cDNA Library Research Articles

A Virulence Factor from Sclerotinia sclerotiorum Targets the Host Chloroplast Proteins to Promote Infection

Chloroplasts are not only places for photosynthesis, but also participate in plant immunity and are important targets of pathogens. Pathogens secrete chloroplast-targeted proteins (CTPs) that disrupt host immunity and promote infection. Sclerotinia sclerotiorum (Lib.) de Bary is a phytopathogenic fungus with a broad host range. However, little is known about the pathogenic mechanisms underlying this wide host range. In this study, we investigated the role of Chloroplast-Targeted Protein 1 (SsCTP1) secreted by S. sclerotiorum in pathogenesis, which inhibits plant immunity and promotes pathogen infections. SsCTP1 was highly up-regulated during the early stages of S. sclerotiorum infection in various hosts, and its transient expression in Nicotiana benthamiana revealed that it was predominantly localized within chloroplasts. Mutants with SsCTP1 deletion exhibited a similar growth rate and colony morphology to the wild type, but significantly reduced pathogenicity in various hosts. Moreover, SsCTP1 inhibited chitin-induced callose deposition and defense gene expression, and enhanced sensitivity to S. sclerotiorum in N. benthamiana. Similarly, transgenic Arabidopsis thaliana overexpressing SsCTP1 displayed an increased susceptibility to S. sclerotiorum. Furthermore, two host proteins that interact with SsCTP1, Coproporphyrinogen-III oxidase (GmCPX), and shikimate kinase 2 (GmSKL2) were identified by screening the soybean cDNA library, and these interactions were confirmed in vivo. Importantly, the silencing of NbCPX by virus-induced gene silencing enhanced N. benthamiana resistance to S. sclerotiorum. Our results indicate that SsCTP1 is an important pathogenic factor that contributes to the wide host range of S. sclerotiorum and may inhibit plant immunity by targeting the chloroplast proteins GmCPX and GmSKL2, which are ubiquitous in host plants.

Identification and characterization of tissue-specific genes in response to handling stress in topmouth culter (Culter alburnus) kidney, liver and muscle tissues

Topmouth culter (Culter alburnus) is an important freshwater economic fish in China. However, external stress often triggers strong reactions, resulting in low survival rates and reduced productivity. The absence of stress-related genes has significantly limited our understanding of stress response in this fish. Therefore, 85,846,206 high-quality reads were acquired from kidney, liver and muscle cDNA libraries of topmouth culter using illumina sequencing technology in this study. Comparative analysis revealed that 3,158; 409 and 1,952 unigenes were specifically expressed in the kidney, liver and muscle transcriptome, respectively. Additionally, 83 crucial tissue-specific genes were identified within three stress-related GO terms: response to stimulus (GO:0050896), response to stress (GO:0006950) and response to hypoxia (GO:0001666). From these, 18 tissue-specific genes were further isolated. During the short-term stress experiment (two repeated handling stress, including chasing 2 min and netting out of water for 30s), significant changes were observed in the cortisol levels of both the treatment and recovery groups. Furthermore, notable changes were noted in the expression of LCP2, PTK2b and P-selectin genes in the kidney; FABP1, IGFBP1 and CYP4V2 genes in the liver; and MYH10, Myogenin 2 and Toponin C genes in the muscle of topmouth culter in the treatment and recovery groups (P < 0.05). The tissue-specific transcriptome profiles generated in this study offer valuable insights into the molecular and functional mechanisms associated with stress response in topmouth culter. We characterizated genes related to stress response in tissues such as the kidney, liver and muscle, these findings offer novel insights into stress research in fish. We can further explore the breeding of strains with enhanced stress resistance and promote the healthy development of topmouth culter industry.

Construction and Characterization of a Full-Length Infectious cDNA Clone of a Strain of Watermelon Mosaic Virus Isolated from Melon.

Watermelon mosaic virus (WMV), a member of the genus Potyvirus, causes serious economic losses in cucurbit crops. For molecular biological studies of viruses, it is necessary to construct an infectious clone that can facilitate gene functional analysis. In this study, we constructed an infectious cDNA clone of WMV genomic RNA by Gibson assembly and evaluated its virulence and symptoms on a variety of host plants. A WMV isolate (WMV-IS-me2) collected from melon in Iksan, Jeonbuk Province, Korea in 2015 caused mosaic symptoms on leaves. Four overlapping PCR fragments of the full-length genome of this isolate and the pJL89 binary vector with overhanging ends of 40 bp were amplified by reverse transcription PCR and joined in a single isothermal reaction. The complete nucleotide sequence of the infectious cDNA clone of WMV was determined and the recombinant vector was transformed into Agrobacterium tumefaciens GV3101. Following agro-infiltration, an infectious clone (pWMV-M, KACC95145P) systemically induced mosaic symptoms on watermelon (Citrullus lanatus), zucchini (Cucurbita pepo), melon (Cucumis melo), and Nicotiana benthamiana plants. This infectious clone may be useful for screening cucurbit varieties resistant to WMV, as well as for studying viral gene function.

