CF-11 Cellulose Research Articles

First Report of Peach-associated luteovirus in Nectarine (Prunus persica) in Italy

Nectarines (Prunus persica) are among the most popular stone fruits grown in Italy. In particular, the Campania region produces an average of 80,000 metric tons of fresh fruits per year. In 2014, a survey was conducted in Eboli (Salerno province) in a 5-year-old nectarine (cv. Gartairo) orchard in which about 30% of the trees showed an intense pitting of the fruit surface. Leaves, branches, and trunk were symptomless, and the intensity of the pitting tended to increase with fruit ripeness. The fruit mesocarp was not altered, nor were the flavor and taste of the fruits. To investigate the possible etiology of the disease, a symptomatic sample was analyzed by high-throughput sequencing (HTS). Double-stranded RNAs were purified by CF11 cellulose chromatography as previously described (Candresse et al. 2013) from 2- to 3-mm-thick epicarp peel collected from a ripe fruit. The cDNA libraries were generated with SuperScript II reverse transcriptase (Invitrogen), polymerase chain reaction (PCR) amplified and sequenced on the Miseq Illumina platform using a 2 × 250-bp paired-end sequencing strategy. Raw data were trimmed and cleaned by removing adaptor sequences generating a total of 1,999,750 high-quality reads that were de novo assembled with CLC Genomic Workbench 9.0, generating a total of 1,663 contings. These contigs were annotated by BlastN and BlastX searches against the GenBank database, revealing the presence of several viral agents already reported as stone-fruit pathogens: Hop stunt viroid, Apple chlorotic leaf spot virus, and Cherry green ring mottle virus. In addition, two contigs (of respectively 648 and 510 bp, totaling 0.025% of trimmed reads) showing 97% nt identity with the corresponding sequence of Peach-associated luteovirus (PaLV) (KY635988) were also observed. To confirm the presence of PaLV and fill the sequence gap between the two contigs, total RNA was extracted and used in a reverse transcription (RT) PCR experiment carried out with specific primers (forward, 5′-GAAACGGTAAGTCGACGGACATCGCG-3′; reverse, 5′-GGAGGTTACACTGACAAGACAATGGA-3′) designed from the ends of the contigs. A PCR product of the expected size (672 bp) was obtained, purified, and directly sequenced, showing 96% nt identity with the PaLV corresponding sequence. The sequence of the completed scaffold (1,609 nt), integrating the HTS data and the sequence of the 451-nt gap determined from the PCR product, has been deposited in GenBank (accession no. MF990276). To our knowledge, this is the first report of PaLV infecting a stone fruit tree in Italy. Members of genus Luteovirus are aphid-transmitted and phloem-limited viruses that have been recently reported to infect nectarine (Bag et al. 2015), cherry (Lenz et al. 2017), and peach (Igori et al. 2017; Wu et al. 2017). Attempts to detect PaLV in other symptomatic nectarine trees of the same orchard by RT-PCR failed, thus indicating that the virus is most probably not associated with the symptoms. Given their recent discovery, a lot of information on the biology, symptomatology, distribution, and prevalence of fruit-tree-infecting luteoviruses is still missing. Further efforts to understand these agents and their potential significance are needed to reach scientifically motivated decisions as to the need to control them or to exclude them from Prunus propagation materials.

Molecular markers for artemisinin and partner drug resistance in natural Plasmodium falciparum populations following increased insecticide treated net coverage along the slope of mount Cameroon: cross-sectional study

