Chinese Yellow Cattle Research Articles

Combined Transcriptome and Metabolome Analysis of Smooth Muscle of Myostatin Knockout Cattle.

Myostatin (MSTN), a growth and differentiation factor, plays an important role in regulating skeletal muscle growth and development. MSTN knockout (MSTN-KO) leads to skeletal muscle hypertrophy and regulates metabolic homeostasis. Moreover, MSTN is also detected in smooth muscle. However, the effect of MSTN-KO on smooth muscle has not yet been reported. In this study, combined metabolome and transcriptome analyses were performed to investigate the metabolic and transcriptional profiling in esophageal smooth muscles of MSTN-KO Chinese Luxi Yellow cattle (n = 5, 24 months, average body weight 608.5 ± 17.62 kg) and wild-type (WT) Chinese Luxi Yellow cattle (n = 5, 24 months, average body weight 528.25 ± 11.03 kg). The transcriptome was sequenced using the Illumina Novaseq™ 6000 sequence platform. In total, 337 significantly up- and 129 significantly down-regulated genes were detected in the MSTN-KO cattle compared with the WT Chinese Luxi Yellow cattle. Functional enrichment analysis indicated that the DEGs were mainly enriched in 67 signaling pathways, including cell adhesion molecules, tight junction, and the cGMP-PKG signaling pathway. Metabolomics analysis by liquid chromatography-tandem mass spectrometry (LC-MS/MS) identified 130 differential metabolites between the groups, with 56 up-regulated and 74 down-regulated in MSTN knockout cattle compared with WT cattle. Differential metabolites were significantly enriched in 31 pathways, including glycerophospholipid metabolism, histidine metabolism, glutathione metabolism, and purine metabolism. Transcriptome and metabolome were combined to analyze the significant enrichment pathways, and there were three metabolically related pathways, including histidine metabolism, purine metabolism, and arginine and proline metabolism. These results provide important references for in-depth research on the effect of MSTN knockout on smooth muscle.

Comparison of meat nutritions and flavor between Chinese Yanbian yellow cattle and Simmental cattle

This research explored the difference between Chinese Yanbian yellow Beef and Simmental Beef in nutrients, meat quality and flavor, aimed at providing a basis for the development of Chinese Yanbian yellow cattle resources. Eight Chinese Yanbian yellow cattle and eight Simmental cattle were selected in this experiment. All the experimental cattle were fenced to 30 months of age under the same feeding conditions and slaughtered to determine the quality and flavor substance content of beef. The results showed that the contents of crude protein, ether extract and various amino acids in Chinese Yanbian yellow beef were significantly higher than those in Simmental beef (P<0.05). The shear force of Chinese Yanbian yellow beef was significantly lower than that of Simmental beef (P<0.05). The results of Gas chromatography. mass spectrometry (GC-MS) also showed that the kinds of flavor substances in Chinese Yanbian yellow beef were more than those in Simmental beef. In conclusion, the nutritional level and flavor of Chinese Yanbian yellow beef are better than those of Simmental beef. In conclusion, the nutritional level and flavor of Chinese Yanbian yellow beef are better than those of Simmental beef.

Characterization of Volatile Profiles and Correlated Contributing Compounds in Pan-Fried Steaks from Different Chinese Yellow Cattle Breeds through GC-Q-Orbitrap, E-Nose, and Sensory Evaluation.

This study focused on characterizing the volatile profiles and contributing compounds in pan-fried steaks from different Chinese yellow cattle breeds. The volatile organic compounds (VOCs) of six Chinese yellow cattle breeds (bohai, jiaxian, yiling, wenshan, xinjiang, and pingliang) were analyzed by GC-Q-Orbitrap spectrometry and electronic nose (E-nose). Multivariate statistical analysis was performed to identify the differences in VOCs profiles among breeds. The relationship between odor-active volatiles and sensory evaluation was analyzed by partial least square regression (PLSR) to identify contributing volatiles in pan-fried steaks of Chinese yellow cattle. The results showed that samples were divided into two groups, and 18 VOCs were selected as potential markers for the differentiation of the two groups by GC-Q-Orbitrap combined multivariate statistical analysis. YL and WS were in one group comprising mainly aliphatic compounds, while the rest were in the other group with more cyclic compounds. Steaks from different breeds were better differentiated by GC-Q-Orbitrap in combination with chemometrics than by E-nose. Six highly predictive compounds were selected, including 3-methyl-butanal, benzeneacetaldehyde, 2-ethyl-6-methyl-pyrazine, 2-acetylpyrrole, 2-acetylthiazole, and 2-acetyl-2-thiazoline. Sensory recombination difference and preference testing revealed that the addition of highly predictive compounds induced a perceptible difference to panelists. This study provides valuable data to characterize and discriminate the flavor profiles in pan-fried steaks of Chinese yellow cattle.

