Chlorotic Margins Research Articles

First Report of Anthracnose on Cinnamomun burmannii Caused by Colletotrichum scovillei in China.

Mei Pian tree belongs to a new physiological type of Cinnamomun burmannii discovered in the eastern part of the Guangdong province in China in 1987 (Chen et al. 2011). Although the external morphology of Mei Pian tree is similar to Cinnamomun burmannii, the leaves of Mei Pian tree, known as an important traditional Chinese medicine, are rich in natural D-borneol, which protects the heart, brain, and other organs, regulates the central nervous system, and promotes the absorption of other drugs (Yang et al. 2020; Fu et al. 2020). In April 2020, we found that the yield and quality of Mei Pian tree leaves were seriously threatened by anthracnose. Approximately, 40 - 60% of trees were infected in Pingyuan County, Meizhou City, Guangdong Province (N24°28'31.13", E115°50'50.02"). Small circular black spots were initially observed on infected leaves, and spots continued to grow and developed chlorotic margins and concentric rings with sunken areas. As the disease progressed, multiple spots were observed on almost all leaves. Four symptomatic leaves were collected and used for pathogen isolation. The areas of symptomatic and healthy-appearing leaf tissues at the margin of spots were surface-sterilized with 0.5% NaClO for 2 minutes and 70% alcohol for 30 seconds. The sterilized leaves were washed three times with sterile water, air dried, plated on potato dextrose agar (PDA) medium, and incubated at 28°C for 4 days in the dark. A total of six single-spored isolates were obtained and named from MPS-1 to MPS-6, respectively. Among those isolates, MPS-2, MPS-5, and MPS-6 were identical when cultured on PDA plate. The colonies were white to pale gray with dense aerial mycelia, and the reverse side of the colonies was light reddish brown. Conidia were cylindrical and measured 9.0 to 14.0 μm in length and 3.0 to 4.5 μm in width (n = 35). For molecular identification, the primers ITS1/ITS4, GDF/GDR , CHS-79F/CHS-345R, ACT-512F/ACT-783R and T1/Bt2b were used to amplify the partial regions of rDNA-ITS, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chitin synthase(CHS1), actin (ACT) and β-tubulin (TUB2), respectively, from the genomic DNA extracted from fresh mycelia of MPS-2 (Damm et al. 2012). The resulting sequences were deposited in GenBank with accession numbers of MW091490, MW125584, MW125585, MW125586 and MW125587, respectively. The phylogenetic tree was generated by the maximum likelihood method of the MEGA 7 software using a concatenated alignment of ITS, GADPH, CHS1, ACT and TUB2 sequences. According to both morphological and sequence analyses, MPS-2 was identified as Colletotrichum scovillei (Damm et al. 2012, 2020). Pathogenicity tests were performed by inoculating healthy Mei Pian tree leaves with 5 mm PDA plugs containing actively growing mycelium of MPS-2 and wound-inoculated by spraying MPS-2 conidial suspension (106 conidia ml-1). Controls were inoculated only with sterile PDA plugs and ddH2O. All inoculated plants were maintained in a moist chamber (RH greater than 90%) at 25 °C, with an 8-h photoperiod under T5 LED lights. All inoculated leaves developed symptoms similar to those on naturally infected leaves after 5 days, but leaves on control plants remained asymptomatic. The fungus on the inoculated plants was identical in morphology to that found on the original sample collected in the field, thus fulfilling Koch's postulates. In previous studies, Colletotrichum scovillei also caused anthracnose on banana (Musa spp. AAA group), pepper (Capsicum annuum), and mango (Mangifera indica L.) in China (Zhou et al. 2016; Zhao et al. 2016; Qin et al. 2019). To our knowledge, this is the first report of Colletotrichum scovillei causing anthracnose on Cinnamomun burmannii in China and worldwide. The identification of C. scovillei as the causal agent of the observed anthracnose on C. burmannii is critical to the prevention and control of this disease in the future.

First Report of Leaf Spot Disease Caused by Stemphylium vesicarium on Fagopyrum esculentum in China.

Common buckwheat (Fagopyrum esculentum) is a widely cultivated non-grass cereal. It has a considerable market value with nutritional qualities and ability to treat or prevent cancers, hypertension and diabetes (Cawoy et al., 2006). In July-August 2018 and 2019, leaves exhibiting unfamiliar symptoms were observed in Huan County and Huachi County, Gansu, China, with 15% incidence and moderate to severe severity across the field. Initial symptoms consisted of small chlorotic, circular to oval leaf spots. As disease progressed, the spots enlarged and turned light brown to brown with chlorotic margins. When the disease was severe, the leaf spots coalesced and the leaves became prematurely chlorotic and senescent. Spots occurred mostly but not exclusively on older foliage. Diseased tissues were surface sterilized with 75% ethanol for 20 s and 0.1% NaClO for 2 min, placed on PDA medium and incubated at 20 °C for 48-72 h. A total 24 isolates were obtained and purified through single-spore cultures, 19 of which were characterized. Colonies on PDA of all 19 isolates were identical, exhibiting a light gray color, with whitish aerial mycelium that later turned light brown on the reverse of the culture plates, and sporulated sparsely. Conidia were brown colored, cylindrical, and borne singly, often had three main transverse septa, at which points there were conspicuous constrictions, and measured (17-37) μm long × (13-21) μm wide (n=30) in V8 juice agar, (22-38) μm long × (11-19) μm wide (n=30) in PCA, (21-41) μm long × (13-20) μm wide (n=30) in SNA, the mean length/width ratio was 1.6 to 2.0 in V8 juice agar, 1.6 to 2.5 in PCA, 1.3 to 2.2 in SNA. Conidiophores were unbranched, 5.1 to 7.9 μm wide. Dictyospores were produced on well-differentiated conidiophores, the apical cell of conidiophore was slightly to distinctly swollen. Based on morphological features, the isolates were tentatively identified as a member of the Stemphylium vesicarium species complex (Koike et al., 2013; Simmons, 1967). Genomic DNA of representative isolate B1 was extracted, and the internal transcribed spacer (ITS) region and calmodulin gene (cmdA) were amplified using ITS1/4, V9G/ITS4, and CALDF1/CALDR1, respectively. The resulting sequences were deposited in GenBank (acc. nos. MT629829, MW406903, MW417122). Nucleotide BLAST similarity analysis of the sequence fragment of ITS and cmdA from isolate B1 resulted in higher than 99% (99.32% for ITS1/4, 100% for V9G/ITS4, and 100% for CALDF1/CALDR1) identity with S. vesicarium strains (GenBank acc. nos. LC512757, MH863402 and MH206181). Based on morphological features and molecular data, the buckwheat isolates were identified as S. vesicarium. To verify pathogenicity, the back side of leaves from six asymptomic plants were inoculated by spraying the spore suspension (104 spores/ml) harvested from isolate B1 grown on V8 juice agar for 20 days. Control plants were sprayed with sterile water. Each plant was covered with a black plastic bag for 48 h and then was kept in a greenhouse. Stemphylium spot symptoms were observed on all inoculated leaves after 14 days, whereas control leaves were symptomless. The pathogen was reisolated from symptomatic leaf spots, micromorphological features and colony characters of the reisolated fungi were identical to the original isolate. To our knowledge, this is the first documentation of leaf spot of buckwheat caused by S. vesicarium in China, and the first characterization of a Stemphylium foliar pathogen on this crop.