Extracellular vesicles, RNA sequencing, and bioinformatic analyses: Challenges, solutions, and recommendations.

Extracellular vesicles (EVs) are heterogeneous entities secreted by cells into their microenvironment and systemic circulation. Circulating EVs carry functional small RNAs and other molecular footprints from their cell of origin, and thus have evident applications in liquid biopsy, therapeutics, and intercellular communication. Yet, the complete transcriptomic landscape of EVs is poorly characterized due to critical limitations including variable protocols used for EV-RNA extraction, quality control, cDNA library preparation, sequencing technologies, and bioinformatic analyses. Consequently, there is a gap in knowledge and the need for a standardized approach in delineating EV-RNAs. Here, we address these gaps by describing the following points by (1) focusing on the large canopy of the EVs and particles (EVPs), which includes, but not limited to - exosomes and other large and small EVs, lipoproteins, exomeres/supermeres, mitochondrial-derived vesicles, RNA binding proteins, and cell-free DNA/RNA/proteins; (2) examining the potential functional roles and biogenesis of EVPs; (3) discussing various transcriptomic methods and technologies used in uncovering the cargoes of EVPs; (4) presenting a comprehensive list of RNA subtypes reported in EVPs; (5) describing different EV-RNA databases and resources specific to EV-RNA species; (6) reviewing established bioinformatics pipelines and novel strategies for reproducible EV transcriptomics analyses; (7) emphasizing the significant need for a gold standard approach in identifying EV-RNAs across studies; (8) and finally, we highlight current challenges, discuss possible solutions, and present recommendations for robust and reproducible analyses of EVP-associated small RNAs. Overall, we seek to provide clarity on the transcriptomics landscape, sequencing technologies, and bioinformatic analyses of EVP-RNAs. Detailed portrayal of the current state of EVP transcriptomics will lead to a better understanding of how the RNA cargo of EVPs can be used in modern and targeted diagnostics and therapeutics. For the inclusion of different particles discussed in this article, we use the terms large/small EVs, non-vesicular extracellular particles (NVEPs), EPs and EVPs as defined in MISEV guidelines by the International Society of Extracellular Vesicles (ISEV).

Characterization of Orexin Gene in Tilapia (Oreochromis niloticus):Regulator Feeding Appetite, and Correlation with Reproductive Factors

The mechanism of energy allocation related to increased appetite and feed intake in fish involves several neuropeptides encoded by specific genes. Orexin (OX) is a peptide secreted in the pars tuberalis of the hypophysis that acts as a stimulator in appetite increase (orexigenic factor). However, the expression of different orexigenic factors varies among vertebrate species, reflecting their unique types and lineages. Therefore, this study aimed to identify genes encoding appetite in Tilapia. RNA isolation, complementary Deoxyribose Nucleic Acid (cDNA) cloning, and DNA amplification were performed from brain samples of gonadally mature Tilapia. The PCR products were subsequently sent to Macrogen.Inc for sequencing. The amplification results of Orexin with β-Actin (positive control) observed using agarose gel electrophoresis showed that the size of the nucleotide base product of each gene was 196 bp and 197 bp. Confirmation of sequencing results carried out using the Basic Local Alignment Search Tool (BLAST) method - National Center for Biotechnology Information (NCBI) for Orexin and β-Actin were 97% and 100%. Based on these results, it can be concluded that each target gene isolated from the tilapia brain showed homology/similarity with the sequence available in the NCBI database

Preparation of Phage Display cDNA Libraries for Identifying Immunogenic Tumor Antigens: Challenges in Functional cDNA Presentation and Approaches to Overcoming Them

Preparation of Phage Display cDNA Libraries for Identifying Immunogenic Tumor Antigens: Challenges in Functional cDNA Presentation and Approaches to Overcoming Them

Identification of Antisense RNA NRAS-AS and Its Preliminary Exploration of the Anticancer Regulatory Mechanism

