Cherelle Wilt Research Articles

Negative effects of water deficit on cocoa tree yield are partially mitigated by irrigation and potassium application

Yields of most tropical crops are strongly reduced by drought, but this may be partially mitigated by irrigation and potassium application. Understanding the mechanisms regulating these relationships is essential to select crop varieties reaching high yield under environmental stress. We conducted a 2-year field experiment (2020–2022) to investigate the effects of seasonal irrigation, potassium application and their interaction on cocoa reproduction and yield, using six genotypes in Côte d’Ivoire. Potassium application increased pod number and size, contributing significantly to annual yield, but this effect was conditional to soil water availability. Similarly, irrigation when combined with potassium application almost doubled yield from 1.5 to 3.0 kg/tree (2000 kg ha−1 yr−1 to 4000 kg ha−1 yr−1, respectively). This yield effect was mostly the result of positive effects of irrigation on pod number per tree and, to a lesser extent, due to its positive effects on bean number per pod and bean mass. Irrigation effects on pod number were associated with an increased number of cherelles whereas the larger pod number during the major harvest compared to the minor harvest was associated with lower cherelle wilt. We also found a more than two-fold genotypic difference in yield, with the genotypes CI02 and CI03 and to a lesser extent hybrid M having lower yields having lower yields than the genotype CI01. These genotypic yield differences were associated with differences in both cherelle wilt and initial cherelle production rates. The effects of withholding irrigation on yield were significantly dependent on the genotype, reflecting a potential genotypic difference in drought tolerance. The development of climate adaptive strategies for cocoa production requires integrating effects of irrigation, potassium application and cocoa genotype on yields. Future research should focus on unraveling the underlying genotypic and ecophysiological mechanisms of the results presented here, and identifying other potential approaches to enhance the resilience of cocoa to increasing water deficit under climate change.

Performance of Cacao (Theobroma cacao L.) Varieties to Wood Ash and NPK Fertilizer on Flowering, Cherelle Wilt and Pod Yield

Experiments were conducted to evaluate NPK fertilizer and wood-ash application on flowering, cherelle performance and pod yield of cacao (Theobobroma cacao L). Treatments includes NPK 15.15.15; NPK + wood-ash; sole wood-ash and control with five cacao varieties (TC1, TC2, TC3, TC4, and TC6) in a 4x5 factorial experiment with three replications. Data were measured on flowering, cherelle formation, and pod development. From the results, flowering, cherelle formation and pod development were significantly enhanced by application of NPK, sole wood-ash and their combinations over control plots. Application of wood-ash alone significantly enhanced flowering, cherelle formation and pod development in both seasons over other fertilizer treatments. However, cherelle wilt under sole application of wood-ash was significantly higher compared to sole NPK and NPK + wood-ash combinations. Interaction effects of fertilizer and cacao varieties had significant positive effects on flower development and reduced cherelle wilt in both light and main crop seasons. Interactions of wood-ash and cacao varieties were found to significantly enhanced cherelle formation and pod development. The study concludes that NPK, NPK + wood-ash and sole wood-ash treatments significantly enhanced flowering, cherelle formation and pod development in cacao over the control. Also, cherelle with rate drop significantly with integration of NPK+wood-ash

Genotypic variation in flowering, fruit set, and cherelle wilt, and their relationship with leaf nutrient status in cocoa (Theobroma cacao L.) grown in humid tropics of India

Genotypic variation in flowering, fruit set, and cherelle wilt, and their relationship with leaf nutrient status in cocoa (Theobroma cacao L.) grown in humid tropics of India

Description and Pathogenicity of Colletotrichum kapreanum sp. nov, a Cherelle Wilt Pathogen Belonging to the Gigasporum Species Complex.