First report of Pyrenophora teres f. teres causing leaf spot on wheat in Brazil.

Pyrenophora teres f. teres is well known for causing net form net blotch on barley, but its pathogenicity on wheat has also been reported in Hungary (Tóth et al. 2008) and east Russia (Mikhailova et al. 2010). The report from Hungary mentioned symptoms of dark brown necrotic lesions with or without chlorotic margins, while the report from Russia described symptoms similar to tan spot. A survey of fungal pathogens causing leaf spot diseases on wheat in the humid subtropical areas of Paraná State, southern Brazil, was conducted in 2016. Twenty four isolates, representing different wheat fields in the municipalities of Guarapuava and Pinhão, in the state of Paraná, were collected from wheat plants at the soft dough stage. The isolates analyzed in our study were obtained from leaf fragments of wheat cv. Toruk and were removed from the edge of lesions resembling tan spot, a major fungal disease of wheat in that region, caused by Pyrenophora tritici-repentis. The leaves presented oval, diamond, or elongate-shape lesions with tan necrotic spots. Still, they did not always show the brown center, which seemed not very characteristics of tan spot caused by P. tritici-repentis. Yellow halos surrounded the necrotic lesions. The fragments were superficially disinfected for 30 sec in 0.5% sodium hypochlorite, washed in sterile water, dried with a sterile paper towel, and transferred to petri plates containing potato dextrose agar (PDA) medium. After four days of incubation at 24±2ºC and a photoperiod of 12 h, hyphal tips were removed from the PDA medium and transferred to petri plates containing V-8 medium. Plates were incubated for 14 days in alternate cycles of 12 h at 23±2ºC under light and 12 h at 19±2ºC in darkness for sporulation. Pure cultures were obtained from single conidia produced on V-8 medium. Single spore isolates, representing different fields, were obtained from individual leaves. Conidia measuring 38-82 µm × 16-20 µm were smoothly cylindrical and straight, with rounded ends, subhyaline or yellowish brown, with four to seven pseudosepta. Genomic DNA extracted from cultures grown in yeast extract broth medium was used for PCR amplification of the ribosomal internal transcribed spacers and the 5.8S ribosomal DNA gene (ITS-5.8S rDNA) using the primers ITS4 and ITS5 described by White et al. (1990). A BLAST search of the GenBank database revealed that the ITS-5.8S rDNA sequence fragments (505 bp) from 12 out of 67 isolates were 99-100% similar to P. teres accession number EF452452 (Andrie et al. 2008). The DNA sequences of three P. teres isolates (20C3, 20A3, and 20A1) were deposited in GenBank (accession nos. MH594043.1, MH594042.1, and MH594041.1, respectively). These isolates were obtained from different fields in the municipality of Pinhão (25° 42 '26 "S; 51° 38' 0" W), in Paraná State. To test the pathogenicity of the isolates 20C3, 20A3, and 20A1, a conidial suspension for each isolate with 2-3 × 103 conidia per mL was sprayed at the boot stage (BBCH-scale 45) on leaves of wheat cv. Toruk and on susceptible barley cv. Ana 01 plants growing in pots. Each pot containing 5-7 plants was considered as replicate. Wheat plants were also inoculated with a P. tritici-repentis isolate with a conidial suspension at the same concentration described above to serve as reference of symptoms for tan spot. Wheat and barley plants were also inoculated with sterile water to serve as a control. Six replications were inoculated for each treatment. After inoculation, the plants were maintained in a dew chamber for 24 h and then moved to a growth room at 20±2ºC and 16 h photoperiod. Initially, the leaves of wheat plants inoculated with P. teres exhibited small, irregular, dark lesions surrounded by yellow halos, and later exhibited oval to elongate, pale brown, necrotic lesions, and yellow halos. Differently from tan spot caused by P. tritici-repentis, the wheat leaves inoculated with P. teres f. teres presented a more diffuse yellowing, and the center of necrotic lesions was pale brown. The symptoms observed in the barley leaves were the net form net blotch, which allowed us to infer that the disease was caused by P. teres f. teres isolates. All inoculated plants presented symptoms, with some variation among them. Pyrenophora teres f. teres was reisolated from the inoculated wheat and barley plants. This is the first report of P. teres f. teres causing leaf disease on wheat in Brazil. The finding contributes to a better understanding of the etiology of wheat leaf spots in humid subtropical areas of southern Brazil.

First Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Georgia, U.S.A.

HomePlant DiseaseVol. 104, No. 3First Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Georgia, U.S.A. PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Georgia, U.S.A.M. E. Ali, O. Hudson, S. Waliullah, J. Brock, B. Hayes, J. L. Williams-Woodward, and J. E. OliverM. E. Ali†Corresponding author: M. E. Ali; E-mail Address: ma49268@uga.eduhttp://orcid.org/0000-0002-5871-5055Department of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, O. HudsonDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, S. WaliullahDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, J. BrockDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, B. HayesUniversity of Georgia Cooperative Extension, Mitchell County, Camilla, GA 31730Search for more papers by this author, J. L. Williams-WoodwardDepartment of Plant Pathology, University of Georgia, Athens, GA 30602Search for more papers by this author, and J. E. OliverDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author AffiliationsAuthors and Affiliations M. E. Ali1 † O. Hudson1 S. Waliullah1 J. Brock1 B. Hayes2 J. L. Williams-Woodward3 J. E. Oliver1 1Department of Plant Pathology, University of Georgia, Tifton, GA 31793 2University of Georgia Cooperative Extension, Mitchell County, Camilla, GA 31730 3Department of Plant Pathology, University of Georgia, Athens, GA 30602 Published Online:30 Dec 2019https://doi.org/10.1094/PDIS-09-19-1962-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Blackberries (Rubus L. subgenus Rubus) are small, round, aggregate berries comprising a cluster of tiny fruits called drupelets that grow on flowering shrubs or trailing vines (Clark et al. 2007). The acreage of blackberry production in Georgia has increased 10-fold in the last 15 years to 880 acres (NASS 2017). Downy mildew of blackberry, caused by the oomycete pathogen Peronospora sparsa, is a systemic disease that impacts blackberry production in many regions worldwide. Symptoms of downy mildew on blackberry include yellowing on the upper leaf surface and reddish-brown angular lesions with necrotic centers and chlorotic margins. In May 2019, leaf symptoms typical of blackberry downy mildew were observed on blackberry cultivar ‘Ouachita’ plantlets at a nursery in Mitchell County, Georgia. Initial identification was done based on the morphological characteristics of the sporangia and sporangiophores. Round or slightly ovoid sporangia were observed that were colorless to yellowish-brown, consistent with Peronospora sp. (Gubler and Rebollar-Alviter 2017). The identification of P. sparsa was further confirmed using nucleic acid-based molecular methods directly on infected plant tissue. Genomic DNA was extracted from symptomatic leaf tissue and tested for the presence of P. sparsa by targeting the P. sparsa-specific rDNA-ITS region using “P” primer pair P1 (5′-CACGTGAACCGTATCAACC-3′) and P2 (5′-GATAGGGCTTGCCCAGTAG-3′) with an amplicon size of 94 bp (Hukkanen et al. 2006). PCR reactions produced the expected sizes of the fragments for P. sparsa. The amplified products were then sequenced and subjected to BLAST analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for further identification. Sequence analysis revealed that the obtained partial sequence of P. sparsa-specific rDNA-ITS (GenBank submission no. MN477916) shared 100% identity to corresponding sequences from P. sparsa (accession no. Y15816). Samples were also tested for the presence of P. sparsa by real-time PCR using the same set of “P” primers. For real-time PCR, plant internal control primer pair R1 (5′-CAAACGACTCTCGGCAAC-3′) and R2 (5′-CCTCGGCCTAATGGCTT-3′) was used to target the highly conserved region of 5.8S plant ribosomal DNA (Hukkanen et al. 2006). The real-time PCR assay was performed in a Cepheid smart cycler II (Sunnyvale, CA) using iQ SYBR Green Supermix (BioRad Laboratories, Hercules, CA) in a 25-µl reaction according to the manufacturer’s protocol (Harper et al. 2010). All four samples extracted from symptomatic leaves were positive based on the real-time PCR assay. In addition, Koch’s postulates were fulfilled to verify the pathogenicity of the P. sparsa. Leaves from four uninfected blackberry plants (also cv. Ouachita) were surface sterilized, laid under sporulating leaf tissue, and incubated at 17°C with a 12-h photoperiod in a moist chamber. After 16 days, on the previously uninfected leaves, sporangiophores and sporangia consistent with P. sparsa developed. As a control, additional leaves from the same four plants were surface sterilized, placed in a moist chamber, incubated at 17°C with a 12-h photoperiod, and examined 16 days later. No lesions or sporulation developed on the uninoculated controls. To the best of our knowledge, this is the first report of P. sparsa causing downy mildew on blackberry in Georgia. Our findings suggest that Georgia blackberry growers should be aware of this disease and accordingly establish management measures for P. sparsa.The author(s) declare no conflict of interest.