Effects of Different Dietary Carbohydrate Sources on the Meat Quality and Flavor Substances of Xiangxi Yellow Cattle.

This study investigated the dietary supplementation of starches with different carbohydrate sources on the proximate composition, meat quality, flavor substances, and volatile flavor substances in the meat of Chinese Xiangxi yellow cattle. A total of 21 Chinese Xiangxi yellow steers (20 ± 0.5 months, 310 kg ± 5.85 kg) were randomly divided into three groups (control, corn, and barley groups), with seven steers per group. The control steers received a conventional diet (coarse forage type: whole silage corn at the end of the dough stage as the main source), the corn group received a diet with corn as the main carbohydrate source, and the barley group received a diet with barley as the main carbohydrate source. The experiment lasted for 300 d. and the means of the final weights in the control, corn, and barley groups were 290 kg, 359 kg, and 345 kg. The diets were isonitrogenous. The corn and barley groups reduced the moisture (p = 0.04) and improved the intramuscular fat content of the meat (p = 0.002). They also improved meat color (a*) (p = 0.01) and reduced cooking loss (p = 0.08), shear force (p = 0.002), and water loss (p = 0.001). There was no significant difference in the 5'-nucleotide content (p > 0.05), the equivalent umami concentration (EUC) (p = 0.88), and taste activity value (TAV) (p > 0.05) among the three groups. The 5'-IMP (umami) content was the highest in the 5'-nucleotide and its TAV > 1. The corn and barley groups improved the content of tasty amino acids (tAA, p < 0.001). The corn group had a higher content of sweet amino acids (SAA, p < 0.001) and total amino acids (TAA, p = 0.003). Corn and barley improved the levels of MUFA (p < 0.001), PUFA (p = 0.002), n-3 PUFA (p = 0.005), and n-6 PUFA (p = 0.020). The levels of alcohols, hydrocarbons, and aldehydes in the corn group were higher than in the barley and control groups (p < 0.001). The esters content in the corn group was higher than in the barley and control groups (p = 0.050). In conclusion, feeding corn or barley as a carbohydrate source can improve the nutrient content and taste. Feeding corn as a carbohydrate source can improve the content of free amino acids (Cys, Glu, Gly, Thr, Leu, Trp, Gln, Asn, and Asp), fatty acids (saturated fatty acid, monounsaturated fatty acid, polyunsaturated fatty acid, n-3PUFA, n-6PUFA, and total fatty acid), and volatile flavor substances (alcohols, aldehydes, acids, and hydrocarbons) to improve the flavor and meat quality.

Growth Traits and Sperm Proteomics Analyses of Myostatin Gene-Edited Chinese Yellow Cattle.

Chinese Yellow Cattle, an ancient and domesticated breed for draft service, provide unique animal genetic resources with excellent genetic features, including crude feed tolerance, good stress resistance, strong adaptability, and tender meat quality; however, their production performance and meat yield are significantly inferior. Herein, the myostatin gene (MSTN), a negative regulator of skeletal muscle development, was knocked out by CRISPR/Cas9 technology. Eight MSTN gene-edited bull calves (MT) were born, and six of them are well-developed. Compared with the control cattle (WT), the growth trait indexes of MT cattle were generally increased, and the hindquarters especially were significantly improved. The biochemical indexes and the semen characteristics demonstrated that MT bulls were healthy and fertile. Consistent with our conjecture, the wobble and beating of MT bull spermatozoa were significantly higher than that of WT. Nine sperm motility-related proteins and nineteen mitochondrial-related proteins were identified by up-regulation in MT bull spermatozoa using FLQ proteomic technique and act to govern sperm flagellum assembly, organization, and beating and provide sufficient energy for sperm motility. The current study confirmed that the MSTN gene-edited Chinese Yellow cattle have improved growth traits and normal fertility, which can be used for beef cattle production and breeding.

Consumer Sensory Evaluation and Quality Prediction Model Construction for 9 Kinds of Chinese Yellow Cattle Snowflake Beef

Consumer Sensory Evaluation and Quality Prediction Model Construction for 9 Kinds of Chinese Yellow Cattle Snowflake Beef

Chinese Yellow Cattle Breeds

This datasheet on Chinese Yellow Cattle Breeds covers Identity, Overview, Further Information.