BackgroundDrug resistance is one of the greatest challenges of malaria control programmes, with the monitoring of parasite resistance to artemisinins or to Artemisinin Combination Therapy (ACT) partner drugs critical to elimination efforts. Markers of resistance to a wide panel of antimalarials were assessed in natural parasite populations from southwestern Cameroon.MethodsIndividuals with asymptomatic parasitaemia or uncomplicated malaria were enrolled through cross-sectional surveys from May 2013 to March 2014 along the slope of mount Cameroon. Plasmodium falciparum malaria parasitaemic blood, screened by light microscopy, was depleted of leucocytes using CF11 cellulose columns and the parasite genotype ascertained by sequencing on the Illumina HiSeq platform.ResultsA total of 259 participants were enrolled in this study from three different altitudes. While some alleles associated with drug resistance in pfdhfr, pfmdr1 and pfcrt were highly prevalent, less than 3% of all samples carried mutations in the pfkelch13 gene, none of which were amongst those associated with slow artemisinin parasite clearance rates in Southeast Asia. The most prevalent haplotypes were triple mutants PfdhfrI51R59N108I164(99%), pfcrt- C72V73I74E75T76 (47.3%), and single mutants PfdhpsS436G437K540A581A613(69%) and Pfmdr1 N86F184D1246 (53.2%).ConclusionsThe predominance of the Pf pfcrt CVIET andPfdhfrIRN triple mutant parasites and absence of pfkelch13 resistance alleles suggest that the amodiaquine and pyrimethamine components of AS-AQ and SP may no longer be effective in their role while chloroquine resistance still persists in southwestern Cameroon.

Extraction and molecular detection of viral dsRNA from different infected plants

Extraction of viral double stranded RNA (dsRNA) from infected plants is helpful in identification of the viruses involved in infection. To date, there have been several methods developed to isolate dsRNA; however, type of the plant and virus is determinative in extraction efficiency. In this study we extracted dsRNA from different woody and herbaceous plants through a modified method which reduces the costs and time of extraction procedure. This method is based on different affinity of nucleic acids for the cellulose CF-11 in1X STE (Sodium chloride Tris EDTA) buffer containing 16 % ethanol. There is no phenol treatment or mini columns used in the isolation procedure. Extracted dsRNAs were identified by ribonuclease treatment and RT-PCR (Reverse Transcriptase-Polymerase Chain Reaction). We have applied the procedure on five different hosts representing Amaranthaceae, Vitaceae, Fabaceae and Rosaceae infected with four different viruses representing Secoviridae and Bromoviridae.

Plasmodium falciparum merozoite surface protein 1 block 2 gene polymorphism in field isolates along the slope of mount Cameroon: a cross - sectional study.

BackgroundMalaria remains a major global health burden despite the intensification of control efforts, due partly to the lack of an effective vaccine. Information on genetic diversity in natural parasite populations constitutes a major impediment to vaccine development efforts and is limited in some endemic settings. The present study characterized diversity by investigating msp1 block 2 polymorphisms and the relationship between the allele families with ethnodemographic indices and clinical phenotype.MethodIndividuals with asymptomatic parasitaemia (AP) or uncomplicated malaria (UM) were enrolled from rural, semi-rural and semi-urban localities at varying altitudes along the slope of mount Cameroon. P. falciparum malaria parasitaemic blood screened by light microscopy was depleted of leucocytes using CF11 cellulose columns and the parasite DNA genotyped by nested PCR.ResultsLength polymorphism was assessed in 151 field isolates revealing 64 (5) and 274 (22) distinct recombinant and major msp1 allelic fragments (genotypes) respectively. All family specific allelic types (K1, MAD20 and RO33) as well as MR were observed in the different locations, with K1 being most abundant. Eighty seven (60 %) of individuals harbored more than one parasite clone, with a significant proportion (p = 0.009) in rural compared to other settings. AP individuals had higher (p = 0.007) K1 allele frequencies but lower (p = 0.003) mean multiplicity of genotypes per infection (2.00 ± 0.98 vs. 2.56 ± 1.17) compared to UM patients.ConclusionsThese results indicate enormous diversity of P. falciparum in the area and suggests that allele specificity and complexity may be relevant for the progression to symptomatic disease.

A new method to isolate total dsRNA.

When a diseased plant is suspected to be infected with unknown viruses, the approach of isolating double-stranded RNA (dsRNA) from diseased tissues and analyzing the sequence has been useful for detecting the viruses. This procedure owes its success to the majority of plant pathogenic viruses being RNA viruses, which accumulate dsRNAs as copies of their genome or as a replicative intermediate in infected cells. Conventional dsRNA isolation methods (e.g., chromatography using CF-11 cellulose) require a significant amount of plant material and are laborious and time consuming. Therefore, it has been impractical to isolate dsRNA from many samples at the same time. To overcome these problems, we developed a novel dsRNA isolation method involving a recombinant dsRNA-binding protein. Using this method, we can readily isolate viral dsRNA from a small amount of plant material, and can process numerous samples simultaneously. Purified dsRNA can be used as a template for cDNA synthesis and sequencing, enabling detection of both known and unknown viruses.

Detection of Beet Necrotic Yellow Vein Virus by Double Stranded RNA Analysis

Beet necrotic yellow vein virus (BNYVV), the type member of the Benyvirus genus, has a multipartite, positive-sense single-stranded RNA genome, which consists generally of four, or in some isolates five, distinct RNA species. In this study, 108 BNYVV infected soil samples were collected from Isparta province, Turkey. Sugar beet plants cv Kasandra were grown in these soil samples using bait plant techniques and root samples were then analyzed by dsRNA analysis. The RNA was purified by CF-11 cellulose chromatography and gel electrophoresis. In 108 samples tested, dsRNA profiles were observed in 53 samples. No dsRNA bands were observed in negative control used in the analysis.

Physalis angulata: A New Natural Host of Tomato chlorosis virus in Brazil.

Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) are the two Solanaceae-infecting Crinivirus species (family Closteroviridae) of worldwide importance. In Brazil, only ToCV has been detected under natural conditions infecting tomato (Solanum lycopersicum), sweet pepper (Capsicum annuum), and potato (S. tuberosum), causing foliar chlorosis (1, 3). However, there are no formal reports of alternative weed hosts of ToCV. During crop surveys in Capão Bonito, São Paulo State, Brazil (May 2011), a high incidence (above 20%) of plants of the weed, cut leaf ground cherry (Physalis angulata L.) growing around and within a tomato (cv. Alambra) field with a high incidence of ToCV, were found displaying interveinal chlorosis on the lower leaves, similar to those induced by magnesium deficiency. The P. angulata plants also had high populations of whiteflies (Bemisia tabaci biotype B). Ten leaf samples were taken from individual symptomatic ground cherry and tomato plants for Crinivirus testing. Total nucleic acids were extracted from 2 g of symptomatic and healthy leaf tissues of both hosts using Whatman CF-11 cellulose (Sigma) as described (4). The purified double stranded RNA samples were used as a template in reverse transcription (RT)-PCR using specific primers targeting the p22 gene region in the genome of ToCV (2). Only the 566-bp ToCV-specific amplicon was detected in all field samples. Sequences of samples from the P. angulata and tomato cDNA amplicons were identical to each other (GenBank Accession No. JX187514) and they showed 99% identity with the ToCV RNA 1 from a tomato isolate from Florida (AY903447). This confirmed the initial hypothesis of Crinivirus infection. Cuttings of symptomatic P. angulata plants were also obtained and kept in a voile cage under greenhouse conditions together with healthy seedlings of P. angulata and the begomovirus-resistant inbred tomato line 'TX-468RG.' Fifty aviruliferous B. tabaci (biotype B) adults were placed in the cage. Similar symptoms were observed 50 days after exposure to whiteflies in both hosts. Transmission to P. angulata and to 'TX-468RG' was also confirmed via sequencing of ToCV-specific amplicon, demonstrating the infectivity of the isolate to both hosts. To our knowledge, this is the first report of P. angulata as a natural host of ToCV in Brazil. This weed is often present in the commercial fields because of its natural tolerance to herbicides currently used in tomato production. The ToCV-infected P. angulata plants might serve as alternative sources of inoculum for the surrounding tomato fields. The environmental persistence of P. angulata combined with its intense whitefly colonization might allow a year-round ToCV exposure for tomato plants under field conditions in this major production area of Brazil where at least 25 million tomato plants are cultivated annually.

First Report of Shallot virus X in Onion in Sudan.

Onion (Alium cepa L.) is among the most important vegetable field crops in Sudan. During a disease survey in crops (cvs. Kamleen Yellow and Abu-freua) conducted in 2010, samples showing mild mottling symptoms were collected from Shambat Research Station Farm, Khartoum North, Sudan. A CF-11 cellulose chromatography dsRNA preparation (4) of a mixed onion leaf sample of five plants (20 g) resulted, apart from smaller dsRNAs up to 3 kbp, in a high molecular weight dsRNA of approximately 9 kbp. This dsRNA was used as a template for a random reverse transcriptase (RT)-PCR followed by cloning (4) and sequencing of two randomly selected clones by the ABI BigDye Terminator v3.1 Cycle Sequencing Kit. Comparison with sequences available at GenBank revealed high identities to Shallot virus X (ShVX). ShVX is the type member of the genus Allexivirus (Alphaflexiviridae). One sequence obtained showed 84% nt and 98% aa sequence identity (genome position 414 to 1,285 of Accession No. M97264) to the replicase, whereas the other sequence partially covered the ORF4 and coat protein (CP) coding region (7,127 to 7,998). This sequence showed 80% nt (entire sequence) and 80/89% aa sequence identity to the ORF4 encoded protein/coat protein of a Russian ShVX isolate, respectively. ShVX was first reported in shallot in Russia (2) and subsequently in the Netherlands, Germany, India (3), and New Zealand (1). To confirm the presence of ShVX in Sudan, 32 symptomatic leaf samples were collected in 2011 from different onion fields in Khartoum North, with a similar disease incidence compared to 2010. Thirty-one of these onion samples reacted positively in a double antibody sandwich-ELISA with a ShVX-specific antiserum (DSMZ AS-1042). Total RNA was extracted from five ShVX-ELISA positive onion samples using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Two primer pairs were also designed on the basis of sequences obtained in the random RT-PCR approach, targeting a 659-bp fragment of the coat protein region (ShVX-CPs 5'GTTGAATGTGGCGAGCGCAA3' and ShVX-CPas 5'AGTGCAGAAGCCTTCCACA3') or a 686-bp fragment of the replicase (ShVX-Rs 5'ATGTACTTCGGTACGGCATCA3' and ShVX-R-as 5'TAATCGAATGAGGTCGGCCA3'). Fragments of the expected sizes were obtained for all positive samples. One RT-PCR product of each primer pair was directly sequenced, showing high sequence identities to those previously obtained (>98%). The random RT-PCR sequences obtained in this study were submitted to GenBank (JQ751056 and JQ751057). On the basis of the nucleotide sequences obtained with the dsRNA template, ShVX specific RT-PCR, and ELISA, the presence of ShVX in Sudan was confirmed in two consecutive years. To our knowledge, this is the first report of ShVX in Sudan and Africa, indicating this virus is more widespread than previously reported. The presence of ShVX also suggests the presence of its only known vector, the mite Aceria tulipae. The virus may have been introduced to Sudan by infected onion sets. Even if the impact of ShVX on onion production has not been determined, its identification and the availability of a diagnostic antiserum may be helpful to select virus-free propagation material in order to achieve sustainable onion production in Sudan.

Using CF11 cellulose columns to inexpensively and effectively remove human DNA from Plasmodium falciparum-infected whole blood samples

BackgroundGenome and transcriptome studies of Plasmodium nucleic acids obtained from parasitized whole blood are greatly improved by depletion of human DNA or enrichment of parasite DNA prior to next-generation sequencing and microarray hybridization. The most effective method currently used is a two-step procedure to deplete leukocytes: centrifugation using density gradient media followed by filtration through expensive, commercially available columns. This method is not easily implemented in field studies that collect hundreds of samples and simultaneously process samples for multiple laboratory analyses. Inexpensive syringes, hand-packed with CF11 cellulose powder, were recently shown to improve ex vivo cultivation of Plasmodium vivax obtained from parasitized whole blood. This study was undertaken to determine whether CF11 columns could be adapted to isolate Plasmodium falciparum DNA from parasitized whole blood and achieve current quantity and purity requirements for Illumina sequencing.MethodsThe CF11 procedure was compared with the current two-step standard of leukocyte depletion using parasitized red blood cells cultured in vitro and parasitized blood obtained ex vivo from Cambodian patients with malaria. Procedural variations in centrifugation and column size were tested, along with a range of blood volumes and parasite densities.ResultsCF11 filtration reliably produces 500 nanograms of DNA with less than 50% human DNA contamination, which is comparable to that obtained by the two-step method and falls within the current quality control requirements for Illumina sequencing. In addition, a centrifuge-free version of the CF11 filtration method to isolate P. falciparum DNA at remote and minimally equipped field sites in malaria-endemic areas was validated.ConclusionsCF11 filtration is a cost-effective, scalable, one-step approach to remove human DNA from P. falciparum-infected whole blood samples.

The FPase properties and morphology changes of a cellulolytic bacterium, Sporocytophaga sp. JL-01, on decomposing filter paper cellulose

Sporocytophaga sp. JL-01 is a sliding cellulose degrading bacterium that can decompose filter paper (FP), carboxymethyl cellulose (CMC) and cellulose CF11. In this paper, the morphological characteristics of S. sp. JL-01 growing in FP liquid medium was studied by Scanning Electron Microscope (SEM), and one of the FPase components of this bacterium was analyzed. The results showed that the cell shapes were variable during the process of filter paper cellulose decomposition and the rod shape might be connected with filter paper decomposing. After incubating for 120 h, the filter paper was decomposed significantly, and it was degraded absolutely within 144 h. An FPase1 was purified from the supernatant and its characteristics were analyzed. The molecular weight of the FPase1 was 55 kDa. The optimum pH was pH 7.2 and optimum temperature was 50°C under experiment conditions. Zn(2+) and Co(2+) enhanced the enzyme activity, but Fe(3+) inhibited it.

Separation and purification of Toxoplasma gondii tachyzoites from in vitro and in vivo culture systems

In this study, we evaluated four methods to separate and purify Toxoplasma gondii tachyzoites from in vivo and in vitro culture systems, including trypsin digestion, purification with a 3-μm filter, CF-11 cellulose purification, and Percoll purification. Our results indicate that both purification with a 3-μm filter and CF11 cellulose purification methods remove leukocytes or HeLa cells, and can therefore be used as candidate methods for the purification of in vivo and in vitro culture products. Trypsin digestion had a high tachyzoite recovery rate, but 22.35% of leukocytes and 69.64% of HeLa cells remained in the purified products. Percoll solution [30% (v/v)] also had a high tachyzoite recovery rate, but 3.44% of leukocytes and 61.61% of HeLa cells remained in the purified products. The 40% Percoll solution was also a candidate method for purifying tachyzoites from in vivo culture products, with a 65.45% tachyzoite recovery rate and without leukocytes.

Production of Hydrogen from α-1,4- and β-1,4-Linked Saccharides by Marine Hyperthermophilic Archaea

Nineteen hyperthermophilic heterotrophs from deep-sea hydrothermal vents, plus the control organism Pyrococcus furiosus, were examined for their ability to grow and produce H₂ on maltose, cellobiose, and peptides and for the presence of the genes encoding proteins that hydrolyze starch and cellulose. All of the strains grew on these disaccharides and peptides and converted maltose and peptides to H₂ even when elemental sulfur was present as a terminal electron acceptor. Half of the strains had at least one gene for an extracellular starch hydrolase, but only P. furiosus had a gene for an extracellular β-1,4-endoglucanase. P. furiosus was serially adapted for growth on CF11 cellulose and H₂ production, which is the first reported instance of hyperthermophilic growth on cellulose, with a doubling time of 64 min. Cell-specific H₂ production rates were 29 fmol, 37 fmol, and 54 fmol of H₂ produced cell⁻¹ doubling⁻¹ on α-1,4-linked sugars, β-1,4-linked sugars, and peptides, respectively. The highest total community H₂ production rate came from growth on starch (2.6 mM H₂ produced h⁻¹). Hyperthermophilic heterotrophs may serve as an important alternate source of H₂ for hydrogenotrophic microorganisms in low-H₂ hydrothermal environments, and some are candidates for H₂ bioenergy production in bioreactors.

Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae

BackgroundIn most of the infected fungi, the mycoviruses are latent or cryptic, the infected fungus does not show disease symptoms, and it is phenotypically identical to a non-infected strain of the same species. Because of these properties, the initial stage in the search for fungi infected with mycoviruses is the detection of their viral genome, which in most of the described cases corresponds to double-stranded RNA (dsRNA). So to analyze a large number of fungal isolates it is necessary to have a simple and rapid method to detect dsRNA.ResultsA rapid method to isolate dsRNA from a virus-infected filamentous fungus, Botrytis cinerea, and from a killer strain of Saccharomyces cerevisiae using commercial minicolumns packed with CF11 cellulose was developed. In addition to being a rapid method, it allows to use small quantities of yeasts or mycelium as starting material, being obtained sufficient dsRNA quantity that can later be analyzed by agarose gel electrophoresis, treated with enzymes for its partial characterization, amplified by RT-PCR and cloned in appropriate vectors for further sequencing.ConclusionsThe method yields high quality dsRNA, free from DNA and ssRNA. The use of nucleases to degrade the DNA or the ssRNA is not required, and it can be used to isolate dsRNA from any type of fungi or any biological sample that contains dsRNA.