Objective: To explore the influence of NRAS-AS on the proliferation, apoptosis, cell cycle, migration, and invasion ability of HCC cells, as well as its underlying mechanisms. Methods: A double-stranded cDNA library for liver cancer cells was constructed, and identified NRAS-AS through High-throughput sequencing, bioinformatics, chain-specific fluorescent quantitative PCR, and RACE. NRAS-AS′s effects on HepG2 and SMMC-7721 cells and gene expression were evaluated. Additionally, the study analyzed the influence of NRAS-AS overexpression on tumor formation in nude mice. Immunohistochemistry and Western blotting were used to detect NRAS protein levels in clinical samples. RT-qPCR examined NRAS-AS and NRAS gene expression in HCC and adjacent tissues. Results: NRAS-AS overexpression suppresses HCC cell proliferation and invasion, induces cell cycle alterations in HepG2 and SMMC-7721 cells, and enhances apoptosis. NRAS-AS interference promoted liver cancer invasion, inhibited apoptosis, and influences the cell cycle. Nude mice overexpressing NRAS-AS showed smaller tumors. NRAS-AS expression in liver cancer patients correlated with clinical factors. RT-qPCR revealed an inverse correlation between NRAS-AS and NRAS gene expression in liver cancer and adjacent tissues. IHC analysis revealed reduced NRAS protein expression in HepG2 and SMMC-7721 cells following NRAS-AS overexpression. The impact of AZA treatment on antisense NRAS-AS and sense NRAS gene expression in liver cancer cells was observed, and antisense. Conclusion: Reduced NRAS-AS expression is frequently observed in HCC and is inversely related to NRAS gene expression, suggesting a role in HCC pathogenesis through NRAS regulation. Targeting antisense RNA NRAS-AS could hold promise as a therapeutic target and diagnostic biomarker for HCC.

An Engineered Citrus Tristeza Virus (T36CA)-Based Vector Induces Gene-Specific RNA Silencing and Is Graft Transmissible to Commercial Citrus Varieties.

A protein-expressing citrus tristeza virus-based vector construct, pT36CA-V1.3, obtained from a California isolate of the T36 strain (T36CA), was retooled into a virus-induced gene silencing system intended for use with studies of California citrus. Virus-induced gene silencing constructs engineered with a truncated Citrus macrophylla PHYTOENE DESATURASE (CmPDS) gene sequence in the sense or antisense orientation worked equally well to silence the endogenous CmPDS gene. In a parallel effort to optimize vector performance, two nonsynonymous nucleotides in open reading frame 1a of pT36CA-V1.3 were replaced with those conserved in the reference sequences from the T36CA cDNA library. The resulting viruses, T36CA-V1.4 (with one amino acid modification: D760N) and T36CA-V1.5 (with two amino acid modifications: D760N and P1174L), along with T36CA-V1.3, were individually propagated in Nicotiana benthamiana and C. macrophylla plants. Enzyme-linked immunosorbent assay (ELISA) measurements of extracts of the newly emerged leaves suggested that all three viruses accumulated to similar levels in N. benthamiana plants at 5 weeks postinoculation. ELISA values of T36CA-V1.4- and -V1.5-infected C. macrophylla samples were significantly higher than that of T36CA-V1.3-infected samples within an 8- to 12-month postinoculation window, suggesting a higher accumulation of T36CA-V1.4 and -V1.5 than T36CA-V1.3. However, at 36 months postinoculation, the ELISA values suggested that all three viruses accumulated to similar levels. When C. macrophylla plants infected with each of the three viruses were grafted to commercial citrus varieties, a limited number of receptor plants became infected, demonstrating a weak but nonetheless (the first) successful delivery of T36CA to California-grown commercial citrus.

First report of natural infection by cowpea mild mottle virus on Sesbania cannabina and Physalis angulata in China.