Similar to cacao pod rot, cherelle wilt decreases production from cacao fields. Among all known fungal pathogens of the cacao, Colletotrichum spp. are common infectious agents that affect the cherelles and pods of cacao; thus, cacao diseases are often classified by stage. Therefore, knowing whether these pathogens are common in both fruit stages is necessary for implementing disease control measures. Symptoms of cherelle wilt were found in cacao plants in Pangasinan, Philippines, in 2022. The fungal strain obtained from the lesion was found to be pathogenic towards cherelles, but not towards pods. The strain was classified as an unknown species belonging to the gigasporum species complex, based on the morphological and molecular phylogenetic analyses of ITS, GAPDH, CHS1, ACT, and TUB2. We propose Colletotrichum kapreanum sp. nov. as a causal agent of cacao cherelle wilt, but not pod rot.

Locally-selected cacao clones for improved yield: a case study in different production systems in a long-term trial

Ageing plantations, poor genetic material, soil degradation, pests and diseases are, among other factors, limiting cacao production. To meet the increasing demand for cacao in the absence of productivity gains, forests are cleared and the use of external inputs is generalised, with severe negative impacts on biodiversity and GHG emissions. The use of improved plant genetic material should support a sustainable increase of production. In this study, we evaluate and compare the yield performance of four locally-selected clones with those of four widely-used international clones in South America and four full-sib families (crosses of the same international clones). The research was conducted in a long-term trial in Bolivia with different production systems, including monocultures and agroforestry systems under organic and conventional farming and a successional agroforestry system without external inputs. Their cacao yields and the factors determining productivity (pod index, flowering intensity, pod load, pod losses, aboveground biomass, harvesting period) were assessed during 5 years. The cacao trees grown in the two monocultures had higher yields than those in the agroforestry systems. This was the result of higher aboveground biomass, flowering intensity and pod load, and similar pod losses due to cherelle wilt and fungal diseases in the former when compared with the latter. No differences between conventional and organic management were observed. We did not identify any genotypes performing better in a specific production system. On average, the local clones had twofold and five times higher yields than the international ones and the full-sib families, respectively. This was related to their higher total pod load, bigger pods and higher yield efficiency, i.e., higher yield per unit of tree biomass. However, the local clones had less flowering intensity, more cherelle wilt and similar losses due to fungal diseases to those of the international clones. This study clearly shows the need to invest in selection and breeding programmes using locally-selected genetic material to increase cacao production and support renovation/rehabilitation plans. Breeding genetic material that is adapted to low light intensities is crucial to close the yield gap between monocultures and agroforestry systems, and to further promote the adoption of the latter.

Application of coconut shell biochar and rhizobacteria consortium to increase cocoa production (Theobroma cacao L.)

This research is aimed to study and investigate how coconut shell biochar interacts with rhizobacteria in increasing cocoa plant growth and production. This research was conducted at Kodeoha, North Kolaka, Southeast Sulawesi with an alluvial soil type and average rainfall is 192.17 mm from October 2022 until January 2023. The experiment was set using a split plot design with biochar dosage as the Main Plot consisted of four levels, namely 0 ton ha−1 (control), 2.5 ton ha−1, 5 ton ha−1, and 7.5 ton ha−1 and rhizobacteria concentration as Sub Plots consisted of four levels, namely 0 mL L−1, 50 mL L−1, 100 mL L−1, and 150 mL L−1. The results of the recent research show a significant interaction between biochar 10 ton ha−1 and rhizobacteria 150 mL L−1 on the parameter of percentage of cherelle wilt (60.47 %) and percentage estimated of surviving pods (28.68%). This doses suggested to be applied to cocoa plantations in the field to maintain maximum production. In addition, there is a need for further research using spesific bacteria especially potassium solvents in order to maximize the production potential.