First Report of Bacterial Canker of Kiwifruit Caused byPseudomonas syringaepv.actinidiaein Fujian Province, China

In recent years, kiwifruit (Actinidia chinensis cv. Hongyang) was introduced into Fujian Province as an economically important fruit. During 2016 and 2017, symptoms of bacterial canker were observed on kiwifruit in an approximately 15-ha orchard with 3-year-old plants in Fuan city, Fujian Province of China. The orchard exhibited 70 to 80% incidence. Symptoms on leaves began as brown angular spots surrounded by chlorotic margins that later became dark brown spots surrounded by yellow halos, and occasionally red-rusty cankers with reddish exudates were observed on the stems. Two representative strains, FJ-21a and FJ-21d, were isolated onto Luria-Bertani medium (LB) from stems showing a typical symptom of red-rusty cankers with reddish exudates, which were randomly selected from two different plants. These two strains were gram negative, aerobic, rod shaped, and nonfluorescent on King’s B medium or LB; positive for carbohydrate utilization, levan production, and hypersensitive on tobacco and tomato; and negative for oxidase, arginine dihydrolase, urease activity, gelatin liquefaction, and nitrate. The two strains were further identified by polymerase chain reaction (PCR) amplified 16S rDNA region (1,500 bp) and outer membrane protein P1 (ompP1) gene (492 bp) using 27F/1492R (Weisburg et al. 1991) and psaF/psaR (Koh and Nou 2002) primer pairs, respectively. BLASTn analysis showed that the 16S rDNA region (NCBI accession nos. MH071159 and MH071160) and ompP1 (MH084697 and MH084698) gene sequences shared 100 and 100% identity to that of Pseudomonas syringae pv. actinidiae (Psa) strains ICMP 18884 (CP011972) and CRAFRU 12.29 (CP019730), and 11955 (JQ934479) and ISF 8.57 (FR863682), respectively. Based on morphological characteristics, physiological and biochemical tests, and molecular identification, these strains were identified as Psa (Cunty et al. 2015; Takikawa et al. 1989). The two Psa strains were characterized as biovar 3 through PCR using the biovar-specific primers Tac-F/Tac-R (Koh et al. 2014). Pathogenicity was tested with two strains on 6-month-old kiwifruit cv. Jinyan (Fruit Research Institute, Fujian Academy of Agricultural Sciences) using two methods: injecting cell suspensions (10⁸ CFU/ml) into stems with a hypodermic syringe and spraying the bacterial suspension on wounded or unwounded leaves until runoff. Five plants and 10 leaves were used per strain and method. Control plants were inoculated with distilled water or liquid LB medium. The inoculated plants were incubated at 26/22°C (day/night) in a greenhouse (12 h light and >90% relative humidity) for 3 to 4 weeks. As a result, all inoculated plants exhibited the symptoms of twig death or black wilting on stems and yellow or dark brown spots on leaves, which were similar as observed initially in the field. Psa strains were reisolated from each inoculated location. Psa has been reported in other provinces of China, but to our knowledge, this is the first report of Psa causing bacterial canker on kiwifruit in Fujian Province. Psa could have a significant impact on the establishment and productivity of kiwifruit in natural conditions. There is urgency to determine the distribution of Psa in Fujian Province. Furthermore, quarantine measures are needed to prevent further spread of the pathogen to other kiwifruit orchards.

Isolation and characterization of Xanthomonas euvesicatoria pv. euvesicatoria causing bacterial spot in Physalis pubescens in Northeast China

Ground cherry (Physalis pubescens) is widely cultivated in Northeast China as one of its popular fruits. In the summer of 2017, suspected bacterial disease symptoms consisting of water-soaked spots and brown interveinal necrotic lesions with chlorotic margins were observed on ground cherry leaves in a field of Hailun County in Northeast China. From infected leaves, bacteria with pale-yellow, mucoid, domed circular colonies were repeatedly isolated. Based on biochemical tests and genetic characterizations of hrpB and concatenated four housekeeping genes (lepA-gyrB-gapA-gltA), the bacteria isolates obtained in this study were identified as Xanthomonas euvesicatoria pv. euvesicatoria. Pathogenicity of these isolates was confirmed on ground cherry, tomato and pepper seedlings by artificial inoculation. It was further confirmed that none of the related pathogens X. vesicatoria, X. gardneri or X. euvesicatoria pv. perforans were detected by species-specific PCR in field samples. To our knowledge, this is the first report of X. euvesicatoria pv. euvesicatoria causing bacterial spot of ground cherry in China.

Occurrence of Late Blight (Septoria apiicola Speg.) on Celery (Apium graveolens L.) in Egypt

Celery (Apium graveolens L., family Umbelliferae) is an important, annual crop cultivated mainly as medicinal plant aswell as vegetable plant in Egypt. The seeds and essential oil are very important and expensive yield components due to their usages as spice, in medicinal products and in folk medicine. Recently, the area cultivated is expanded in Beni-Suief Governorate as a result of the increase in exportation demand. Late blight (=Septoria leaf spot) caused by Septoria apiicola Speg. is a worldwide major foliage disease causing losses of 50-90% in commercial celery fields. In Egypt, symptoms of the disease started to appear at the end of March and during April 2015 on growing fieldplants in Beba and Somusta Counties, Beni-Suief Governorate. Symptoms appear as small, circular, water soaked spots on the leaves(about 1.3 to 1.8 mm, av. 1.6 mm - diam.), often surrounded by a faint chlorotic margins (Fig.1.). After 21 to 36 days, the spots turned dark to nearly black and became filled with minute black pycnidia (Fig.1.), which were closed, pear-shaped cups partly embedded in the infected plant tissues (Fig.2.). These symptoms were usually observed on allthe foliage plant parts at the last month of the growing season and percentages of infected plants reached 60-100% in severely infected fields with disease severity ranged between 43-90%. Moreover, about 5% plants of the total growing area were completely destroyed. According to the available literature, this is the first report of this disease in Egypt.

Bacterial wilt of common bean (Phaseolus vulgaris) caused by Curtobacterium flaccumfaciens pv. flaccumfaciens in Iran

Bacterial wilt of common bean (Phaseolus vulgaris L.) (cv. Talash and Akhtar) caused by a yellow variant of Curtobacterium flaccumfaciens pv. flaccumfaciens was identified in East Azerbaijan Province, northwestern Iran. Interveinal necrotic lesions surrounded by chlorotic margins leading to total wilt were observed with up to 50 % of plants infected in some fields. The causal agent was characterized using biochemical tests and confirmed by specific polymerase chain reaction primers. This is the first report of bacterial wilt of common bean in Iran.