Genomic diversity and breed composition of Vietnamese smallholder dairy cows

AbstractVietnamese smallholder dairy cows (VDC) are the result of crossbreeding between different zebu (ZEB) and taurine dairy breeds through many undefined generations. Thus, the predominant breed composition of VDC is currently unknown. This study aimed to evaluate the level of genetic diversity and breed composition of VDC. The SNP data of 344 animals from 32 farms located across four dairy regions of Vietnam were collected and merged with genomic reference data, which included three ZEB breeds: Red Sindhi, Sahiwal and Brahman, three taurine breeds: Holstein (HOL), Jersey (JER) and Brown Swiss (BSW), and a composite breed: Chinese Yellow cattle. Diversity and admixture analyses were applied to the merged data set. The VDC were not excessively inbred, as indicated by very low inbreeding coefficients (Wright's FIS ranged from −0.017 to 0.003). The genetic fractions in the test herds suggested that the VDC are primarily composed of HOL (85.0%); however, JER (6.0%), BSW 5.3%) and ZEB (4.5%) had also contributed. Furthermore, major genotype groupings in the test herds were pure HOL (48%), B3:15/16HOL_1/16ZEB (22%) and B2:7/8HOL_1/8ZEB (12%). The genetic makeup of the VDC is mainly components of various dairy breeds but also has a small percentage of ZEB; thus, the VDC could be a good genetic base for selecting high milk‐producing cows with some degree of adaptation to tropical conditions.

Genetic effects of MOGAT1 gene SNP in growth traits of Chinese cattle.

Single nucleotide polymorphism (SNP) has recently become one of the ideal genetic markers. SNP refers to the DNA sequence polymorphism caused by double nucleotide variation in the genome, including the conversion or transversion of segmented bases. The synthesis and metabolism of triglycerides are related to the changes of energy in the body of livestock, which in turn affects their growth and development. Studies have shown that MOGAT1 gene plays a role in the route of triglyceride synthesis. PCR-RFLP and agarose gel electrophoresis technology were used to type the SNP site of MOGAT1 gene at g.25940T>C in this study. Association analysis between typing results and growth trait data was detected by SPSS 20.0 software. Results show that MOGAT1 gene was in a low level of heterozygosity in Xianan, Qinchuan and Pinan cattle population (0<PIC<0.25), and in middle level of heterozygosity in YL cattle population(0.25<PIC<0.5). And genotype 'AA' was dominant gene in Chinese cattle population. In QC and XN cattle, genotype of GG possess advantage on Body weight (P<0.05); in YL cattle, individuals with genotype of homozygous mutation decreased significantly on Chest depth (P<0.05). The purpose of this research is to provide theoretical materials for molecular breeding of yellow cattle and to promote the process of improving the growth traits of Chinese local yellow cattle.

The combination between NCSTN gene copy number variation and growth traits in Chinese cattle

Copy number variation (CNV) has been used as an important source of phenotypic and genetic diversity in recent years. Nicastrin (NCSTN) gene is usually attached to human diseases such as Alzheimer’s disease, and Acne inversa. However, there are no essays about the NCSTN gene combining with cattle breeds. In our study, we discovered different distributions of NCSTN gene copy number and associated it with phenotypic traits in four Chinese yellow cattle breeds (XN, PN, QC and YL). The result turned out that the CNV of the NCSTN gene was associated with several growth traits, such as cannon circumference, chest girth and rump length (p < 0.05). In general, we revealed the eminence over CNV of NCSTN gene and economic traits, suggesting that the CNV of the NCSTN gene can be considered to be a promising molecular breeding marker of Chinese beef cattle.

The Association of the Copy Number Variation of the MLLT10 Gene with Growth Traits of Chinese Cattle.

Simple SummaryCopy number variation is a common genetic polymorphism, mainly represented by submicroscopic levels of deletion and duplication, caused by rearrangement of the genome. It is well-known that the copy number variation of a gene is associated with growth traits of livestock. In this study, we detected the correlation between the copy number variation of the the MLLT10 gene and the growth traits of Chinese yellow cattle. We found that the copy number variation of the MLLT10 gene has a significant influence on hip width, rump length, hucklebone width, and cannon bone circumference of some Chinese yellow cattle breeds. The results provide preliminary suggestions for Chinese yellow cattle breeding and new insights about the future of copy number variation (CNV) as a new promising molecular marker in animal breeding.Copy number variation is a part of genomic structural variation and has caused widespread concern. According to the results of high-throughput screening of the MLLT10 gene, we found that the copy number variation region of the MLLT10 gene was correlated with bovine growth traits. We aimed to detect the MLLT10 gene copy number variation and provide materials for the Chinese yellow cattle breed. In this study, the SPSS software was used to analyze the correlation among the copy number type of six different cattle breeds (i.e., Qinchuan, Xianan, Jiaxian, Yanbian, Sinan, Yunling) and the corresponding growth traits. The results showed the following: In Qinchuan cattle, the copy number duplication type was greater than the deletion and normal types; in Xianan cattle, the copy number duplication and normal types were less as compared with the deletion type; and in Yunling cattle, the frequency of the duplication type was dominant among the three types of copy number variants. The correlation analysis result showed that there is a significant correlation between the copy number variation (CNV) of the MLLT10 gene and the growth traits of three cattle breeds. Furthermore, correlation analysis showed that MLLT10 CNV had positive effects on growth traits such as hip width, rump length, hucklebone width, and cannon bone circumference (p < 0.05). This study provides a basis for the molecular-assisted marker breeding of cattle and contributes to the breeding of cattle.

The effect of facial hair whorl position and raising environment on the temperament of the Chinese Yellow cattle in Shinjang Uyghur Aptonom Rayoni, China.

Objective:The objective of this study is to determine whether there is a relationship between hair whorl position and temperament in Chinese Yellow cattle using a questionnaire. Also, the effect of the raising environment is investigated.Materials and methods:A total of 122 Chinese Yellow cattle were surveyed in 3 village areas and four grassland areas in the northern area of China. For each cattle, an investigator asked the care-person about each item of a temperament questionnaire and determined the facial hair whorl position of each cattle. The location of hair whorl was categorized as low, middle, or high in relation to the eyes.Results:The overall distribution was 20.5% high, 58.2% middle, 13.1% low, 6.6% double, and 1.6% no hair whorl. There was no significant difference between the grassland and village area cattle in the distribution of whorl position. The scores of grassland areas were significantly higher than those of village areas in terms of “Retentive memory”, “Sensitivity,” and “Timidity” and lower in “Docility” and “Fortitude.” The scores for the high position tended to be higher than those for the middle plus low positions in terms of “Adaptability” and “Obedience.” On the other hand, there was a tendency for a score for the high position to be lower than the other positions in “Excitability.” A significant interaction between area and whorl position was observed in “Friendliness to cattle.”Conclusion:These findings suggest that hair whorl location may be useful in predicting the temperament in cattle, but temperament can be influenced by environment and/or handlings.

Comparative transcriptomics to reveal muscle-specific molecular differences in the early postmortem of Chinese Jinjiang yellow cattle

Differences in the expression of functional genes between beef Longissimus Lumborum (LL) and Psoas Major (PM) are not well understood. The aim of present study is to reveal transcriptome changes of beef LL and PM during early postmortem by high-throughput Illumina Hiseq4000 Sequencing. Hierarchical clustering analysis indicated significant differences in transcriptome profiles between LL and PM as well as 1 h and 12 h postmortem. A total of 65 genes differentially expressed between LL and PM (fold change ≥3, and p < 0.05; 34 were up-regulated in LL and 31 in PM), and the majority of them (53 genes) occurred at 12 h postmortem. These differentially expressed genes mainly involved in energy production and conversion, nucleotide metabolic, posttranslational modification, and transcription. KEGG analysis revealed that oxidative phosphorylation was one of the important pathways. This study gave new perspectives to understand the underlying mechanisms associated with muscle-specific beef quality.

Copy number variation of bovine SHH gene is associated with body conformation traits in Chinese beef cattle.