Hand pollination under shade trees triples cocoa yield in Brazil’s agroforests

Agricultural diversification can enhance climate resilience, biodiversity conservation, and livelihood in global farming systems. Diverse agroforestry systems with cocoa have been shown to provide all these benefits, but the often-lower yields compared to monocultures limit agroforestry adoption by smallholder farmers. Cocoa yield is pollination-limited, and here, we quantified the effect of hand pollination in cocoa on fruit set, fruit abortion or cherelle wilt, pest and diseases, and number of mature fruits. Experiments were conducted in Bahia, Brazil, along a shade gradient from low [10–30%] to high [70–100%] canopy cover and with cocoa trees grafted with high-yielding varieties. We found on average 331% fruit set, and 300% mature fruit increase (i.e. ripe pods) per tree by enhancing pollination by hand as little as 10% of the flowers/tree, compared to the control (i.e. with only natural pollination). Fruit set, fruit losses, and mature fruit development linked to hand pollination was higher in low compared to highly shaded cocoa areas. We found 31% higher fruit set and 37% higher number of mature fruits in grafted than un-grafted trees. Further, when comparing efforts invested in hand pollination, minimum labor (∼5 min/tree to pollinate 10–30% of the flowers/tree) led to a 871% fruit set and a 750% mature fruit increase under low canopy cover, and intermediate labor (∼15 min/tree to pollinate 40–60% flowers/tree) to a 629% fruit set under high canopy cover. As ∼5–15 min/tree hand pollination can substantially enhance fruit set and number of mature fruits in low as well as high shade management, we recommend performing hand pollination particularly in agroforests under 40–50% canopy cover to create win-win opportunities for high productivity and climate resilience. Future research should focus on the wide range of agroforestry, tree grafting and innovation strategies in all major production regions to capture the long-term variability of hand pollination as a basis to scale-up hand pollination for sustainable cocoa production globally.

Effects of fertilizer application on cacao pod development, pod nutrient content and yield

Fertilizer application in cacao production systems in West Africa yields highly variable results, ranging from no effect to doubling of the yield. Mechanisms underlying yield responses to increased nutrient availability are still largely unkown. In this study, we assessed how fertilizer application affects pod development and production of cacao trees in a full sun cocoa system in Côte d'Ivoire and a shaded cocoa system in Ghana. We monitored pod growth over time and the number of pods produced simultaneously on the trees in the minor and major harvest seasons. Furthermore, we measured nutrient concentrations in cherelles and beans and husks of developing pods in the major harvest season to estimate the total nutrients allocated to developing pods per tree. Lastly, we performed detailed yield measurements (number of pods, location in the tree (canopy or trunk), pod size and bean content) in 2020 for the plot in Côte d'Ivoire.Our results showed that, in the major harvest season, pods on fertilized trees grew wider (average: 15.4 cm) than pods on unfertilized trees (average: 11.9 cm). A higher pod growth rate resulted in a larger final pod size; larger pods took longer to mature. In the major harvest season, more cherelles on fertilized trees than on unfertilized trees reached maturity despite having an equal or lower nutrient content. Competition for assimilates rather than nutrients seems to induce cherelle wilt. In pods past wilting stage, fertilizer application slightly influenced nutrient dynamics of developing pods but not the final nutrient content in ripe pods. Lastly, increased nutrient availaibility did not change the absolute number of pods a tree produced annually. However, fertilizer application did increase the estimated annual dry bean yields from 2260 kg ha−1 to 2930 kg ha−1 by increasing the number of pods that developed during the major harvest season, when pods were heavier and the bean weight within the pods was relatively higher.

Control of cacao (Theobroma cacao) diseases in Santo Domingo de los Tsachilas, Ecuador

Introduction. Ecuador occupies the fourth place in cocoa exports with 293,487 tons per year, produced on 559,617 hectares. However, its yield per hectare is low mainly due to the presence of pathogens that affect the pods. Objective. To evaluates different methods of control of pathogens of the Theobroma cacao cv ‘CCN-51’ pod. Materials and methods. The work was carried out in Luz de America, Santo Domingo de los Tsachilas, Ecuador, between 2016 and 2017. The treatments were the result of the combination of cultural practices + two fungicides (Chlorothalonil and Pyraclostrobin) + one biofungicide Serenade® (Bacillus subtilis QST713), with and without fertilizers. In total, 16 treatments were evaluated with 3 replicates or blocks, installed in a commercial cocoa plantation cv ‘CCN-51’ and under a Randomized Complete Block Design (RCBD). Results. The use of fungicides (chemical and biological), decreased the incidence of moniliasis (Moniliophthora roreri), black pod rot (Phytophthora spp.), and cherelle wilt; but the application of fertilizers did not increase the effectiveness of these products. Treatment with only cultural practices did not decrease the final incidence of moniliasis, nor of brown rot, in contrast, the final incidence of cherelle wilt increased. The number of pods and the yield were not directly related and the highest yield of fermented and dry cocoa, corresponded to T9 [Cultural labors + Serenade® (0.2 kg ha-1) (every 15 days) + Fertilizer (0.3 kg ha-1) + Fertilizer (1 kg plant-1)], a treatment that also had the highest net income per hectare. Conclusion. Chemical and biological control can manage cocoa pods pathogens. The integration of both control methods allowed the cocoa producer to obtain greater income.

Micro-Climate Conditions, Weed Diversity, Flowering and Yield of Young Cacao Plants as Affected by Shade Regimes

Experiments were conducted in 2015/2018 in two cacao plots established in 2012 and 2013 in Akure, Nigeria to investigate micro-climate conditions, weed densities, flowering and yield of cacao as affected by shade regimes. Established cacao plots under three plantain (Musa spp) shade regimes consisting of No-shade, Moderate and Dense shade were used. Air and soil temperature, relative humidity and Photosynthetic Active Radiation (PAR), weed population and species diversity, cacao flowering and pod production were measured. From the results, air and soil temperature measurements under No-shade plots had a significantly higher mean values (32°C) and soil (28°C) compared with moderately shaded [air, 30°C and soil, 26.5°C] and densely shaded [air, 30°C and soil, 26°C] plots in2015 and 2016 measurements but under 2017 measurements, no significant difference in the soil temperature of the plots under dense shade, moderate and the no-shade which were ascribed to canopy close-up of the cacao that led to reduced transmitted light through the canopy to the understories species. The vigour of weeds under no-shade plots were significantly higher compared with dense and moderately shaded plots. In 2013 established cacao plot, flower production was higher significantly in no-shade compared with those in moderate and dense shaded cacao plots in 2015 and 2016 measurement. Pod production under No-shade were significantly higher compared with other treatments in 2016 and 2017. Cherelle wilt rate was higher in shaded plots compared with the no-shade plots. Pod yield parameters were significantly higher under No-shade plots compared with shaded treatments during the three years of data measurement. Air temperature between 30°C to 33.7°C during flowering and fruit/pod setting was found to have positive influence on bean yield in cacao. The study concluded that excessive shade decreases yield of cocoa, while increases in temperature and relative humidity boosts some physiological processes for pod production in Cocoa

Micro-Climate Conditions, Weed Diversity, Flowering and Yield of Young Cacao Plants as Affected by Shade Regimes

Experiments were conducted in 2015/2018 in two cacao plots established in 2012 and 2013 in Akure, Nigeria to investigate micro-climate conditions, weed densities, flowering and yield of cacao as affected by shade regimes. Established cacao plots under three plantain (Musa spp) shade regimes consisting of No-shade, Moderate and Dense shade were used. Air and soil temperature, relative humidity and Photosynthetic Active Radiation (PAR), weed population and species diversity, cacao flowering and pod production were measured. From the results, air and soil temperature measurements under No-shade plots had a significantly higher mean values (32°C) and soil (28°C) compared with moderately shaded [air, 30°C and soil, 26.5°C] and densely shaded [air, 30°C and soil, 26°C] plots in2015 and 2016 measurements but under 2017 measurements, no significant difference in the soil temperature of the plots under dense shade, moderate and the no-shade which were ascribed to canopy close-up of the cacao that led to reduced transmitted light through the canopy to the understories species. The vigour of weeds under no-shade plots were significantly higher compared with dense and moderately shaded plots. In 2013 established cacao plot, flower production was higher significantly in no-shade compared with those in moderate and dense shaded cacao plots in 2015 and 2016 measurement. Pod production under No-shade were significantly higher compared with other treatments in 2016 and 2017. Cherelle wilt rate was higher in shaded plots compared with the no-shade plots. Pod yield parameters were significantly higher under No-shade plots compared with shaded treatments during the three years of data measurement. Air temperature between 30°C to 33.7°C during flowering and fruit/pod setting was found to have positive influence on bean yield in cacao. The study concluded that excessive shade decreases yield of cocoa, while increases in temperature and relative humidity boosts some physiological processes for pod production in Cocoa

