of the females (n = 12) are as follows: body length = 632-725 (681 ± 32) µm; a = 24-34 (28 ± 3); b = 5.1-7.2 (6.0 ± 0.6); b' = 4.3-6.4 (5.3 ± 0.6); c = 33-46 (39 ± 5); c' = 1.1-1.4 (1.2 ± 0.1); V = 62-78 (65 ± 4)%; O = 30 -49 (39 ± 6); stylet length = 21-26 (24 ± 2) µm; DGO = 9.2-12.4 (10.8 ± 1.1) µm. To validate morphological observations, molecular analyses of the ITS (Vrain et al., 1992) and the D2-D3 of 28S rRNA (Subbotin et al., 2006) were conducted. The ITS and D2-D3 sequences from this study (accession number: PP060444 and PP033748) exhibited the highest similarity of 99.8% and 100% to the sequence of H. dihystera in GenBank (KM506885 and MW023215), respectively. The infection test took place in a greenhouse at 28 ± 2℃. Three-month-old Phaius tankervilleae (n=8) were individually grown in 15 x 15 cm deep pots filled with sterilized sand and inoculated with 500 gravid females of H. dihystera (Rashid & Azad, 2013). Two noninoculated plants served as controls. After 60 days of inoculation, symptoms such as sunspots and root necrosis, observed in the market, appeared in the tested plants (Fig. S1). The presence and diagnosis of H. dihystera infestation in soil, roots, and stems across growth stages of orchids indicates the nematode to be an obligate parasite. The nematodes penetrate the roots, causing characteristic necrotic lesions initially yellow, then turn reddish-brown to black, along with brown root flecks in discolored tissues. Heavy infestations post-flowering led to extensive necrosis, distortion, and decay of the roots. The average reproduction factor (final population/initial population) of H. dihystera in this study was 22.2. Control plants remained symptom-free. Notably, 100% of tested plants were infected, highlighting the severe impact of H. dihystera. The nematodes were successfully reisolated and identified as H. dihystera through molecular analyses (accession number: PP060615 (ITS) and PP033748 (D2-D3)), reaffirming its identity. In addition to 32 host plants in Vietnam (Nguyen et al., 2023), our study reveals a strain of H. dihystera parasitizing Lady Tankerville orchids with a relatively high reproduction factor and infection rate. This marks the first reported instance of H. dihystera parasitizing Lady Tankerville orchids in Vietnam, emphasizing the need for proactive measures to protect this plant.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.