An enzyme-linked immunosorbent assay for measuring desmosine in vivo

Pulmonary emphysema may be a disease in which some elastin in lung is lost. In order to evaluate lung elastin degradation, we developed an enzyme-linked immunosorbent assay for desmosine and measured urinary desmosine excretion and serum desmosine levels in healthy individuals and patients with pulmonary emphysema and other chronic pulmonary disorders. The measurement was performed by the inhibition technique of ELISA so that the samples had to be applied to CF11 cellulose mini-column for partial purification of desmosine. Total urinary excretion of desmosine was uniformly low in healthy individuals and patients with lung cancer, but urinary desmosine was elevated in some cases of pulmonary emphysema and diffuse panbronchiolitis. Using this ELISA method, more than 0.06 micrograms/ml serum desmosine concentration could be measured in 3 out of 25 healthy subjects who had never smoked (13.6%), 4/9 healthy current smokers (44.4%) and 19/26 patients with pulmonary emphysema (73.1%). Mean serum desmosine levels of meseared 19 cases of empysema were 0.182 micrograms/ml. It has been reported that approximately 15% of smokers develop pulmonary emphysema. The most important problem now is whether smokers with elevated urinary desmosine or with high serum desmosine will eventuality develop pulmonary emphysema.

Escherichia coli expression and purification of LL37 fused to a family III carbohydrate-binding module from Clostridium thermocellum

The cathelicidin derived human peptide LL37 has a broad spectrum of antimicrobial and immunomodulatory activities. The large variety of biological activities makes LL37 a very promising candidate for clinical applications. The production of biologically active LL37 in large amounts with reduced costs can only be achieved using recombinant techniques. In this work, LL37 has been cloned to the N- and C-termini of a family III carbohydrate-binding module fused to the linker sequence (LK-CBM3) from Clostridium thermocellum; both constructions (LL37-LK-CBM3 and LK-CBM3-LL37) were cloned into the pET-21a vector. A formic acid recognition site was introduced between the two modules, allowing the isolation of LL37 after chemical cleavage.The recombinant proteins were expressed in Escherichia coli BL21 (DE3) and solubilized with Triton X-100. The purification was achieved using cellulose CF11 fibers, taking advantage of the CBM3 specific affinity for cellulose; after hydrolysis with formic acid, LL37 was further purified by reverse-phase HPLC, as confirmed by MALDI-TOF mass spectrometry. The production and purification methodology developed in this work compares advantageously to other protocols previously described, having fewer purification steps. Only the recombinant LL37 obtained from the C-terminally fused protein (LK-CBM3-LL37) showed antibacterial activity against E. coli K12, with a MIC of 180μg/ml.

Effective Application of CF11 Cellulose for Detection of Apple scar skin viroid in Apple

The low virus titer in woody plant tissues and the presence of inhibitor compounds such as polyphenols, tannins and polysaccharides are common difficulties that compromise purification of plant viroids from their woody hosts. A simple, reliable method of RNA isolation using CF11 cellulose column on a microcentrifuge tube scale for detecting Apple scar skin viroid (ASSVd) in apple was developed. Total RNA extracted from leaf, woody bark and the fruit skin was used for reverse transcription. RT-PCR products could be detected from RNA prepared from dormant woody bark, fruit skin and fresh leaves with both the CF11 cellulose column method and NucliSens extractor in February, August and November. Meanwhile, with the RNeasy kit RT-PCR, products were detected only in leaves and not from bark or fruit skin. The PCR product, about 330 base pairs, was analyzed by agarose gel electrophoresis. The CF11 cellulose column method was effective for detecting ASSVd. The method enabled the processing of a large numbers of samples of dormant woody bark, leaf and fruit skin of apple.