Vigna unguiculata (L.) Walp. (cowpea) is an important economic vegetable in Sanya, Hainan Province, China. But it is easily infected by various viral diseases, especially cowpea mild mottle virus (CPMMV), bean common mosaic virus (BCMV) and cowpea polevirus 2 (CPPV2), causing symptoms such as yellowing, dwarfism and mosaic of leaves, affecting photosynthesis of cowpea. Weeds are perfect intermediate hosts for crop viruses. In the cowpea fields of Sanya, there are a large number of weeds growing nearby, including Sesbania cannabina (Retz.) Poir. and Physalis angulata (L.). S. cannabina, a species of legume, has high nutritional value as the one of the most admired green-manuring plants widely used in crop field for gaining yield and decreasing the quantity of chemical fertilizer (Tiwari et al. 2004). P. angulata, commonly known as husk tomato, is an annual Solanaceaea vegetable crop grown for its fruits (Ramakrishna Pillai et al. 2022). In July 2022, S. cannabina and P. angulata surrounding one hectare of cowpea fields of Sanya with chlorotic and asymptomatic (Figure S1) were collected, and then their total RNAs were individually extracted by the TRIzol Reagent (Life, USA), and two cDNA libraries (one including the RNA samples of S. cannabina, another including the RNA sample of P. angulata) were subsequently constructed using VAHTS Universal V8 RNA-seq Library Prep Kit (Vazyme, China). High-throughput sequencing was performed on a DNBSEQ-T7 platform (BGI, China) with the 150 bp paired-end method. A total of 40,134,299 and 149,473,308 clean reads were de novo assembled by SPAdes 3.15.5 to generate contigs, followed by BLAST-x/n search in viral genomes in GenBank. From the RNA-seq library of S. cannabina, we identified one contig (6255 nt) that exhibited 96.45% nucleotide identity to the CPMMV isolate CPMMV-JS (MT366555), covering 6033 bp out of 6255 bp (6033/6255) of the contig. Additionally, we found seven contigs (ranging in length from 1870 nt to 8336 nt) in the RNA-seq library of P. angulata that showed 78.92% to 84.15% nucleotide identity to the CPMMV isolate Brunt (OK558693), with specific alignment lengths varying from 669/795 to 4244/5337. CPMMV was verified by reverse transcription - polymerase chain reaction (RT-PCR) detection using specific primer (F: 5'-CTGGCCAAGTGGTTTGTTTT-3', R: 5'- AACCGGGTTTACAATCCACA -3') (Wei et al. 2020). PCR products were extracted from an agarose gel, cloned into the pMD19-T Vector (Takara, China), and transformed into Escherichia coli DH5α cells (Sangon Biotech, Shanghai). Two clones for each PCR product were sequenced by Sanger sequencing. The amplified 1865 bp fragments of S. cannabina (PP790744) and P. angulata (PP790743) had 98.07% identity (1727 bp out to 1761 bp) and 97.92% sequence identity (1739 bp out to 1776 bp) to CPMMV-JS (MT366555). Afterwards, we collected S. cannabina and P. angulata with similar symptoms around two cowpea fields (each field covers an area of about one hectare) in three districts of Sanya, namely Yazhou, Tianya, and Haitang, and conducted CPMMV detection. We found that CPMMV was detected in all six samples. CPMMV, including genus Carlavirus and family Betaflexiviridae, was first identified on cowpea in Ghana in the 1970s. Since then, it has been shown to have a very extensive geographical distribution and a wide natural host range. CPMMV principally infects Fabaceae, it is also able to infect hosts from Solanaceaea, Nyctaginaceae, Cleomaceae, Asteraceae and Lamiaceae (Celli et al. 2016; Lamas et al. 2017; Zanardo and Carvalho 2017). To our knowledge, this is the first report of natural infection of the S. cannabina and P. angulata by CPMMV, which may represent additional reservoirs of this virus in the region. Meanwhile, investigating CPMMV in S. cannabina and P. angulata is crucial for developing integrated strategies to prevent its transmission to economically important plants such as cowpea.

Abscisic acid enhances SmAPK1-mediated phosphorylation ofSmbZIP4 to positively regulate tanshinone biosynthesis in Salvia miltiorrhiza.

Tanshinones, isolated from Salvia miltiorrhiza, is efficient to treat cardiovascular and cerebrovascular diseases. Abscisic acid (ABA) treatment is found to promote tanshinone biosynthesis; however, the underlying mechanism has not been fully elucidated. A protein kinase namely SmAPK1 was identified as an important positive regulator of ABA-induced tanshinone accumulation in S. miltiorrhiza. Using SmAPK1 as bait, a basic region leucine zipper (bZIP) family transcription factor SmbZIP4 was screened from the cDNA library. Functional identification reveals that SmbZIP4 negatively regulates tanshinone biosynthesis in hairy roots and transgenic plants through directly targeting SmGGPPS and SmCYP76AK1. SmAPK1 phosphorylates the Ser97 and Thr99 site of SmbZIP4, leading to its degradation via the 26S proteasome pathway, which is promoted by ABA-induced enhancement of SmAPK1 kinase activity. Degradation of SmbZIP4 upregulates the expression levels of SmGGPPS and SmCYP76AK1, resulting in increased tanshinone content. Taken together, our results reveal new molecular mechanism by which SmAPK1-SmbZIP4 module plays a crucial role in ABA-induced tanshinone accumulation. This study sheds new insights in the biosynthesis of bioactive compounds in medicinal plants.

Comparative and Spatial Transcriptome Analysis of Rhododendron decorum Franch. During the Flowering Period and Revelation of the Plant Defense Mechanism.

Rhododendron is a globally distributed and extensive genus, comprising over 1000 species. In the southwestern mountains of China, there exists a remarkable diversity of Rhododendron, with Yunnan Province alone harboring more than 600 species. R. decorum Franch. has long been utilized by local communities for its medicinal and edible properties. However, the transcriptional regulation function, medicinal properties, and edibility characteristics of R. decorum Franch. currently lack a solid theoretical basis. Total RNA was extracted from leaves, corollas and androecium/gynoecium of R. decorum Franch. in Heqing county, followed by the construction of cDNA libraries and the de novo assembly of transcriptomes. A total of 63,050 unigenes were extracted from the flowers and leaf organs of R. decorum Franch. Among these unigenes, 43,517 were predicted to be coding sequences, with 32,690 being effectively annotated. Differential gene expression enrichment was observed among different organs within their respective transcriptomes; notably floral organs exhibited significant defense against plant diseases along with signal transduction functions. Furthermore, during the flower harvesting period, all floral organs exhibited gene enrichment pathways associated with carbohydrate metabolism. Additionally, the stamen and pistil displayed flavonoid metabolism pathways, suggesting their potential applications as functional food or medicine. Our results shed light on plant-pathogen defense mechanisms and the molecular bias of flavonoids biosynthesis on flower organs during the flowering period, which might help to understand the consumption of R. decorum Franch. corollas by the Bai nationality of Heqing county.

First Report of Pepper Chlorosis-Associated Virus in Burdock (Arctium lappa) in Korea.

Burdock (Arctium lappa) is a fiber-rich root vegetable widely used in Asian cuisine with many health benefits. In July 2023, two burdock leaf samples showing viral symptoms, such as yellowing and interveinal chlorosis, were collected from a field in Daegu, South Korea, with an incidence rate of about 10%. The samples were pooled, ground with liquid nitrogen, and total RNA was extracted using a Maxwell® 16 LEV Plant RNA Kit (Promega, Madison, USA). A cDNA library was constructed using TruSeq Standard Total RNA with Ribo-Zero (Illumina, San Diego, USA) and sequenced on an Illumina NovaSeq 6000 (BIOTO, Daejeon, Korea) with 100 bp paired-end reads. Of the approximately 84 million reads generated, about 61 million clean reads were identified using Trimmomatic 0.39 with default parameters. Subsequently, Trinity 2.13.0 was used for de novo assembly, resulting in 179,910 contigs, which, when annotated as previously described (Bak et al., 2024), revealed the presence of tomato spotted wilt virus (TSWV) and pepper chlorosis-associated virus (PepCaV). Three PepCaV-related contigs, representing a near-complete genome, were submitted to NCBI GenBank (PP502423-PP502425). BLASTn analysis showed 95.21% (7275/7641 bp), 95.89% (1680/1752 bp), and 96.18% (1461/1519 bp) identities with the L, M, and S segments of the PepCaV isolate Higashitsuno_2021 (LC719619-LC719621), respectively. RT-PCR was performed to confirm the presence of viruses using specific primers for PepCaV (5'-CACCTTGATTATAGACATGACAG/GTTCTCAAATCTTCCCAATCG-3') targeting the coat protein region, and TSWV (5'-GCAACAACTTGCAAGAAGATG/CATGACCTTCAGAAGGCTTG-3'; Kim et al., 2021). Initial results showed both samples were positive for TSWV, and one was positive for PepCaV. Additionally, 26 symptomatic and 8 asymptomatic samples were collected from the same field. PepCaV was positive in 3 samples, TSWV in 12, and TSWV+PepCaV in 11 by RT-PCR. All asymptomatic samples were negative. Leaves infected with PepCaV, whether solely or co-infected with TSWV, initially exhibited interveinal chlorosis and vein contraction on one side of the main vein (Fig. S1). In plants infected with PepCaV alone, these symptoms were mild or less noticeable in the initial phases. The majority of PepCaV-infected samples were co-infected with TSWV, during which symptoms appeared more severe. Following this, an amplicon, derived from the sample that initially tested positive for PepCaV in the first RT-PCR was cloned using the All in OneTM Cloning Kit (BioFact, Daejeon, Korea) and sequenced by Bionner (Daejeon, Korea). The resulting sequence, submitted to NCBI GenBank (PP928956), demonstrated 96.87% (805/831 bp) identity with the PepCaV isolate Higashitsuno_2021 (LC719600). Moreover, sap inoculation was performed on A. lappa, Nicotiana benthamiana, N. clevelandii, N. debneyi, N. rustica, N. tabacum, Chenopodium amaranticolor, and C. quinoa, but no transmission was identified in any case. PepCaV, recently identified and likely belonging to the genus Ophiovirus within the family Ophioviridae, is known to infect pepper and tobacco (Shimomoto et al., 2023; Wang et al., 2024). This is the first report of PepCaV in Korea and the first identification of burdock as a natural host. Although studies on its vectors and pathogenicity are lacking, PepCaV's presence suggests potential risks. Given the widespread cultivation of burdock in Korea, PepCaV could significantly impact local agriculture by affecting crop yield and health.

Molecular cloning of PRD-like homeobox genes expressed in bovine oocytes and early IVF embryos.

