Citrus Psyllid Research Articles

Recent progress in the understanding of Citrus Huanglongbing: from the perspective of pathogen and citrus host.

Citrus Huanglongbing (HLB) is a devastating disease spread by citrus psyllid, causing severe losses to the global citrus industry. The transmission of HLB is mainly influenced by both the pathogen and the citrus psyllid. The unculturable nature of the HLB bacteria (Candidatus Liberibacter asiaticus, CLas) and the susceptibility of all commercial citrus varieties made it extremely difficult to study the mechanisms of resistance and susceptibility. In recent years, new progress has been made in understanding the virulence factors of CLas as well as the defense strategies of citrus host against the attack of CLas. This paper reviews the recent advances in the pathogenic mechanisms of CLas, the screening of agents targeting the CLas, including antimicrobial peptides, metabolites and chemicals, the citrus host defense response to CLas, and strategies to enhance citrus defense. Future challenges that need to be addressed are also discussed.

Two new polyketone derivatives from the mangrove endophytic fungus Aspergillus sp. GXNU TH4b

Two new polyketones, exserone B (1) and cytosporone F (2), along with three known metabolites, were isolated from the mangrove endophytic fungus Aspergillus TH4b. The structures of 1 and 2 were determined by detailed NMR, and MS spectroscopic data. The absolute configurations of 1 and 2 were determined by single crystal X-ray diffraction analysis and the combination of experimental ECD and computational ECD, respectively. Compounds 1–2 have strong inhibitory activity against citrus Psyllid (Diaphorina citri) with 95.4% and 93.7% lethal at 1000 mg/kg.

Detection of huanglongbing infection in citrus using compositional analysis of volatile organic compounds

AbstractHuanglongbing (HLB) is caused by “Candidatus Liberibacter asiaticus” and is spread by citrus psyllids. It is a highly damaging and infectious disease of citrus for which there is no reliable treatment. Timely detection and removal of diseased trees is an effective strategy to control HLB. Various citrus cultivars infected with HLB exhibit distinct symptoms, posing a challenge to generalize HLB detection methods across multiple cultivars. Volatile organic compounds (VOCs) in HLB‐infected leaves from cultivars grown in different regions were comprehensively analysed by gas chromatography–mass spectrometry (GC‐MS) and gas chromatography‐ion mobility spectrometry (GC‐IMS), aiming to establish a new generalized HLB detection method applicable to a range of citrus cultivars. The changes in VOCs were analysed in leaves of four citrus cultivars after infection with HLB. The results showed that there was a similar response to HLB infection in different citrus cultivars, and this response was reflected in both the concentration and type of VOCs. By combining GC‐MS and GC‐IMS with orthogonal partial least squares discriminant analysis (OPLS‐DA) model, the accurate identification of the HLB infection status of different citrus cultivars was achieved, with the prediction indices reaching 0.994 for GC‐MS and 0.972 for GC‐IMS. In addition, 27 compounds were identified that were significantly different between citrus cultivars affected by HLB and healthy plants. This study provides valuable insights into the changes in VOCs in citrus cultivars after HLB infection and lays the theoretical foundation for VOC‐based HLB detection strategies.

Decoding Huanglongbing: Understanding the Origins, Impacts, and Remedies for Citrus Greening

Citrus cultivation is a vital component of the agricultural sector, offering significant nutritional and economic benefits. However, citrus plants face numerous disorders, including Huanglongbing (HLB), also known as citrus greening disease. HLB is a devastating disease caused by the bacterial species Candidatus Liberibacter asiaticus (Las), primarily transmitted by the citrus psyllid and grafting. Investigating the distribution and molecular characterization of HLB in various citrus varieties and psyllid populations is crucial. Molecular techniques and iodine starch staining have been used to detect HLB symptoms. Several studies have been designed to determine the incidence and severity of HLB symptoms in different citrus varieties and locations and estimate the psyllid population density in different citrus varieties. Furthermore, these studies established a correlation between the population of psyllids and the incidence and severity of HLB in different locations and these findings suggest a potential link between psyllid infestation and the prevalence of HLB. This study highlights the prevalence of HLB in various locations and varieties, providing insights into the distribution, severity, and correlation between psyllid populations and HLB incidence. The reliability of PCR testing for Las infection confirms its effectiveness. Such findings suggest implementing integrated pest management strategies, including monitoring and controlling psyllid populations, removing infected plants, and using certified disease-free planting materials to prevent HLB spread.