Phaseolus lunatus, a New Host of Xanthomonas axonopodis pv. phaseoli in Iran

AbstractCommon bacterial blight caused by Xanthomonas axonopodis pv. phaseoli (Xap) is one of the most destructive diseases limiting the production of common bean (Phaseolus vulgaris) in Iran. The disease has previously been described on common bean and mung bean from several regions of Iran, including the central plain and south‐western provinces. In this study, lima bean (Phaseolus lunatus cv. Christmas) plants are being reported as a new natural host of Xap in East Azerbaijan and West Azerbaijan Provinces, northwestern Iran. Disease symptoms consisted initially of water‐soaked spots that progressed to irregular necrotic lesions with chlorotic margins. Infection was observed to affect up to 40% of plants in the field. Identification of the pathogen was based on the biochemical and molecular characteristics, as well as the pathogenicity tests. To our knowledge, this is the first report of X. axonopodis pv. phaseoli causing common bacterial blight on lima bean plants in Iran.

First Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Arkansas

In March of 2014, blackberry (Rubus fruticosus) greenhouse seedlings with leaf symptoms that included yellowing on the leaf surface and reddish brown angular lesions with necrotic centers and chlorotic margins were detected in the University of Arkansas Fruit Research Station in Clarksville, AR (35°32.065' N, 93°24.3564' W). Symptoms were observed on multiple blackberries in the greenhouse, with an estimated prevalence of 25%. Three symptomatic samples of the affected plants were submitted to the Plant Health Clinic in Fayetteville, AR, for diagnosis. Sporulation was observed on the underside of the symptomatic leaf tissue. Hyaline sporangiophores were observed emerging from stomata on the undersides of leaves, 295 to 620 × 4 to 6 μm with long, straight trunks and were branched 3 to 4 times with bifurcated tips, with a length of 5 to 23 μm. Typically, one branch of each pair curved inward and one reflexed. Sporangiophores ended with sporangia that were round or slightly ovoid, colorless to yellowish-brown, and 14 to 22 × 11 to 18 μm. The causal agent was morphologically identified as Peronospora sparsa Berk (1,2). The identification was confirmed using a molecular method directly from plant tissue. DNA was extracted from two samples (~3 × 3 mm) from each of three symptomatic leaves, followed by PCR amplification using P. sparsa-specific rDNA-ITS region primers P1: 5'-CACGTGAACCGTATCAACC-3' and P2: 5'-GATAGGGCTTGCCCAGTAG-3' (GenBank Accession No. Y15816) (4). DNA amplification was successful, resulting in a product of 94 bp, confirming that P. sparsa was present in the symptomatic blackberry tissue. Sporulating leaf tissue was laid on the underside of surface sterilized blackberry leaves from three plants with a similar genetic background and incubated at 17°C with a 12-h photoperiod in a moist chamber. Sporangiophores and sporangia developed on the underside of lesions on previously uninfected leaves 16 days after inoculation. As a control, leaves from the same three plants were surface sterilized and placed in a moist chamber and incubated at 17°C with a 12-h photoperiod and examined 16 days later. No lesions or sporulation developed on the controls. Previously, P. sparsa has been reported on blackberry in California (3) and Mexico (5). To our knowledge, this is the first report of P. sparsa causing downy mildew on blackberry in Arkansas.

First Report of Curtobacterium flaccumfaciens pv. flaccumfaciens Causing Cowpea Bacterial Wilt in Iran

AbstractDuring surveys in cowpea fields of Marand County, East Azerbaijan province, Iran, in the summer of 2013, a suspected bacterial disease was observed on cowpea leaves as tan spots and interveinal necrotic lesions surrounded by chlorotic margins. The disease was of high incidence where some fields had been fully destroyed and severity of the disease in some fields had reached up to 70%. Gram‐positive, yellow‐pigmented, coryneform bacteria were isolated from infected leaves. Pathogenicity of isolates was confirmed on 20‐day‐old cowpea (cv. Khoy) plants, and they were identified as Curtobacterium flaccumfaciens pv. flaccumfaciens based on biochemical test results confirmed using specific PCR primers. This is the first report of C. flaccumfaciens pv. flaccumfaciens, the causal agent of cowpea bacterial wilt in Iran.

First Report of Leaf Necrosis on Microstegium vimineum Caused by Bipolaris microstegii in Maryland.