Embryonic genome activation (EGA) is a critical step in early embryonic development, as it marks the transition from relying on maternal factors to the initiation of transcription from embryo's own genome. The factors associated with EGA are not well understood and need further investigation. PRD-like (PRDL) homeodomain transcription factors (TFs) are considered to play crucial roles in this early event during development but these TFs have evolved differently, even within mammalian lineages. Different numbers of PRDL TFs have been predicted in bovine (Bos taurus); however, their divergent evolution requires species-specific confirmation and functional investigations. In this study, we conducted molecular cloning of mRNAs for the PRDL TFs ARGFX, DUXA, LEUTX, NOBOX, TPRX1, TPRX2, and TPRX3 in bovine oocytes or in vitro fertilized (IVF) preimplantation embryos. Our results confirmed the expression of PRDL TF genes in early bovine development at the cDNA level and uncovered their structures. For each investigated PRDL TF gene, we isolated at least one homeodomain-encoding cDNA fragment, indicative of DNA binding and thus potential role in transcriptional regulation in developing bovine embryos. Additionally, our cDNA cloning approach allowed us to reveal breed-related differences in bovine, as evidenced by the identification of a high number of single nucleotide variants (SNVs) across the PRDL class homeobox genes. Subsequently, we observed the prediction of the 9aa transactivation domain (9aaTAD) motif in the putative protein sequence of TPRX3 leading us to conduct functional analysis of this gene. We demonstrated that the TPRX3 overexpression in bovine fibroblast induces not only protein-coding genes but also short noncoding RNAs involved in splicing and RNA editing. We supported this finding by identifying a shared set of genes between our and published bovine early embryo development datasets. Providing full-length cDNA evidence for previously predicted homeobox genes that belong to PRDL class improves the annotation of the bovine genome. Updating the annotation with seven developmentally-important genes will enhance the accuracy of RNAseq analysis with datasets derived from bovine preimplantation embryos. In addition, the absence of TPRX3 in humans highlights the species-specific and TF-specific regulation of biological processes during early embryo development.

Analysis of Differential microRNA Expression in the Hippocampus of Scopolamine-Induced Amnesic Mouse Model.

Amnesia is characterized by memory deficits linked to various neurodegenerative pathologies and can be induced by the administration of scopolamine, a cholinergic antagonist. Scopolamine-induced amnesia is a well-studied pharmacological animal model that simulates memory impairment caused by aging, brain illnesses, neuropathologies, and trauma. However, the molecular mechanism of amnesia, more importantly in terms of microRNA (miRNA) regulation, is not well understood. Therefore, this study aimed to analyze miRNA profiles in the hippocampus of both control mice and those treated with scopolamine (amnesic mice). Initially, a short cDNA library was prepared for each sample and then sequenced on the Illumina platform. Among the total differentially expressed miRNAs, 113 were significantly upregulated and 96 were downregulated in the scopolamine group in comparison to the control group. Ten upregulated and ten downregulated miRNAs were validated to confirm the reliability of the sequencing results using qRT-PCR (quantitative real-time PCR). Furthermore, we performed a target prediction analysis intersecting the results from TargetScan, miRDB (miRNA database), and Miranda to analyze the targets of the dysregulated miRNAs. We also conducted a pathway analysis to investigate the molecular, cellular, and biological functions of these targets. miRNA‒target interactions were found to play roles in various signaling pathways during amnesia. These results provide an initial insight for the contribution of miRNAs to scopolamine-induced amnesia, as well as their possible application as markers of disease pathology.

The Inhibitory Effect and Mechanism of the Histidine-Rich Peptide rAj-HRP from Apostichopus japonicus on Human Colon Cancer HCT116 Cells.

Colon cancer is a common and lethal malignancy, ranking second in global cancer-related mortality, highlighting the urgent need for novel targeted therapies. The sea cucumber (Apostichopus japonicus) is a marine organism known for its medicinal properties. After conducting a bioinformatics analysis of the cDNA library of Apostichopus japonicus, we found and cloned a cDNA sequence encoding histidine-rich peptides, and the recombinant peptide was named rAj-HRP. Human histidine-rich peptides are known for their anti-cancer properties, raising questions as to whether rAj-HRP might exhibit similar effects. To investigate whether rAj-HRP can inhibit colon cancer, we used human colon cancer HCT116 cells as a model and studied the tumor suppressive activity in vitro and in vivo. The results showed that rAj-HRP inhibited HCT116 cell proliferation, migration, and adhesion to extracellular matrix (ECM) proteins in vitro. It also disrupted the cytoskeleton and induced apoptosis in these cells. In vivo, rAj-HRP significantly inhibited the growth of HCT116 tumors in BALB/c mice, reducing tumor volume and weight without affecting the body weight of the tumor-bearing mice. Western blot analysis showed that rAj-HRP inhibited HCT116 cell proliferation and induced apoptosis by upregulating BAX and promoting PARP zymogen degradation. Additionally, rAj-HRP inhibited HCT116 cell adhesion and migration by reducing MMP2 levels. Further research showed that rAj-HRP downregulated EGFR expression in HCT116 cells and inhibited key downstream molecules, including AKT, P-AKT, PLCγ, P38 MAPK, and c-Jun. In conclusion, rAj-HRP exhibits significant inhibitory effects on HCT116 cells in both in vitro and in vivo, primarily through the EGFR and apoptosis pathways. These findings suggest that rAj-HRP has the potential as a novel targeted therapy for colon cancer.