Gamma-Aminobutyric Acid Supplementation Boosts the Phytohormonal Profile in 'Candidatus Liberibacter asiaticus'-Infected Citrus.

The devastating citrus disease, Huanglongbing (HLB), is associated with 'Candidatus Liberibacter sp.' and transmitted by citrus psyllids. Unfortunately, HLB has no known sustainable cure yet. Herein, we proposed γ-aminobutyric acid (GABA) as a potential eco-friendly therapeutic solution to HLB. Herein, we used GC/MS-based targeted metabolomics combined with gene expression to investigate the role of GABA in citrus response against HLB and to better understand its relationship(s) with different phytohormones. GABA supplementation via root drench boosts the accumulation of endogenous GABA in the leaves of both healthy and 'Ca. L. asiaticus'-infected trees. GABA accumulation benefits the activation of a multi-layered defensive system via modulating the phytohormone levels and regulating the expression of their biosynthesis genes and some pathogenesis-related proteins (PRs) in both healthy and 'Ca. L. asiaticus'-infected plants. Moreover, our findings showed that GABA application stimulates auxin biosynthesis in 'Ca. L. asiaticus'-infected plants via the activation of the indole-3-pyruvate (I3PA) pathway, not via the tryptamine (TAM)-dependent pathway, to enhance the growth of HLB-affected trees. Likewise, GABA accumulation was associated with the upregulation of SA biosynthesis genes, particularly the PAL-dependent route, resulting in higher SA levels that activated CsPR1, CsPR2, CsPR5, and CsWRKY70, which are prominent to activation of the SA-mediated pathway. Additionally, higher GABA levels were correlated with an enhanced JA profile and linked with both CsPR3 and CsPR4, which activates the JA-mediated pathway. Collectively, our findings suggest that exogenous GABA application might be a promising alternative and eco-friendly strategy that helps citrus trees battle HLB.

Isolation and insecticidal activities of new cyclic peptides from mangrove endophytic fungus Aspergillus sp. GXNU-4QQY1a

An investigation on bioactive metabolites from the mangrove endophytic fungus Aspergillus sp. GXNU-4QQY1a led to the isolation of two undescribed cyclic peptides, guaspertide A (1) and guaspertide B (2), together with six known compounds, 3–8. These structures and the new compounds' absolute configuration were determined by mass spectrometry analysis, nuclear magnetic resonance spectrum, electronic circular dichroism, and single-crystal X-ray diffraction. Insecticidal assays were carried out with compounds 1–8, and the results showed that compounds 1–3 and 8 exhibited good insecticidal activity against citrus psyllids.

REPELLENCE EFFECTS OF RED CHILI AND BLACK PEPPER OLEORESINS AGAINST AGRICULTURALLY IMPORTANT SUCKING PESTS

A study was carried out to evaluate red chili and black pepper oleoresins’ repellence against Citrus psyllids (Diaphorina citri Kuwayama), Red spider mites (Tetranychus urticae Koch), Cotton aphids (aphis gosippi Glover) and Cotton mealy bug (Phenacoccus solenopsis Tinsley) at laboratory conditions. In filter paper half of the portion was treated with one ml of respective solution using pipette and air dried under room condition. After they placed into 80 mm petriplates. Then the insects (15 nos ) were released into it and the repellency was recorded at 6 hrs interval. The results revealed that at 1% concentration, the red chili oleoresin possessed the highest repellence against aphids (100%), followed by red spider mites (86.66%) and psyllids (69.33%). The highest repellence (51.20%) in mealybugs was noticed only at the maximum concentration tested (5%).At 1% concentration, repellence was very minimal (25.33%). A similar trend was recorded in black pepper oleoresin also. Both the spice oleoresins had the highest repellence against cotton aphids. Phytotoxicity studies on 25 and 45 days old cotton plants revealed no symptoms at concentrations from 0.1 to 1%. At higher concentrations tested, some minor leaf and boll injuries appeared, and later, the plants recovered.

Role Of Weather Factors In Deciding The Population Of Diaphorina Citri Kuwayama On Curry Leaf

Citrus psyllid, Diaphorina citri Kuwayama is known to cause serious damage to tender shoots, which in turn reduces the leaf yield in curry leaf plants. The pest is emerged as serious on curry leaf growing in and around Dharwad during the recent years. Thus it is important to understand the role of different factors promoting psyllid population on curry leaf plant. The changing weather parameters may also be one among few important factors promoting higher psyllid population. The influence of weather factors on citrus psylla, Diaphorina citri Kuwayama population on curry leaf (Murraya koenigii L.) was studied in 2018 and 2019. The average psyllid population ranged from 1.96 to 38.85 per 4 terminal shoots. There was no nymphal population from the 15th to 18th SMW during 2018 and 2019. The nymphal population peaked during the 37th SMW during both years. The adult population was recorded throughout the year with fluctuation. The adult population peaked (26.20 and 30.10 per 4 terminal shoots) during the 38th SMW (3rd week of September) in both years. Correlation analysis for both years indicated that maximum temperature exhibited a significant and positive correlation with the adult population. Similarly, evening relative humidity was highly significant and positively correlated with the nymphal population whereas, maximum temperature adversely affected the build-up of the nymphal population. The study is useful to find out the weak links of psyllid populations about abiotic factors that could be exploited to curb its infestation.

A colorimetric, sensitive, rapid, and simple diagnostic kit for the HLB putative causal agent detection

Huanglongbing (HLB) is one of the most devastating diseases in citrus worldwide. The Gram-negative bacterial plant pathogen “Candidatus Liberibacter spp.” is phloem-limited and vectored by citrus psyllids. The species “Candidatus Liberibacter asiaticus” (C.Las) has been detected in Argentina, and its vector has been found in at least nine provinces. Early detection of C.Las is critical for a successful management of HLB disease. Currently, HLB molecular diagnosis is carried out by PCR, nested PCR, real-time PCR, or another combination of these techniques, which require purification of genomic DNA, sophisticated equipment, and highly trained personnel. We have developed a prototype of a sensitive colorimetric kit to detect C.Las based on the specific DNA isothermal amplification of this microorganism. The reaction buffer contains hydroxynaphthol blue (HNB), an indicator dye that turns from violet to blue/light blue when the DNA amplification reaction is positive. Similar sensitivity to visualize a positive reaction was observed between HNB loop-mediated isothermal amplification and agarose gel electrophoresis analysis. The detection of C.Las-infected plants was up to 8 ng of total infected plant genomic DNA, similar to quantitative PCR. A blind validation test of the prototype kit was performed with purified DNA extracted from healthy or C.Las-infected midrib plants. Our kit showed 100% concordance with the results of a gold-standard quantitative PCR technique applied by the Laboratorio de Biología Molecular de EEA Montecarlo. The analysis of samples, without DNA purification to detect C.Las, showed a similar sensitivity to the analysis of the same samples in which C.Las DNA was previously purified.

Enhancing PCR Capacity To Detect 'Candidatus Liberibacter asiaticus' Utilizing Whole Genome Sequence Information.

'Candidatus Liberibacter asiaticus' (CLas) is an unculturable α-proteobacterium associated with citrus Huanglongbing (HLB; yellow shoot disease). PCR procedures that accurately confirm or exclude CLas infection in citrus tissue/Asian citrus psyllid (ACP) samples are critical for HLB management. When CLas was described in 1994, a 23-bp signature oligonucleotide sequence (OI1) in the 16S rRNA gene (rrs, three genomic copies) was identified based on Sanger sequencing. OI1 contains single nucleotide polymorphisms (SNPs) distinguishing CLas from non-CLas species. The SNPs were used to design the primer HLBas, a key primer for a commonly used TaqMan PCR system (HLBas-PCR) for CLas detection. Recent developments in next-generation sequencing technology have led to the identification of 15 CLas whole genome sequence strains (WGSs). Analyses of CLas WGSs have generated a significant amount of biological information that could help to improve CLas detection. Utilizing the WGS information, this study re-evaluated the sequence integrity of OI1/HLBas and identified and/or confirmed a missing nucleotide G in the two primers. Replacement primers for OI1 and HLBas are proposed. At low cycle threshold (Ct) values (e.g., <30), HLBas-PCR remained reliable in CLas determination. At high Ct values (e.g., >30), HLBas-PCR alone was unreliable in differentiating whether samples contain low CLas titers or whether CLas is not present. The availability of ribonucleotide reductase (RNR)-PCR derived from the five-copy nrdB gene helped to resolve this problem. To further enhance low CLas titer detection, a 4CP-PCR system, based on a four-copy genomic locus, was developed. Evaluation of 107 HLB samples (94 citrus and 13 ACP) showed that 4CP-PCR was more sensitive than HLBas-PCR and shared similar sensitivity with RNR-PCR.

English

The survey was carried out in 2016 in the production of citrus fruits at Adiha and Sheka Tekli irrigation schemes of Kolla Tembien and Tanqua Abergelle districts, to assess the type of diseases, the causes and the characteristic symptoms of the diseases and to identify the types of insect pests that inflict serious damage. The laboratory analysis result depicted that bacteria and fungi caused most of the diseases of citrus at Adiha and Sheka Tekli irrigation schemes. Exceptionally cyst nematode and climbing weed were problems in production of citrus at the irrigation schemes. Diseases like citrus melanose, brown rot, root rot, blue mold, sooty mold, leaf spot and fruit spot were among the fungal diseases identified at the irrigation schemes. Moreover, citrus greening, and citrus canker were also some of the bacterial diseases of citrus at Adiha and Sheka Tekli irrigation schemes. Conversely, the type of insect pest that predominantly constrained the production of citrus in both areas were woolly whitefly, citrus mealybugs, orange dogs, cottony cushion scale insects, brown scale insect, citrus leafminer, citrus psyllid, fruit fly, adult flatid planthoppers, citrus aphid, red scale and root weevil respectively. Most of these insect pests belong to the Hemipteran order followed by lepidopteron insect group. Milk vine had also been observed as one of the weeds that pose serious problems to some of the citrus trees at Adiha and Sheka Tekli irrigation schemes. Therefore, further research intervention should focus on management of these insect and disease pests at Adiha and Sheka Tekli irrigation schemes. Key words: Citrus disease, insect pest, symptoms and identification.

Antimicrobial Compounds to Combat Citrus Huanglongbing

Citrus Huanglongbing (HLB) is associated with the fastidious bacterium,Candidatus Liberibacter, (Las) that is transmitted by a phloem-feeding insect (Citrus Psyllid). An ideal solution to combat citrus HLB is to completely eliminate the bacteria after a single course of the chemotherapy, either active directly on the bacteria or indirectly through induction of host defense compounds. Twenty-seven antimicrobial compounds were screened to test for in vivo activities against HLB bacterium while assessing their phytotoxicity to citrus using the optimized graft-based chemotherapy approach (Zhang et al., 2012). The Las bacterial titers were quantified by qPCR from the leaf samples that were taken at 4-months and 6-months after inoculation, respectively. The Las-infected plants were considered as Las positive with threshold cycle (Ct) values less than 32.0. The efficiency against the HLB bacterium of the tested compound was evaluated by Ct values in the inoculated plants (both scions and rootstocks), scion infected percentage and HLB bacterial transmission percentage. The phytotoxicity was determined by the survival and growth of scions treated by antimicrobial compounds. The clustering results indicated that 27 antimicrobial compounds were divided into 3 groups. The first group including 12 compounds, such as Zineb, was not effective in eliminating the HLB bacteria, with high scion infection (67.9% ± 14.4% on average)， Las transmission percentage (83.4% ± 13.85 on average) as well as the high bacterial titers. The second group of only two compounds was also not effective against the HLB bacterium, but had high phytotoxicity to citrus (less than 40% of the scion survival and 15% of the scion growth). The third group including 13 compounds, such as nicotine, was effective in eliminating the Las bacteria and had no phytotoxicity to citrus. The effective compounds will be further tested in the container-potted plants and in the field.

First Report of ‘Candidatus Liberibacter asiaticus’ associated with huanglongbing in the weeds Cleome rutidosperma, Pisonia aculeata and Trichostigma octandrum in Jamaica

Citrus huanglongbing (HLB) also known as citrus greening is the most destructive disease of citrus worldwide. Three species of the causal organism have been identified. These are ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. africanus’ and ‘Ca. L. americanus’ (Bove, 2006). In 2010 a survey of non-citrus plants was conducted on two major citrus producing farms in Clarendon and St Catherine in Jamaica. This was to determine the possibility of the existence of non-citrus hosts of HLB. A total of 120 plants belonging to 10 different species and nine families were collected over a period of two months. The plants collected included weeds as well as non-citrus trees. None of the plants collected exhibited any symptoms of HLB and at the time of sample collection, no citrus psyllids was observed on the plants. DNA was extracted from plant samples using the method of Dellaporta et al. (1983) and analysed by PCR using the primer pair OI1 (5` GCGCGTATGCAATACGAGCGGCA3`) and OI2c (5`GCCTCGCGACTTCGCAACCCAT 3`). DNA obtained from a confirmed HLB infected citrus plant from Florida served as the positive control whereas DNA from a citrus plant uninfected by HLB was used as the negative control.

Unique features of a Japanese 'Candidatus Liberibacter asiaticus' strain revealed by whole genome sequencing.

Citrus greening (huanglongbing) is the most destructive disease of citrus worldwide. It is spread by citrus psyllids and is associated with phloem-limited bacteria of three species of α-Proteobacteria, namely, ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. americanus’, and ‘Ca. L. africanus’. Recent findings suggested that some Japanese strains lack the bacteriophage-type DNA polymerase region (DNA pol), in contrast to the Floridian psy62 strain. The whole genome sequence of the pol-negative ‘Ca. L. asiaticus’ Japanese isolate Ishi-1 was determined by metagenomic analysis of DNA extracted from ‘Ca. L. asiaticus’-infected psyllids and leaf midribs. The 1.19-Mb genome has an average 36.32% GC content. Annotation revealed 13 operons encoding rRNA and 44 tRNA genes, but no typical bacterial pathogenesis-related genes were located within the genome, similar to the Floridian psy62 and Chinese gxpsy. In contrast to other ‘Ca. L. asiaticus’ strains, the genome of the Japanese Ishi-1 strain lacks a prophage-related region.

First Report of 'Candidatus Liberibacter asiaticus' Associated with Huanglongbing on Citrus latifolia in Martinique and Guadeloupe, French West Indies.

Huanglongbing is an unculturable vascular citrus pathogen transmitted from infected to healthy plants through grafting or by citrus psyllids, Diaphorina citri mainly in Asia and America and Trioza erytreae in Africa. This phloem limited gram-negative bacterium causes dramatic yield losses and is classified into three species based on 16S rDNA sequence analysis (2): (i) 'Candidatus Liberibacter asiaticus' (Las), the most epidemiologically active, widespread and heat tolerant species; (ii) 'Ca. L. africanus' (Laf), only found in Africa; and (iii) the newly described 'Ca. L. americanus' (Lam), which appeared in 2005 in Brazil (5). Considered as a quarantine organism in America and Europe, Las is actively affecting North America and Asia, and research is leading toward psyllid management and resistance breeding. Despite the fact that Reunion Island has successfully controlled Las by introducing a psyllid parasitoid, Tamarixia radiata (1), this strategy was less effective or reproducible within other territories. D. citri was first detected in Guadeloupe in 1998, where the control of the the psyllid population has been effective with T. radiata (3); and was first detected in Martinique in 2012. Following the outbreak in the United States and the Caribbean, and also supported by reports of symptoms in citrus orchards, local National Plant Protection Organizations (NPPO) organized a detection survey across both islands to verify the occurrence of Huanglongbing. Since 2012, 450 sites were prospected each year in Martinique and Guadeloupe, where 20 leaves from 10 to 30 trees were analyzed. DNA extraction was performed (DNeasy Plant Mini Kit, Qiagen) on fresh or dried leaf midribs, along with negative control midribs (Citrus paradisi 'Star Rubis') and PCR amplification was done with the species-specific primers A2/J5 (4) and GB1/GB3 (5). Only Las-specific 703-bp amplicons were obtained (n = 43) and 20 were sequenced (Beckman Coulter Genomics, United Kingdom; sequences available through GenBank Accession Nos. KF699074 to KF699093) and blasted against the National Center for Biotechnology Information non-redondant database (NCBI-nr). BLAST analysis revealed 100% identity with the 50S ribosomal protein subunit L1 (rplA) and L10 (rplJ) of 'Ca. L. asiaticus' (all strains), and no significant homology to other organisms. Additionally, sequence assembly on a reference genome (NC_012985) showed 100% homology. Huanglongbing was detected in Guadeloupe on March 2012 at Le Moule (East coast) in a Tahiti lime orchard (C. latifolia) and crossed the island in 6 months. Las was detected in Martinique on May 2013 on Tahiti lime (C. latifolia) at Bellefontaine (Northwest) in a private garden and at Le Lorrain (Northeast) in an orchard. Other species from the Rutaceae family were affected by HLB (C. reticulat and C. sinensis) on both islands; however, few of the positive samples showed HLB symptoms (blotchy mottle patterns and green islands on leaves), but presented symptoms similar to nutrient deficiencies. Despite the former presence of T. radiata in Guadeloupe and its detection in Martinique a few weeks after the detection of D. citri, where it had a mean parasitism rate of 70%, an outbreak of HLB spread across both islands. These analyses confirm the presence of HLB in Martinique and Guadeloupe and to our knowledge represent the first report of Las in the French West Indies. Introduction events remain unclear, but this report raises the importance of plant certification, psyllid population control, and surveillance of territories close to the French West Indies, with regards to the risk that HLB presents to citrus production worldwide.

Common pests of psyllids and whiteflies ( Hemiptera: Psylloidea: Aleyrodoidea) infesting orchard trees in Egypt.

The present review includes psyllids infested orchards trees in Egypt. Six species was recorded. These species are olive psyllid, Euphyllura straminea Loginova (Psyllidae), Saycamora fig psyllid, Pauropsylla trichaeta Petty (Triozidae), Eucalyptus psyllid, Blastopsylla occidentalis (Taylor) (Psyllidae) Craspedolepta heslopharrisoni (Samy) (Psyllidae) and two citrus psyllids, Diaphorina aegyptiaca Puton (Psyllidae) and Trioza sp. (Triozidae). This review also includes three species of whiteflies which infest orchards trees in Egypt. They are pomegranat whitefly, Siphoninus phillyreae (Haliday), citrus whitefly, Dialeurodes citri (Ashmead) and bayberry whitefly, Parabemisia myricae (Kuwana) (Hemiptera: Aleyrodidae).

Complete Genome Sequence of Citrus Huanglongbing Bacterium, ‘CandidatusLiberibacter asiaticus’ Obtained Through Metagenomics

Citrus huanglongbing is the most destructive disease of citrus worldwide. It is spread by citrus psyllids and is associated with a low-titer, phloem-limited infection by any of three uncultured species of alpha-Proteobacteria, 'Candidatus Liberibacter asiaticus', 'Ca. L. americanus', and 'Ca. L. africanus'. A complete circular 'Ca. L. asiaticus' genome has been obtained by metagenomics, using the DNA extracted from a single 'Ca. L. asiaticus'-infected psyllid. The 1.23-Mb genome has an average 36.5% GC content. Annotation revealed a high percentage of genes involved in both cell motility (4.5%) and active transport in general (8.0%), which may contribute to its virulence. 'Ca. L. asiaticus' appears to have a limited ability for aerobic respiration and is likely auxotrophic for at least five amino acids. Consistent with its intracellular nature, 'Ca. L. asiaticus' lacks type III and type IV secretion systems as well as typical free-living or plant-colonizing extracellular degradative enzymes. 'Ca. L. asiaticus' appears to have all type I secretion system genes needed for both multidrug efflux and toxin effector secretion. Multi-protein phylogenetic analysis confirmed 'Ca. L. asiaticus' as an early-branching and highly divergent member of the family Rhizobiaceae. This is the first genome sequence of an uncultured alpha-proteobacteria that is both an intracellular plant pathogen and insect symbiont.

The identity and bionomics of insect vectors of tristeza and greening diseases of citrus in Ethiopia

Abstract Survey studies were carried out to determine the identity and bionomics of insect vectors of tristeza and greening diseases of citrus in citrus growing regions of Ethiopia between 1982 and 1985: Results of these studies revealed that three species of aphids: Aphis gossypii Glover, Toxoptera aurantii Boyer de Fonscolombe and T. citricidus (Kirkaldy), were implicated in tristeza, whereas the citrus psyllid, Trioza erytreae Del Guercio, was solely responsible for greening; the Asiatic psyllid, Diaphorina citri Kuwayama, was not found in this country. Among the aphids, A. gossypii was least common on citrus while T. aurantii was found in large numbers and was widely distributed throughout the country; T. citricidus was confined mainly to the middle Awash areas. Trioza erytrea was widely spread in the country above 1500 m and was more severe at higher altitudes. Host range studies indicated that A. gossypii, T. aurantii and T. erytreae are polyphagous while T. citricidus was found only on citrus. No parasitoid was reared from A. gossypii during the study while five and six species were identified from T. aurantii and T. erytreae respectively. The encyrtids, Psyllaephagus pulvinatus (Waterston) and Psyllaephagus sp. were the dominant and widely distributed primary parasitoids of T. erytreae. Eleven species of predators were recorded on one or more of the insect vectors.