Japanese stiltgrass (JSG, Microstegium vimineum) is an invasive weed causing significant ecological changes in the United States. Severely diseased plants in a shaded location 2 × 4 m in size were discovered in August 2012 at a residence on Indian Springs Rd., Frederick, MD (39.46747° N, 77.46106° W). JSG in larger monoculture stands at sunny locations within 6 to 10 m of diseased plants had a few, small, necrotic spots. Diseased plants had leaves with brown, often large, elliptical, necrotic spots up to 0.5 × 1.5 cm. Lesions were surrounded by a diffuse chlorotic margin, and larger lesions had tan centers. Diseased plants were smaller in stature than neighboring, non-symptomatic plants. Symptoms were similar to those on JSG reported by Kleczewski and Flory (2). Field samples of diseased leaves in moist chambers at room temperature and lighting produced dematiaceous conidiophores and conidia typical of Bipolaris within 2 days. Subcultures of the isolate (FDWSRU 12-049) were made from the conidia. Cultures growing on modified potato carrot agar (broth from 140 g each of potatoes and carrots and 20 g agar in 1 L water), were gray, velutinous or tomentose, and had clumps of short aerial hyphae on the upper surface. Healthy plants were grown in potting soil from seeds collected at the disease site. A minimum of five 4-week-old plants were spray-inoculated in each of three replications by conidia from detached leaves in a suspension of 105 spores/ml, given a 16-h dew period at 25°C, and placed in a 25°C greenhouse for observation. Non-inoculated plants were included for comparison. Brown or dark tan necrotic, irregular, often linear, spots with entire margins developed on all inoculated individual plants and not on control plants. The Bipolaris species was recovered from inoculated plant samples incubated in moist chambers, thus fulfilling Koch's postulates. Conidia were produced sympodially on dematiaceous conidiophores, often in clusters of two to three spores at the terminus, were medium to dark brown, straight or slightly curved, nearly fusiform with obtuse apices, and typically had 8 to 10 distoseptate cells that were 74.8 ± 2.3 × 16.4 ± 0.3 μm, and Q = 4.6 ± 0.1 (mean ± ci, P = 0.05; n = 100). A sequence of the ITS1-5.8S-ITS2 region of DNA, extracted using a DNeasy Plant Mini Kit (QIAGEN), was 100% identical to that of the type specimen of B. microstegii from M. vimineum (BPI 883727; GenBank Accession No. JX089579), using BLAST. On the basis of fungal morphology and molecular characteristics (1), along with symptomatology and published information (2), the causal agent of this disease has been determined to be B. microstegii. Dried specimens of both the isolate and diseased leaves were deposited in the U.S. National Fungus Collections (BPI 892680) and sequence information was submitted to GenBank (KF150215). Bipolaris leaf spot was also found on JSG in Howard and Prince Georges counties, MD, in 2009, but the causal agents were not formally characterized (K. Rane, Univ. Maryland; personal communication). This is the first confirmed identification of B. microstegii on JSG in Maryland, a plant that occurs as extensive monocultures in natural areas. These results provide a basis for characterization of this disease in the mid-Atlantic region.

First Report of Anthracnose Stalk Rot of Maize Caused by Colletotrichum graminicola in Switzerland.

Maize stem samples exhibiting symptoms of anthracnose were collected from a field near Zurich, Switzerland, in September of 2012 and were sent to the fungal genetics laboratory, Centro Hispano-Luso de Investigaciones Agrarias (CIALE) at the University of Salamanca, Spain, for further analysis. The stem samples exhibited glossy, black, and irregularly shaped lesions. Tissue samples, approximately 5 mm2, were dissected from below the epidermis. The tissue samples were surface disinfested for 1 min in 20% sodium hypochlorite and cultured on one half strength acidified PDA supplemented with ampicillin (2). Monoconidial isolates from three different stems were grown on potato dextrose agar (PDA) and had dark gray aerial mycelium with orange spore masses. Conidia were falcate, slightly curved, tapered toward the tips with an average length of 31.77 μm and an average width of 4.76 μm and produced in acervuli with setae, consistent with descriptions of C. graminicola Ces. Wils. Conidial suspensions were prepared for each isolate, and were inoculated onto the leaves of 2-week-old maize plants by laying the plants horizontally in a tray (in pots with their root systems intact) and placing 7.5-μl droplets of a 106 conidial suspension on the leaf surface. The trays were covered and plants were incubated overnight at 23°C. The plants were then returned to their upright position and grown in a growth chamber at 25°C with a 12-h light cycle (3). After 6 days, the inoculated plant leaves exhibited lesions that were elongated and irregularly shaped with necrotic centers and chlorotic margins. The water-inoculated controls did not show symptoms. Microscopic examination revealed the production of conidia on the surface of the leaves, identical to the original isolates. Genomic DNA was extracted using the protocol of Baek and Kenerley (1). A region of the ribosomal DNA repeat was amplified and sequenced using the universal primers ITS4 and ITS5. The resulting sequences were 100% identical to each other and 100% identical to C. graminicola sequences in GenBank. One representative sequence was deposited in GenBank under accession no. KF597538. The 100 most similar sequences in GenBank were used to construct a phylogenetic tree using the neighbor-joining method. The phylogenetic analysis revealed that the isolates clustered within the C. graminicola clade, consistent with their identification as C. graminicola. To our knowledge, this is the first report of anthracnose on maize caused by C. graminicola in Switzerland. Previous reports have demonstrated that the pathogen exists in neighboring countries Germany and France.

First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5'CCGACATTGCCGTCAGCGATCACG3' and rv-5'AGCGTTCTTGGGTGTGTTGAGCATTTG3' (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan.

Characterization and distribution of tomato yellow margin leaf curl virus, a begomovirus from Venezuela

A begomovirus causing mottling and leaf deformation in tomato from the State of Mérida was cloned and sequenced. The virus has a bipartite genome comprised of a DNA-A (2,572 nucleotides) and a DNA-B (2,543 nucleotides) with a genome organization typical of New World begomoviruses. Both components share a common region of 115 nucleotides with 98% sequence identity. Phylogenetic analysis indicated that while no virus sequences were closely related, the A component was distantly related to those of two other tomato-infecting viruses, tomato leaf deformation virus and Merremia mosaic virus; and the DNA-B, to those of pepper huasteco yellow vein virus and Rhynchosia golden mosaic Yucatan virus. The DNA-A and DNA-B sequences were submitted to GenBank (accession no. AY508993 and AY508994, respectively) and later accepted by the International Committee on Taxonomy of Viruses as the genome of a member of a unique virus species with the name Tomato yellow margin leaf curl virus (TYMLCV). Tomato (Solanum lycopersicum L. 'Fl. Lanai') plants inoculated with cloned TYMLCV DNA-A and DNA-B became systemically infected and showed chlorotic margins and leaf curling. The distribution of TYMLCV in tomato-producing states in Venezuela was determined by nucleic acid spot hybridization analysis of 334 tomato leaf samples collected from ten states using a TYMLCV-specific probe and confirmed by PCR and sequencing of the PCR fragment. TYMLCV was detected in samples from the states of Aragua, Guárico, and Mérida, suggesting that TYMLCV is widely distributed in Venezuela.