Sonic Hedgehog (Shh) regulates many key developmental processes during vertebrate limb development, fat formation, and skeletal tissue regeneration. Current whole genome sequencing data have identified a copy number variation mapping to bovine Sonic Hedgehog gene (SHH-CNV). The object of this study was to characterize the SHH-CNV distributions in 648 individuals from 11 Chinese cattle populations and further to investigate the associations of the copy number changes with gene expression and cattle growth traits. The SHH-CNV showed a high variance within Chinese indigenous yellow cattle. Compared to yak and dairy cattle, the beef cattle like Luxi and Xianan breed had significantly higher median copy numbers, suggesting the diversity of SHH-CNV in beef cattle selections. The negative correlation of SHH-CNV with SHH transcriptional level in adult adipose tissue (P < 0.01) indicated the dosage effects of SHH-CNV related to bovine fat formation. Association analysis of SHH-CNV and body size traits was conducted in five breeds. The results revealed that the copy number gain type of SHH-CNV exhibited significantly better chest depth in 24months old Qinchuan cattle, and better body weight, body length, and chest girth in 18months old Nanyang cattle, whereas the normal copy number had superior chest girth and body weight in adult Jinnan cattle (P < 0.05 or P < 0.01). In summary, this research uncovered meaningful effects of SHH-CNV on gene expression and cattle phenotypic traits, indicating its potential applications for genetic improvement of beef cattle.

Determination of genetic effects of SERPINA3 on important growth traits in beef cattle

Serine protease inhibitor protein 3 (serpin peptidase inhibitor, clade A, member 3, SERPINA3) is a member of the serpin superfamily, probably related to the yield and quality of muscle. This study focuses on the relationship between SERPINA3 gene polymorphism and growth traits in beef cattle. The study first uses sequencing pooled DNA samples (Pool-Seq), PCR-RFLP and Tetra-primer ARMS-PCR techniques to determine the genetic polymorphisms of SERPINA3 in 765 beef cattle. Then, the polymorphic loci were correlated with the growth characters of cattle. Five SNPs (SNP1:A-648G, SNP2:T6496A, SNP3:G2495A, SNP4:T2595A, SNP5:A2615G) were found, located in the promoter, introns 5 and SNP 3, 4, 5 were in exons 2, respectively. The observed He was from 0.44 to 0.5, Ne were approaching 2 (1.78 to 2.00). The maximum and minimum PIC (polymorphism information content) values were 0.37 and 0.34, respectively. The association analysis results showed that the SNPs had a significant height in the chest girth and body length. (p < 0.05 or p < 0.01). This will provide important information for the rapid breeding of Chinese yellow cattle and the establishment of a molecular genetic marker database.

Chinese yellow cattle PPARA gene: Analyses of expression, polymorphism and trait association

Peroxisome proliferator-activated receptor alpha (PPARA) is a member of the nuclear receptor superfamily that regulates key proteins involved in fatty acid oxidation and extracellular lipid metabolism. Given the importance of PPARA in modulating energy metabolism, PPARA may be a suitable candidate gene for assessing economic traits in cattle. In the present study, the genetic diversity of the PPARA gene in Chinese cattle breeds and its effects on growth traits in the Nanyang and Jiaxian breeds were investigated. First, the transcript profiles for PPARA were determined in eight adult cattle tissue types. Next, polymorphisms were identified in the coding and predicted promoter regions of the bovine PPARA gene in 424 animals. Finally, an association study was carried out to evaluate the relationship between PPARA and the development of cattle. Based on quantitative real-time polymerase chain reaction, PPARA was mainly expressed in the kidney and liver. Nine single nucleotide polymorphisms (SNPs) were identified in Chinese domestic cattle, including one novel SNP. Haplotype frequencies and linkage disequilibrium were also investigated. Four SNPs (g.17148558A&amp;gt;T, g.117195348A&amp;gt;G, g.117228160T&amp;gt;C, and g.117233248A&amp;gt;G) showed significant associations with growth traits in NY and JX cattle, including body weight, average daily gain, and hipbone width. These results confirmed the importance of PPARA as a candidate gene for marker-assisted selection for growth traits in cattle.

Effect of superchilled storage on shelf life and quality characteristics of M. longissimus lumborum from Chinese Yellow cattle

The effect of superchilled storage (SC, −4 °C) on shelf life and quality characteristics of M. longissimus lumborum from Chinese Yellow cattle compared with traditional chilling (TC, 2 °C) and frozen storage (−18 °C) was studied. The shelf life of beef steaks held at −4 °C extended to 12 weeks based on the total volatile basic nitrogen (TVB-N) value, which was 2.4 times longer than steaks stored at 2 °C. As the storage time increased, SC samples showed a lower increase of the total aerobic count (TAC), pH and thiobarbituric acid reactive substances (TBARS) values compared to TC samples. Further, L⁎ and a⁎ values of SC samples changed more slowly than that of TC samples. Beef steaks held frozen had a longer shelf life than SC steaks, however, the shear force of frozen steaks remained above 55 N throughout the storage time indicative of toughness. Consequently, SC offers an effective approach for maintaining better shelf life and quality of beef steaks.

Estimation of metabolisable energy and net energy of rice straw and wheat straw for beef cattle by indirect calorimetry

ABSTRACTTwo experiments were conducted to estimate the metabolisable energy (ME) and net energy (NE) of rice straw and wheat straw for beef cattle. In each experiment, 16 Wandong bulls (Chinese indigenous yellow cattle) were assigned to 4 dietary treatments in a completely randomised design. Four dietary treatments included one corn silage-concentrate basal diet and three test diets in which the basal diet was partly substituted by rice straw (Exp. 1) or wheat straw (Exp. 2) at 100, 300 and 600 g/kg. Total collection of faeces and urine was conducted for 5 consecutive days after a 2-week adaption period, followed by a 4-d period where gas exchange measurements were measured by an open-circuit respiratory cage. Linear regression equations of rice straw- or wheat straw-associated ME and NE contribution in test diets against rice straw or wheat straw substitution amount were developed to predict the ME and NE values of rice straw and wheat straw. These regression equations resulted in ME and NE values (dry matter basis) of 6.76 and 3.42 MJ/kg for rice straw and 6.43 and 3.28 MJ/kg for wheat straw, respectively. The NE and ME requirement for maintenance of Wandong cattle fed a straw-based diet were 357 and 562 kJ·kg−0.75·d−1, respectively. The regression-derived ME and NE have lower standard errors and coefficients of variation than those estimated by any single substitution ratio. Our study found that the regression method based on multiple point substitution is more reliable than the substitution method for energy evaluation of feedstuffs for beef cattle.

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

Abstract. During the past decades, insertions and deletions (indels) have become increasingly popular in animal breeding for understanding the relationship between genotypes and phenotypes. The androgen receptor (AR) plays the vital role of a bridge on the function of the androgen and has sexual size dimorphism. For this reason, the objective of this study was to explore the novel indel variants within the cattle AR gene and to detect their effects on growth traits in four breeds of Chinese yellow cattle. Herein, we first confirmed a novel 24 bp indel (AC_000187.1g.4187270-4187293delAATTTATTGGGAGATTATTGAATT) within the intron of the cattle AR gene. This is consistent with the results predicted from the NCBI SNP database. The distribution of the indel genotypes of four Chinese yellow cattle were significantly different from each other (P &lt; 0.01). After significant correlation analysis, many remarkable phenotypic differences among the three genotypes were found (P &lt; 0.05). In conclusion, a novel 24 bp indel within the AR gene significantly affected growth traits, suggesting that this indel may be a useful DNA marker for the elimination or selection of excellent individuals for cattle breeding.

Comparison among methods of effective energy evaluation of corn silage for beef cattle.

ObjectiveThis study was conducted to compare different methods on effective energy evaluation of corn silage for beef cattle.MethodsTwenty Wandong bulls (Chinese indigenous yellow cattle) with initial body weight of 281±15.6 kg, were assigned to 1 of 5 dietary treatments with 4 animals per treatment in a randomized complete block design. Five dietary treatments included group 1 with corn silage only diet, group 2 with corn silage-concentrate basal diet (BD) and 3 groups with 3 test diets, which were the BD partly substituted by corn silage at 10%, 30%, and 60%. The total collection digestion trial was conducted for 5 d for each block after a 10-d adaptation period, and then an open-circuit respiratory cage was used to measure the gas exchange of each animal in a consecutive 4-d period.ResultsThe direct method-derived metabolizable energy and net energy of corn silage were 8.86 and 5.15 MJ/kg dry matter (DM), expressed as net energy requirement for maintenance and gain were 5.28 and 2.90 MJ/kg DM, respectively; the corresponding regression method-derived estimates were 8.96, 5.34, 5.37, and 2.98 MJ/kg DM, respectively. The direct method-derived estimates were not different (p>0.05) from those obtained using the regression method. Using substitution method, the nutrient apparent digestibility and effective energy values of corn silage varied with the increased corn silage substitution ratio (p<0.05). In addition, the corn silage estimates at the substitution ratio of 30% were similar to those estimated by direct and regression methods.ConclusionIn determining the energy value of corn silage using substitution method, there was a discrepancy between different substitution ratios, and the substitution ratio of 30% was more appropriate than 10% or 60% in the current study. The regression method based on multiple point substitution was more appropriate than single point substitution on energy evaluation of feedstuffs for beef cattle.