Effective and cheap removal of leukocytes and platelets from Plasmodium vivax infected blood

BackgroundInvestigations of Plasmodium vivax are restricted to samples collected from infected persons or primates, because this parasite cannot be maintained in in vitro cultures. Contamination of P. vivax isolates with host leukocytes and platelets is detrimental to a range of ex vivo and molecular investigations. Easy-to-produce CF11 cellulose filters have recently provided us with an inexpensive method for the removal of leukocytes and platelets. This contrasted with previous reports of unacceptably high levels of infected red blood cell (IRBC) retention by CF11. The aims of this study were to compare the ability of CF11 cellulose filters and the commercial filter Plasmodipur at removing leukocyte and platelet, and to investigate the retention of P. vivax IRBCs by CF11 cellulose filtration.Methods and ResultsSide-by-side comparison of six leukocyte removal methods using blood samples from five healthy donor showed that CF11 filtration reduced the mean initial leukocyte counts from 9.4 × 103 per μl [95%CI 5.2–13.5] to 0.01 × 103 [95%CI 0.01–0.03]. The CF11 was particularly effective at removing neutrophils. CF11 treatment also reduced initial platelet counts from 211.6 × 103 per μl [95%CI 107.5–315.7] to 0.8 × 103 per μl [95%CI -0.7–2.2]. Analysis of 30 P. vivax blood samples before and after CF11 filtration showed only a minor loss in parasitaemia (≤ 7.1% of initial counts). Stage specific retention of P. vivax IRBCs was not observed.ConclusionCF11 filtration is the most cost and time efficient method for the production of leukocyte- and platelet-free P. vivax-infected erythrocytes from field isolates.

Recombinant plant dsRNA-binding protein as an effective tool for the isolation of viral replicative form dsRNA and universal detection of RNA viruses

The isolation of viral replicative form (RF) double-stranded RNA (dsRNA) is a classic technique for plant virus detection when the virus species cannot be predicted from disease symptoms. However, the method has not been very widely used, most likely because dsRNA isolation using CF-11 cellulose is laborious and time-consuming. Here we report an alternative tool, a recombinant plant dsRNA-binding protein, to isolate dsRNA. This tool enables us to isolate viral RF dsRNA in an hour from either extracted nucleic acids or crude detergent extracts. Combining this technique with sequence-non-specific reverse transcription, PCR amplification, cloning, and sequencing, a variety of viruses were efficiently detected using a single set of reagents and procedures.

Separation of hypoviral double-stranded RNA on monolithic chromatographic supports

A procedure based on BIA Separations CIM DEAE anion-exchange chromatography was developed to separate double-stranded (ds) RNA of hypovirus infecting phytopathogenic fungus Cryphonectria parasitica. Using a linear gradient of 25 mM 4-morpholinepropanesulfonic acid (MOPS), pH 7.0 as a binding buffer, and 25 mM MOPS, 1.5 M NaCl, 0.1 mM EDTA, 15% isopropanol (v/v), pH 7.0 as an elution buffer, hypoviral dsRNA was additionally purified from nucleic acid species present in preparations partially purified by standard CF-11 cellulose chromatography. Moreover, crude phenol/chloroform extracts of the fungal tissue were also applied to monolithic supports and CIM DEAE chromatograms revealed clear evidence for hypoviral presence without CF-11 chromatography, nucleic acid precipitation, and electrophoresis.

A non-phenol–chloroform extraction of double-stranded RNA from plant and fungal tissues

Double-stranded RNA (dsRNA) molecules of viruses are found in nature at a very high frequency. Their detection in plants and fungi has been carried out with difficulty due to the complicated dsRNA extraction techniques used commonly which includes phenol–chloroform extractions. In this study, an extraction method for isolation of dsRNA is described that is free of phenol and chloroform. A lysis buffer, containing β-mercaptoethanol and polyvinylpolypyrrolidone (PVPP-40), was added to homogenised tissues and the subsequent supernatant was filtered through a cellulose CF-11 mini-column. DsRNA molecules were separated based on the differing affinity of nucleic acids for the cellulose CF-11 resin in 20% ethanol buffer. This easy, rapid and cheap technique has been successfully tested on fungi and plants containing different dsRNA virus molecules, indicating the possibility of a wide use of the method.