First report of a new pathogenic variant of Cercospora canescens on mungbean (Vigna radiata) from India

Figure 4 Atypical symptoms were observed on the recently released mungbean (Vigna radiata)cv. Meha that were attributed to the pathogen Cercospora canescens during the sampling of Cercospora leaf spot disease. The disease severity caused by the putative new strain of C. canescens (isolate NFCCI-2370) varied from 60 to 80% at the farm of the Indian Institute of Pulses Research Kanpur, India. Similar atypical symptoms were also observed at neighbouring research stations where seed multiplication of cv. Meha is performed. Yield losses from the new strain varied from 50-70% at these sites that was significantly higher than with the previously identified typical strain. Symptoms of the new strain were dry necrotic, grey irregular sporulating spots without chlorotic margins. The pathogen was isolated from infected leaves using the method of Goode & Brown (1970) and purified by single spore isolation in the laboratory. Isolates of the pathogen were confirmed as C. canescens by productionofcercosporin (Daub, 1982) and typical conidia and conidiophores (Ellis & Martin, 1882). Inoculation on to plants of cvs. Meha, Kopergaon and Malvia Joyoti with a monoconidial culture of the new strain produced the atypical symptoms described (Fig. 1a), whereas inoculation with the typical C. canescens isolates (MTCC-10835) produced several small, angular, necrotic water-soaked grey sporulating lesions surrounded by chlorotic margins (Fig. 1b). A morphological comparison of the new strain (NFCCI-2370) with the typical strain (MTCC-10835) was done using mycelium from infected leaves. The new strain was distinguished from the typical strain by 1-2 scars on the conidiophores, whereas the number of scars was 2-7 in the typical strain. The conidiophores (90.09 µm x 9.64 µm) and conidia (128.94 µm x 5.49 µm) were also shorter in the new strain (Table 1). The new strain bears a single conidium at the tip of conidiophores with a prominent scar (Fig. 2). The radial growth, colony morphology and pigment production of the new strain (NFCCI-2370) on PDA at 25°C (Ferrater et al., 2004) was faster, i.e. 3.82 mm/day and colony colour was creamy without production of cercosporin or spores (Fig. 3). The identity of the new strain (NFCCI-2370) together with the other isolate (MTCC-10835) was further confirmed by comparison of ITS (Internal Transcribed Spacer) sequence data with reference isolates. BLASTn analysis of the sequence obtained showed 98-99% homology with reference isolatesof C. canescens. The ITS region of rDNA was amplified with primers ITS1/ ITS4 and sequences of these isolates have been deposited in GenBank (Accession Nos. JF747032 and JF747033). Isolate NFCCI-2370 has been deposited with the National Facility for Indian Culture Collection, Agharakar Research Institute, Pune, India.

Bacterial Leaf Spot Caused by the Quarantine Pathogen Xanthomonas arboricola pv. pruni on Cherry Laurel in Central Italy.

In June 2010, 1-year-old potted plants of cherry laurel (Prunus laurocerasus L.) cv. Novita showing leaf spot symptoms were collected in a commercial nursery in the district of Pistoia (Tuscany, central Italy). Red-purple necrotic lesions (measuring a few millimeters up to 1 cm) surrounded by a brilliant light green halo were observed on the abaxial surface of symptomatic leaves. With age, the necrotic areas drop out, leaving a "shot-hole" appearance. Microscopic observation revealed the absence of fungal structures, whereas bacteria were isolated from symptomatic tissue on nutrient sucrose agar medium. Purified single colonies appeared mucoid, convex, and yellow on yeast extract-dextrose-CaCO3 agar (YDCA) medium, were positive to the KOH test, and induced hypersensitive responses on tobacco (cv. Virginia Bright). Three isolates were selected arbitrarily for further analysis. A fragment of approximately 500 bp of the 16S rRNA gene was amplified via PCR with the universal primer pair 27f/519r and sequenced. Subsequent database searches in the INSD (GenBank, EMBL, and DDBJ) indicated that the resulting sequences had 100% identity over 490 bp with the corresponding gene of a Xanthomonas sp. The isolates were further identified as Xanthomonas arboricola pv. pruni on the basis of quinate metabolism and starch hydrolysis tests and by sequencing the PCR products obtained with the gyrB (4) and X. arboricola pv. pruni-specific (3) primer sets. Pathogenicity tests were conducted on cvs. Novita and Caucasica following the detached leaf bioassay procedure (1) and by injecting with a hypodermic needle a bacterial suspension (1 × 107 CFU/ml) in the leaf mesophyll of 1-year-old potted plants (three plants per cultivar and three leaves per isolate on each plant). Incubation was carried out at 25°C under fluorescent lights with a 16-h photoperiod. After seven (detached leaves) and four (potted plants) days, all leaves inoculated with X. arboricola pv. pruni isolates showed brown necrotic spots delimited by a chlorotic margin. Reisolated bacteria on YDCA showed the same colony morphology as described above and tested positive to the X. arboricola pv. pruni-specific primer set, confirming the causal agent of the disease. Leaf tissue inoculated with sterile distilled water remained symptomless. Bacterial leaf spot on cherry laurel was reported in Lombardy (northern Italy) by the local plant protection service in 2005 but without a confirmatory diagnosis of the causal agent (2). To our knowledge, this is the first confirmed report on the occurrence of X. arboricola pv. pruni on cherry laurel in Italy. The pathogen could have a significant impact on the commercial cherry laurel production in the district of Pistoia, which is the most important area for ornamental plants nurseries (4,536 ha of cultivated surface in 2005) in Italy. X. arboricola pv. pruni is included in the EPPO A2 list of pests recommended for regulation to the member countries.