Diversity Analysis of Cacao (Theobroma Cacao) Genotypes in Nigeria Based on Juvenile Phenotypic Plant Traits

ABSTRACT Fifteen newly-produced cacao hybrids were evaluated in the field with an objective of understanding their genetic diversity using morphological descriptors. The field trials were conducted in Ibadan (7° 13ʹN, 3° 51ʹE), and Owena (7° 11ʹN, 5° 1ʹE), Nigeria. Juvenile performance data were subjected to ANOVA, Principal Component and Cluster analyses. The first three principal axes accounted for 34.41%, 16.71%, and 14.09% of variation among the plant characters, respectively. Numerical taxonomy showed P2 x P11 as the most distinct. The FASTCLUS technique grouped the genotypes into four clusters, P2 x P11 being the only member of its group. There is significant genetic diversity among the genotypes, while plant height, stem diameter, Cherelle wilt, fruiting, and tree size among others are important discriminatory traits among cacao genotypes.

Impact of insecticide and pollinator-enhancing substrate applications on cocoa (Theobroma cacao) cherelle and pod production in Côte d’Ivoire

Cocoa yield in the major cocoa-producing countries is far below potential levels. It has been shown that apart from poor soil fertility, inadequate genotypes and pest and disease incidence, this yield gap is caused by below-optimum pollination levels. On 3 Ivorian cocoa farms, during the six months preceding the main harvest season of 2018–2019 (August 2018 until January 2019), we used generalized mixed models to investigate how the creation of a pollinator-friendly environment by applying rotting organic material (banana pseudostems) to cocoa fields, combined with and without insecticide applications, influences cocoa production. It was found that banana pseudostem treatments had a positive effect on cherelle production but that this effect was only observed in plots treated with insecticide to protect cherelles against sap-sucking mirids, at the beginning of the experiment. Furthermore, although we did not find significant differences in cherelle wilt rates between treated and control plots, we did not observe a significantly higher accumulated number of mature pods that were produced on trees treated with substrate and untreated control trees during the 25 week experimental period. The pollination-enhancing effect of the substrate on cherelle production in sprayed plots was significantly higher in trees that were close (<1 m) to the holes to which the substrate was applied, compared to trees that were further away from these holes. Reduced rainfall towards the end of the minor rainy season of October – November, concurred with a decrease in the number of flowers but also with a decrease in fruit set rate. Soils of all experimental farms had nutrient levels considered to be inadequate for cocoa production, which can explain why the increase in cherelles (+ 75 % and + 50 % in trees respectively close to and further away from substrate holes) did not result in significant increases in mature pods. Our results suggest that closing the pollination gap will close the cocoa yield gap, only when other factors that prevent cherelles to develop into mature pods, are addressed.

Physiological, biochemical activities of cherelle wilt on three cocoa clones (Theobroma cacao) under two levels of soil fertilities

Abstract. Dewi HS ES, Ydono P, Putra ETS, Purwanto BH. 2020. Physiological, biochemical activities of cherelle wilt on three cocoa clones (Theobroma cacao) under two levels of soil fertilities. Biodiversitas 21: 187-194. Cherelle wilt is one of the diseases caused by physiological disorders. It results in loss of young pods by 70-90%. This study aims to reveal the correlation of physiological, biochemical activities of several cocoa clones with two soil fertility status. The study was conducted using a nested design with two blocks as replications. The soil fertility status was classified based on soil chemical status. This obtained two clusters of soil fertility, namely low soil fertility, high soil fertility. The second factor was cocoa clone, consisting of three clones, namely RCC 70, RCC 71, KKM 22. Variables measured were soil character, biochemistry of fresh, wilting cherelles, physiological activities, cherelle wilt, biochemical activities including sucrose content, reducing sugar, invertase activity. The data obtained were analyzed for their variance (ANOVA) with a 95% confidence level, tested using Tukey’s HSD there were significant differences between treatments. The results showed that high soil fertility status could increase contents of N, P, K, boron in leaves, increase nitrate reductase activity, chlorophyll contents, increase photosynthesis rate, suppress transpiration rate, increase assimilate transport from leaves to cherelle, increase enzyme invertase activity. RCC 70 clone indicated better physiological, biochemical activity, had the smallest percentage of cherelle wilt. Soil fertility status can suppress cherelle wilt by up to 60% through increasing physiological, biochemical activity. The RCC 70 clone shows the lowest cherelle wilt values ​​compared to RCC 71, KKM 22 clones.

Kajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene

This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.

INCIDENCE DYNAMIC OF POD ROT DISEASE OF COCOA CLONES IN LAMPUNG, INDONESIA

Incidence dynamic of pod rot disease of cocoa clones in Lampung, Indonesia. The declining of production and productivity of cocoa in Indonesia might due to pests and diseases attacks and planting unselected clones. Dynamic of pod rot incidence was important to plan pest controlling. To study dynamic incidence of some cocoa clones, a research was conducting in Pesawaran District, a centre of cocoa production in Lampung. A farmer cocoa plot under agro-forestry system was selected which had been upgrading in 2014 by pruning and side-grafting with national clones including Sul 1, MCC 1, MCC 2, ICCRI 7 and selected local clone named T1, T2, and T3. The results showed that pod rot incidence occurred along the year of observation. For immature pod, pod rot incidence was dynamic and varied among months and clones. There was high pod rot incidence every months for particular clone. National clone Sul1 and local clone T3 exhibited more tolerant to pod rot disease than other clones. Clones Sul1 and T3 also produced more pod than others. High incidence of pod rot occurred on fruit stage of cherelle (incidence 38.7%) and small pod (incidence 18.8%) that well known as cherelle wilt symptom.

Pengaruh Pupuk Kompos Kulit Buah Kakao Dan Pupuk Tablet Terhadap Produksi Kakao (Theobroma cacao L.)

Cocoa is one of the estate crop whose role is quite important for the national economy, particularly as a provider of employment, income and foreign exchange. The high export opportunities of cocoa beans has not been followed by the production of cocoa beans in Indonesian. The production of dried cacao beans in Indonesia is still low. The low productivity of seeds generally caused by Cherelle wilt of cacao. Wilting occurs due to inability of the cherelle to compete with the other cherelle in absorbing nutrients. Fertilization is an effort to maintain and fulfill the nutrients in the plants. This research is aimed to assess the effect of fertilization using cocoa pod husk and NPK tablets fertilization on cocoa crop yields. This experiment was conducted at PT. PP. Bajabang Indonesia, Cipeundeuy, West Bandung regency from December 2016 to March 2017. The experiment was conducted using a Simple Randomized Block Design that consists 10 treatments: control, single N, P, K fertilizer 297 g/tree, cocoa pod husk 9 kg/tree, cocoa pod husk 9 kg/tree + single N, P, K fertilizer 297 g/tree, cocoa pod husk 18 kg/tree + single N, P, K fertilizer 297 g/tree, cocoa pod husk 9 kg/tree + NPK tablet fertilizer 20 tablets/tree, NPK tablet fertilizer 20 tablets/tree, cocoa pod husk 9 kg/tree + NPK tablet fertilizer 10 tablets/tree, cocoa pod husk 18 kg/tree + NPK tablet fertilizer 20 tablets/ tree, cocoa pod husk 18 kg/ tree + NPK tablet fertilizer 10 tablets/tree. The result of experiment showed that there was an influence of cocoa pod husk and NPK tablet fertilizer on cocoa fruit weight at 12 MSP, that is cocoa pod husk 9 kg/tree + NPK tablet fertilizer 20 tablets/tree. Number of cherelle wilted at 12 MSP with cocoa pod husk 9 kg/tree + NPK tablet fertilizer 20 tablets/tree.

Pattern of Flushing, Cherelle Wilt, and Accuracy of Yield Forecasting of Some Cocoa Clones

Monthly observation of cocoa flushing, number of cherelle wilt (CW), number of small, medium and large pods of 6 clones was conducted for two years to study its dynamics for one year. A study was conducted in Kaliwining Experimental Station, 45 m asl. and D rainfall type (according to Schmidt &amp; Ferguson), using ICS 13, ICS 60, TSH 858, Sulawesi 1, Sulawesi 2 and KW 165 clones of 8 years old. Each clone was planted intermittently in separate rows, replicated 6 rows. Correlation and regression analysis were done between variables and with rainfall data. The parallel research was conducted in the similar station to assess the accuracy of production estimation method by identify percentage of small pods (length 1—10 cm), medium (11—15 cm) and large pods (&gt;15 cm) to grow until harvested. The study used 15th years old trees of Sulawesi 1, Sulawesi 2, KW 165, KKM 22, ICS 13 and DR 2 clones. Each clones was replicated 5 times. The result showed that intensive flushing (&gt;50%) occured during January, March, September and November meanwhile no flushing during December and February. Correlation between rainfall and flushing was positive (r=0.27). Effect of clones on flushing frequency was similar but for flushing intensity was significant. KW 165 tended to be the lowest but TSH 858 tend to be the highest. CW occured for a year-round but the height level during May and June. Effect of clones was significant, KW 165 showed highest followed by Sulawesi 2. CW level showed positive correlation with number of medium (r=0.71) and big pods (r=0.55), except showed negative correlation with flushing intensity (r=-0.37) and rainfall (r=-0.51). High pod setting happened during May to November and low pod setting during December to March. In this aspect effect of clones were significant, the productive clones were Sulawesi 1, Sulawesi 2 and KW 165, but ICS 60 was the less. CW level during 1st semester was lower than at 2nd semester and clone effect was significant. The opportunity of small, medium and big pods to be harvested was similar among both semester. The opportunity of small, medium and big pods to be harvested were 8—56%; 57—83% and 77—96% respectively depend on the clones. In average, those opportunities were 27%, 72%, and 87% for small, medium and big pods respectively.Key words: flushing, cherelle wilt, pod setting, clones, yield prediction

Molecular and metabolic changes of cherelle wilt of cacao and its effect on Moniliophthora roreri

Young Theobroma cacao pods, known as cherelles, are commonly lost to physiological thinning known as cherelle wilt. Cherelles are susceptible to frosty pod rot caused by Moniliophthora roreri. We studied the cherelle wilt process and its impact on M. roreri infection using microscopic, metabolite, and gene expression analyses. Wilt was associated with increased levels of tricarboxylic acid cycle intermediaries and decreased levels of major metabolites. Expression changes of cacao ESTs in response to wilt suggest induction of the polyamine, ethylene, and jasmonic acid biosynthetic pathways and regulation of abscisic acid and cytokinin levels. M. roreriinfection caused little alteration of cherelle physiology. M. roreri responded to the late stage of wilt by altering the expression of M. roreri ESTs associated with metabolite detoxification and host tissue degradation. The environment of the wilting cherelles may truncate the disease cycle of frosty pod rot, by limiting M. roreri sporulation and stopping the lifecycle.

Effect of flush existence, NAA and GA application on cocoa pod development

This experiment was carried out to study the photosynthate allocation between flush and young pods, and the effect of (naphthalene acetic acid) and (gibberellic acid) application to sink strength. Two cocoa clones KW 163 and KW 165 located in Kaliwining Experimental Station of Indonesian Coffea and Cocoa Research Institut were used on this experiment. Each clone was treated with flushes and without flush. Beside that, the young pods sprayed with NAA 250 mg L-1, GA 250 mg L-1, NAA 250 mg L-1 dan GA 250 mg L-1 and control (K = without NAA and GA). There were 2 x 4 treatment combinations for each clone, and replicated three trees for each combination. The parameter were cherelle wilt percentage, sucrose content, fresh and dry weight, long and diameter of healthy and wilting pods.The result showed that sink strength of young pods was lower than that of flushes, which caused application photosynthate translocation to the young pods was lower. NAA and GA application to the pods could improve sucrose allocation, increased pod weight and cherelle wilt was suppressed. The lack of photosynthate on young pod cause metabolism change, so pod became cherelle wilt. But, there was still not known the optimum concentration and method of application of those growth regulators to obtained minimum cherelle wilt.Key words: Cocoa, flush, pod, naphthylacatic acid, gibberellic acid, cherelle wilt.