Discovery and characterization of a novel carlavirus in Ligularia jaluensis plants

Ligularia jaluensis is an important medicinal and ornamental plant in China. However, the viruses capable of infecting Ligularia jaluensis remains unknown. Here, we identified a novel carlavirus, tentatively named ligularia jaluensis carlavirus (LJCV), as well as a known iris severe mosaic virus (ISMV), in L. jaluensis plants displaying chlorosis and yellow ring spot symptoms, using RNA-seq analysis. The LJCV genome consists of an 8497 nt positive-sense, single-stranded RNA [excluding the poly(A) tail], and contains six open reading frames (ORFs). Phylogenetic analyses based on the full-length genome and RNA-dependent RNA polymerase (RdRp) amino acid (aa) sequences revealed that LJCV clusters within an evolutionary branch alongside known viruses in the Carlavirus genus. The RdRp protein encoded by ORF1 of LJCV shared 45.38%–67.41% identity with the corresponding proteins of eight closely related carlaviruses. ORFs 2–4 constitute the triple gene block (TGB), with TGBp1 and TGBp3 localized in the endoplasmic reticulum (ER), while TGBp2 is localized at plasmodesmata (PD) and facilitates viral intercellular movement, as demonstrated by its ability to complement the potato virus X with movement-deficient mutant (PVX-Δp25-GFP). Additionally, ORF6 encodes a cysteine-rich protein (CRP) that is localized in the chloroplast and functions as a viral pathogenicity factor, inducing severe viral symptoms in the heterologous PVX expression system. Furthermore, we successfully constructed an infectious cDNA clone of LJCV, and found that it can infect Nicotiana benthamiana plants through mechanical inoculation or agrobacterium-mediated infiltration of the LJCV infectious clone. These findings enhance our understanding of the characteristics and host range of carlaviruses, as well as the viruses capable of infecting L. jaluensis.

Understanding the pathogenicity of Naegleria fowleri in association with N. fowleri antigen-1 (Nfa1).

Naegleria fowleri, a brain-eating amoeba, thrives in lakes and rivers with aquatic vegetation and causes primary amoebic meningoencephalitis (PAM) in humans. Most recently, it has become such a serious problem that N. fowleri was detected in tap water in Houston, USA. Several pathogenic factors are considered very important to destroy target cells in the brain. In particular, the food-cup where N. fowleri antigen-1 (Nfa1) is located, is strongly expressed in pseudopodia involved in the movement of N. fowleri, and is involved in phagocytosis by attaching to target cells. In this article, we reviewed the role of the Nfa1 protein and its associated pathogenicity. The nfa1 gene was cloned by cDNA library immunoscreening using infection serum and immune serum. Nfa1 protein is mainly distributed in pseudopodia important to movement and vacuoles. Moreover, heat shock protein 70, cathepsin-like proteare and Nf-actin are also associated with pseudopodia in which Nfa1 is localized. Interestingly, the amount of the nfa1 gene changed as N. fowleri trophozoites transformed into cysts. Polyclonal antiserum against Nfa1 showed a protective effect against cytotoxicity of approximately 19.7%. Nfa1-specific IgA antibodies prevent N. fowleri trophozoites from adhering to the nasal mucosa, delaying invasion. The nfa1-vaccinated mice showed significantly higher levels of Nfa1-specific antibody. The duration of anti-Nfa1 IgG in the vaccinated mice lasted 12 weeks, strongly suggesting that nfa1 is a significant pathogenic gene and that Nfa1 is a pathogenic protein. Several factors related to pseudopodia and locomotion have been linked to Nfa1. A clearer function of N. fowleri targeting nfa1 with other genes might enable target-based inhibition of N. fowleri pathogenicity.

Unraveling the interaction between a glycolytic regulator protein EhPpdk and an anaphase promoting complex protein EhApc10: yeast two hybrid screening, in vitro binding assays and molecular simulation study.

The anaphase promoting complex (APC or cyclosome) is a major ubiquitin ligase that coordinates mitotic and G1 progression, acting as a major regulator of chromosome segregation. While the human APC contains fourteen subunits, it is yet to be explored in the pathogen Entamoeba histolytica. Our study reveals the existence of a single functional Apc10 homolog in E. histolytica, which acts as a processivity factor of ubiquitin ligase activity in human. A cDNA library generated from HM1:IMSS strain of E. histolytica was screened for interaction partners of EhApc10 in yeast two hybrid study. The novel interactor, a glycolytic enzyme, pyruvate phosphate dikinase (Ppdk) was found to interact with EhApc10 and further validated by in vitro assay. A comprehensive in silico study has emphasized the structural and functional aspects, encompassing physicochemical traits, predictive 3D structure modelling, validation of EhApc10-EhPpdk interaction through molecular docking and simulation. The interplay between a cell cycle protein and a glycolytic enzyme highlights the connection between cellular metabolism and the cell cycle regulatory mechanism. The study serves as the groundwork for future research on the non-mitotic role of APC beyond cell cycle.

Zinc metalloprotease FgM35, which targets the wheat zinc-binding protein TaZnBP, contributes to the virulence of Fusarium graminearum

Metalloproteinases are ubiquitous in organisms. Most metalloproteinases secreted by pathogenic microorganisms are also called virulence factors, because they degrade proteins in the external tissues of the host, thereby reducing the host’s immunity and increasing its susceptibility to disease. Zinc metalloproteinase is one of the most common metalloproteinases. In our report, we studied the biological function of zinc metalloprotease FgM35 in Fusarium graminearum and the pathogen–host interaction during infection. We found that the asexual and sexual reproduction of the deletion mutant ΔFgM35 were affected, as well as the tolerance of F. graminearum to metal stress. In addition, deletion of FgM35 reduced the virulence of F. graminearum. The wheat target TaZnBP was screened using a wheat yeast cDNA library, and the interaction between FgM35 and TaZnBP was verified by HADDOCK molecular docking, yeast two-hybrid, Bi-FC, Luc, and Co-IP assays. The contribution of TaZnBP to plant immunity was also demonstrated. In summary, our work revealed the indispensable role of FgM35 in the reproductive process and the pathogenicity of F. graminearum, and it identified the interaction between FgM35 and TaZnBP as well as the function of TaZnBP. This provides a theoretical basis for further study of the function of metalloproteinases in pathogen–host interactions.

Transcriptomic analysis reveals differentially expressed genes associated with meat quality in Chinese Dagu chicken and AA+ broiler roosters

BackgroundWith the improvement of living standards, the quality of chicken has become a significant concern. Chinese Dagu Chicken (dual-purpose type) and Arbor Acres plus broiler (AA+ broiler) (meat-type) were selected as the research subjects in this study, the meat quality of the breast and leg muscles were measured. However, the molecular mechanism(s) underlying regulation of muscle development are not yet fully elucidated. Therefore, finding molecular markers or major genes that regulate muscle quality has become a crucial breakthrough in chicken breeding. Unraveling the molecular mechanism behind meat traits in chicken and other domestic fowl is facilitated by identifying the key genes associated with these developmental events. Here, a comparative transcriptomic analysis of chicken meat was conducted on breast muscles (BM) and leg muscles (LM) in AA+ broilers (AA) and Dagu chicken (DG) to explore the differences in their meat traits employing RNA-seq.ResultsTwelve cDNA libraries of BM and LM from AA and DG were constructed from four experimental groups, yielding 14,464 genes. Among them, Dagu chicken breast muscles (DGB) vs AA+ broilers breast muscles (AAB) showed 415 upregulated genes and 449 downregulated genes, Dagu chicken leg muscles (DGL) vs AA+ broilers leg muscles (AAL) exhibited 237 upregulated genes and 278 downregulated genes, DGL vs DGB demonstrated 391 upregulated genes and 594 downregulated genes, and AAL vs AAB displayed 122 upregulated genes and 154 downregulated genes. 13 genes, including nine upregulated genes (COX5A, COX7C, NDUFV1, UQCRFS1, UQCR11, BRT-1, FGF14, TMOD1, MYOZ2) and four downregulated genes (MYBPC3, MYO7B, MTMR7, and TNNC1), were found to be associated with the oxidative phosphorylation signaling pathway. Further analysis revealed that the differentially expressed genes (DEGs) from muscle were enriched in various pathways, such as metabolic pathways, oxidative phosphorylation, carbon metabolism, glycolysis, extracellular matrix-receptor interaction, biosynthesis of amino acids, focal adhesion, vascular smooth muscle contraction, and cardiac muscle contraction, all of which are involved in muscle development and metabolism. This study also measured the meat quality of the breast and leg muscles from the two breeds, which demonstrated superior overall meat quality in Chinese Dagu Chicken compared to the AA+ broiler.ConclusionsOur findings show that the meat quality of dual-purpose breeds (Chinese Dagu chicken) is higher than meat-type (AA+ broiler), which may be related to the DEGs regulating muscle development and metabolism. Our findings also provide transcriptomic insights for a comparative analysis of molecular mechanisms underlying muscle development between the two breeds, and have practical implications for the improvement of chicken breeding practices.