First Report of Leaf Spot of Dracaena reflexa Caused by Burkholderia gladioli Worldwide.

In December 2008 (austral summer), a new disease of Dracaena reflexa Lam. cv. Anita was observed in a postentry quarantine greenhouse near Auckland, New Zealand on plants imported from Costa Rica. Symptoms included rust-colored, water-soaked lesions with chlorotic margins approximately 5 by 10 mm. When the disease was first noticed, incidence approached 80%, but subsequent reduction in greenhouse temperature dramatically reduced symptom expression and lesions were only visible on some leaf tips. Bacteria consistently isolated from the lesions on King's medium B (KB) were cream-colored, shiny, and produced a yellow, diffusible, nonfluorescent pigment. All isolates were able to rot onion slices. On the basis of BIOLOG (Hayward, CA) carbon utilization profiles, isolates were initially identified as Burkholderia gladioli (Severini 1913) Yabuuchi et al. 1993 with a probability index of 100% and a similarity index of 0.85. For molecular identification, a near full-length sequence of the 16S rDNA gene was amplified from all isolates using primers fD2 and rP1 (1), obtaining a PCR product of approximately 1,500 bp. The nucleotide sequences were 100% identical to a number of B. gladioli GenBank entries, including Accession Nos. EF193645 and EF088209. To confirm pathogenicity, three isolates (two isolated prior to greenhouse temperature reduction and one after) were used. Three D. reflexa plants were inoculated per bacterial isolate by wounding three young fully expanded leaves on each plant (four wounds per leaf) and spraying the leaves with a bacterial suspension in sterile distilled water at 108 CFU/ml. At the same time, Gladiolus nanus plants were inoculated in a similar manner. Control plants (D. reflexa and G. nanus) were wounded and sprayed with sterile distilled water. All inoculated plants were covered with plastic bags to maintain humidity and placed in a growth chamber at 25°C. At 3 days, all inoculated plants began to show water soaking and reddish coloration around the inoculation sites, and by 7 days, the lesions had expanded to resemble natural infection. Bacteria isolated on KB from the leading edge of each lesion were morphologically identical to the initial isolates. No bacteria were recovered from the wound sites on the control plants. The 16S rDNA sequences of selected isolates from inoculated plants showed 100% identity to the sequences of the initial isolates, thereby fulfilling Koch's postulates. To our knowledge, this is the first report of B. gladioli causing leaf spot of D. reflexa in the world. Reference: (1) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Occurrence of Banana Bunchy Top Disease Caused by the Banana bunchy top virus on Banana and Plantain (Musa sp.) in Cameroon.

Banana bunchy top virus (BBTV; genus Babuvirus, family Nanoviridae) is a serious pathogen of banana (AAA genome) and plantain (AAB genome) (Musa sp.). It is transmitted by the banana aphid (Pentalonia nigronervosa) in a persistent manner (1). In recent years, BBTV has emerged as a major constraint to banana and plantain production in several countries of Africa and had been previously confirmed in viz., Burundi, Central African Republic, Republic of Congo, Democratic Republic of Congo, Egypt, Equatorial Guinea, Gabon, Malawi, and Rwanda (1) and more recently in Mozambique and Zambia (2) and Angola (3). To assess the potential threat of BBTV in West-Central Africa, we conducted surveys in August and September 2008 in 36 major banana- and plantain-producing regions of Littoral, South, Southwest, and Western Provinces of Cameroon. DNA was extracted from 520 plants and tested by PCR with primers specific for a conserved domain of BBTV DNA-R segment (4). A 240-bp DNA fragment specific to the virus was amplified in 31 samples from 18 plantain and 13 banana plants from Southwest, Western, and Southern Cameroon. Among virus-positive samples, symptoms (upright leaf growth, small leaves with pale chlorotic margins that choked the throat of the plant creating the bunchy appearance at the top) typical of bunchy top disease were observed only in banana (cv. Cavendish Williams) from Muea in the Southwest Province. PCR products obtained from the symptomatic and asymptomatic banana (Cavendish Williams) from Muea and Abang, respectively, were cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and two independent clones from each isolate were sequenced in both directions. Pairwise comparison of these sequences showed 100% sequence homology. A comparison of these sequences (Accession No. F580970) with corresponding sequences in GenBank showed 99% nt sequence identity with a BBTV isolate from Angola (Accession No. EU851977) and 96 to 98% identity with BBTV isolates belonging to the South Pacific group (Australia, Africa, South Asia, and South Pacific). However, the BBTV isolate from Cameroon showed 85 to 90% sequence identity with isolates belonging to the Asian group (China, Indonesia, Japan, Taiwan, Philippines, and Vietnam). To further confirm the virus identity, complete nucleotide sequence of the DNA-SCP segment that encodes for the virus coat protein was determined using PCR amplification of viral DNA (1), cloning of products into pCR2.1 vector, and sequencing. The derived sequence (1,075 nt; Accession No. GQ249344) in BLAST search at NCBI database revealed 98% nt sequence identity with coat protein gene of BBTV isolate from Burundi (Accession No. AF148943). These results, together with phylogenetic analysis, indicate that BBTV isolates from Cameroon have greater affinity to the South Pacific group. To our knowledge, this is the first report of BBTV in West-Central Africa. The occurrence of BBTV in the Western and Southern provinces of Cameroon, neighboring north of Gabon, suggests a possible spread of the virus from Gabon. This report also underscores the need to monitor other countries of West Africa for BBTV and enforce quarantine measures to prevent further spread through infected suckers from endemic areas of West and Central Africa.

Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico.