Cf Resistance Genes Research Articles

Analysis of five near-complete genome assemblies of the tomato pathogen Cladosporium fulvum uncovers additional accessory chromosomes and structural variations induced by transposable elements effecting the loss of avirulence genes

BackgroundFungal plant pathogens have dynamic genomes that allow them to rapidly adapt to adverse conditions and overcome host resistance. One way by which this dynamic genome plasticity is expressed is through effector gene loss, which enables plant pathogens to overcome recognition by cognate resistance genes in the host. However, the exact nature of these loses remains elusive in many fungi. This includes the tomato pathogen Cladosporium fulvum, which is the first fungal plant pathogen from which avirulence (Avr) genes were ever cloned and in which loss of Avr genes is often reported as a means of overcoming recognition by cognate tomato Cf resistance genes. A recent near-complete reference genome assembly of C. fulvum isolate Race 5 revealed a compartmentalized genome architecture and the presence of an accessory chromosome, thereby creating a basis for studying genome plasticity in fungal plant pathogens and its impact on avirulence genes.ResultsHere, we obtained near-complete genome assemblies of four additional C. fulvum isolates. The genome assemblies had similar sizes (66.96 to 67.78 Mb), number of predicted genes (14,895 to 14,981), and estimated completeness (98.8 to 98.9%). Comparative analysis that included the genome of isolate Race 5 revealed high levels of synteny and colinearity, which extended to the density and distribution of repetitive elements and of repeat-induced point (RIP) mutations across homologous chromosomes. Nonetheless, structural variations, likely mediated by transposable elements and effecting the deletion of the avirulence genes Avr4E, Avr5, and Avr9, were also identified. The isolates further shared a core set of 13 chromosomes, but two accessory chromosomes were identified as well. Accessory chromosomes were significantly smaller in size, and one carried pseudogenized copies of two effector genes. Whole-genome alignments further revealed genomic islands of near-zero nucleotide diversity interspersed with islands of high nucleotide diversity that co-localized with repeat-rich regions. These regions were likely generated by RIP, which generally asymmetrically affected the genome of C. fulvum.ConclusionsOur results reveal new evolutionary aspects of the C. fulvum genome and provide new insights on the importance of genomic structural variations in overcoming host resistance in fungal plant pathogens.

Understanding the mechanisms of resistance to tomato leaf mold: A review

Tomato leaf mold is a common disease in tomato production and severely impacts the growth, fruit quality and yield of tomato plants. Research on tomato leaf mold has a long history and has focused mainly on the differentiation of pathogen races, the structure and function of pathogen Avr gene products, the cloning of Cf resistance genes and the analysis of disease resistance mechanisms. Interactions between Cf and Avr are in accordance with the "gene-for-gene" hypothesis and typical Cf/Avr interactions are part of effector-triggered immunity (ETI). However, an increasing number of studies have proven that pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) is involved in the disease resistance response system mediated by Cf genes. In addition, different Cf genes have both similar and different roles in the disease resistance response, indicating that the disease resistance mechanism of Cf genes is complex. In this paper, progress in tomato leaf mold research was reviewed, and the regulatory mechanism underlying the Cf-mediated disease resistance response was thoroughly explored. We hope this summary will lay a foundation for research on tomato leaf mold disease resistance mechanisms and is applicable to breeding for disease resistance.

Characterization of tomato leaf mould pathogen, Passalora fulva, in Croatia

Leaf mould (Passalora fulva) has emerged as an important disease of greenhouse-growing tomato crops in Croatia during the last decade. In order to establish sustainable control measures, the presence of P. fulva races was investigated, in vitro sensitivity of the fungus to several fungicidal products was tested, and susceptibility of some old tomato varieties was checked. Seventeen isolates were collected from different parts of Croatia and inoculated on tomato cv. ‘Moneymaker’ differentials with different resistance genes (Cf-2, Cf-4, Cf-5 and Cf-9) or without resistance genes (Cf-0). Based on symptoms appearance assessment, 11 isolates were determined as P. fulva race 2, two isolates as race 5, one isolate as race 2.5 and three isolate as race 0. Sequence analysis of the Avr2 gene of five P. fulva race 2 isolates showed and insertion of adenine at 117_119 bp compared to the reference Avr2 wild-type gene retrieved from GenBank®, which leads to amino acid change from Tyrosine to Valine (p. Tyr41ValfsX1) in Avr2 protein. Pathogenicity tests with a P. fulva race 2 isolate on seven old tomato varieties lead to the development of leaf mould symptoms on four of seven varieties. Sensitivity of a selected P. fulva race 2 isolate was examined on agar plates amended with four fungicides products which were authorized in Croatia at that time for control different diseases on tomato. According to the results, Signum® was significantly and constantly the most effective product across all assessment periods.

The first report on the occurrence race 9 of the tomato leaf mold pathogen Cladosporium fulvum (syn. Passalora fulva) in Cuba

Leaf mold caused by the fungus Cladosporium fulvum (syn. Passalora fulva) has been a serious disease in greenhouse tomatoes in Cuba, but less damage is seen in outdoor grown plants. This study was conducted to identify races of the causal agent of tomato leaf mold. A total of 36 single conidial isolates obtained from different provinces in Cuba and the reference strain race 0 were inoculated on a differential set of tomato cultivars carrying different Cf resistance genes. Further, a polymerase chain reaction (PCR) was developed using Avr9 gene-specific primers. As result, all isolates could overcome the Cf-9 resistance gene only, but not resistance genes Cf-2, Cf-4 and Cf-5 and must therefore be coined race 9. Race identity was also confirmed by PCR analysis, which showed that the Avr9 gene was not amplified in any of 36 single conidial isolates studied proving that they all lack this gene. This is the first report of the occurrence of race 9 of C. fulvum in Cuba. Pyramiding other Cf genes in hybrid of tomato may provide a more durable level of resistance to C. fulvum.

Occurrence of tomato leaf mold caused by novel race 2.4.9 of Cladosporium fulvum in Japan

Leaf mold disease caused by Cladosporium fulvum appeared on tomato cultivars carrying the Cf-9 resistance gene in Nara Prefecture, Japan, in 2018. We inoculated a differential set of tomato cultivar with six isolates of the fungus and identified two isolates as race 2.9 and four as 2.4.9. We also sequenced their Avr and mating-type genes. All Avr alleles have been found previously in Japanese populations of C. fulvum, but the genotypes of both races were new, suggesting that these isolates have newly emerged in Nara Prefecture.

Knocking down expression of the auxin-amidohydrolase IAR3 alters defense responses in Solanaceae family plants

In plants, indole-3-acetic acid (IAA) amido hydrolases (AHs) participate in auxin homeostasis by releasing free IAA from IAA-amino acid conjugates. We investigated the role of IAR3, a member of the IAA amido hydrolase family, in the response of Solanaceous plants challenged by biotrophic and hemi-biotrophic pathogens. By means of genome inspection and phylogenic analysis we firstly identified IAA-AH sequences and putative IAR3 orthologs in Nicotiana benthamiana, tomato and potato. We evaluated the involvement of IAR3 genes in defense responses by using virus-induced gene silencing. We observed that N. benthamiana and tomato plants with knocked-down expression of IAR3 genes contained lower levels of free IAA and presented altered responses to pathogen attack, including enhanced basal defenses and higher tolerance to infection in susceptible plants. We showed that IAR3 genes are consistently up-regulated in N. benthamiana and tomato upon inoculation with Phytophthora infestans and Cladosporium fulvum respectively. However, IAR3 expression decreased significantly when hypersensitive response was triggered in transgenic tomato plants coexpressing the Cf-4 resistance gene and the avirulence factor Avr4. Altogether, our results indicate that changes in IAR3 expression lead to alteration in auxin homeostasis that ultimately affects plant defense responses.

Identification of race 2.5 of leaf mold (Passalora fulva, syn. Cladosporium fulvum) on tomato

Leaf mold caused by the fungus Passalora fulva has been a serious disease in greenhouse tomatoes in Turkey. This study was conducted to determine races of tomato leaf mold that caused by the P. fulva. Single-spore cultures of twenty-two isolates were obtained from infected samples that are collected from different greenhouses which product tomato in Fethiye and Ortaca. According to the morphological characters, all of the 22 isolates were identified as P. fulva. All isolates of P. fulva were highly pathogenic to the susceptible tomato cultivars (Moneymaker (MM)-Cf-0). These isolates were tested for determination of races of P. fulva on a set of tomato differentials (MM-Cf-0, MM-Cf-2, MM-Cf-4, MM-Cf-5, MM-Cf-9) with different Cf resistance genes. To our knowledge, according to the result of this study, physiological races of this pathogen were identified as race 2.5 for the first time in Ortaca and Fethiye districts of Mugla province.

Mapping and candidate gene screening of tomato Cladosporium fulvum-resistant gene Cf-19, based on high-throughput sequencing technology.

BackgroundTomato leaf mold is a common disease in tomato cultivation. This disease is caused by Cladosporium fulvum, which has many physiological races and differentiates rapidly. Cf genes confer resistance to C. fulvum, and the C. fulvum-tomato pathosystem is a model for the study of gene-for-gene interactions. Plants carrying the Cf-19 gene show effective resistance to C. fulvum in the field, and can be used in breeding and resistance mechanism studies as new resistant materials. In this study, we used F2 bulk specific-locus amplified fragment sequencing (SLAF-seq) and parental resequencing methods to locate and characterize the Cf-19 gene.ResultsA total of 4108 Diff_markers and three association regions were found in association analysis. A 2.14-Mb region containing seven Cf-type genes was identified in further analysis based on data from SLAF-seq and parental resequencing. Two candidate genes, Solyc01g006550.2.1 and Solyc01g005870.1.1, were screened out by quantitative real-time PCR (qRT-PCR) analysis. Sequence analysis showed that Solyc01g006550.2.1 (an allelic locus of Cf-0) in CGN18423 was a novel homologue of the Cladosporium resistance gene Cf-9 (Hcr9s) in the Cf-4/9 locus. The marker P7, which cosegregated with the resistant trait, was developed based on sequence mutation of the Solyc01g006550.2.1 locus in CGN18423.ConclusionsThe Cf-19 gene was mapped to the short arm of chromosome 1. The candidate genes Solyc01g006550.2.1 and Solyc01g005870.1.1 showed related amino acid sequence structures and expression patterns. Solyc01g006550.2.1 had a close evolutionary relationship with the functional Hcr9 members Cf-4 and Cf-9, and was very different from non-functional members. The results from this study will facilitate the breeding of cultivars carrying the Cf-19 gene and provide a basis for further gene cloning, resistance gene evolution and plant resistance mechanism studies.Electronic supplementary materialThe online version of this article (doi:10.1186/s12870-016-0737-0) contains supplementary material, which is available to authorized users.

Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9

Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8–54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

A Survey on Occurrence of Cladosporium fulvum Identifies Race 0 and Race 2 in Tomato-Growing Areas of Argentina.

The presence of Cladosporium fulvum (syn. Passalora fulva), causal agent of tomato leaf mold, was confirmed in the two main greenhouse-production areas for tomato in Argentina. Using both morphological characters and internal transcribed spacer sequencing, we confirmed the presence of physiological races of this pathogen. A diagnostic multiplex polymerase chain reaction (PCR) was also developed, using primers derived from C. fulvum avirulence (Avr) genes. In all, 20 isolates of Cladosporium spp. were obtained as monospore cultures and 12 were identified as C. fulvum. By this method, we showed that, of these 12 isolates, 5 were race 0 (carrying functional Avr2, Avr4, Avr4E, and Avr9 genes) and 7 were race 2 (lacking the Avr2 gene). Race identity was confirmed by testing their virulence on a set of tomato differentials carrying different Cf resistance genes. All Avr genes could be amplified in single or multiplex PCR using DNA isolated from in vitro grown monospore cultures but only three Avr could be amplified when genomic DNA was isolated from C. fulvum-infected necrotic leaf tissue.

Novel Mutations Detected in Avirulence Genes Overcoming Tomato Cf Resistance Genes in Isolates of a Japanese Population of Cladosporium fulvum.

Leaf mold of tomato is caused by the biotrophic fungus Cladosporium fulvum which complies with the gene-for-gene system. The disease was first reported in Japan in the 1920s and has since been frequently observed. Initially only race 0 isolates were reported, but since the consecutive introduction of resistance genes Cf-2, Cf-4, Cf-5 and Cf-9 new races have evolved. Here we first determined the virulence spectrum of 133 C. fulvum isolates collected from 22 prefectures in Japan, and subsequently sequenced the avirulence (Avr) genes Avr2, Avr4, Avr4E, Avr5 and Avr9 to determine the molecular basis of overcoming Cf genes. Twelve races of C. fulvum with a different virulence spectrum were identified, of which races 9, 2.9, 4.9, 4.5.9 and 4.9.11 occur only in Japan. The Avr genes in many of these races contain unique mutations not observed in races identified elsewhere in the world including (i) frameshift mutations and (ii) transposon insertions in Avr2, (iii) point mutations in Avr4 and Avr4E, and (iv) deletions of Avr4E, Avr5 and Avr9. New races have developed by selection pressure imposed by consecutive introductions of Cf-2, Cf-4, Cf-5 and Cf-9 genes in commercially grown tomato cultivars. Our study shows that molecular variations to adapt to different Cf genes in an isolated C. fulvum population in Japan are novel but overall follow similar patterns as those observed in populations from other parts of the world. Implications for breeding of more durable C. fulvum resistant varieties are discussed.

토마토 Cf-9 저항성 품종에 잎곰팡이병을 일으키는 Fulvia fulva 균주의 국내 발생

2012년 충남 부여에서 Fulvia fulva 저항성 유전자 Cf-9를 가지고 있는 토마토 품종('큐티', '도태랑다이아', '유니콘', '라피토')에서 잎곰팡이병이 크게 발생하였다. 이들 4개 Cf-9 토마토 품종으로부터 총 15개 균주를 분리하였다. 이들은 모두 형태적 특성이 같았으므로 이들 중 9개 균주를 선발하여 ITS rDNA 염기서열을 분석하여 동정한 결과, 모든 균주는 F. fulva임을 알 수 있었다. Cf-4, Cf-5 그리고 Cf-9 저항성 품종에 대한 분리한 15개 균주의 병원성을 검정하였다. 모든 균주들은 Cf-9 품종인 '큐티'와 '슈퍼도태랑' 그리고 Cf-5 품종 '요요캡틴'에서 강한 병원성을 나타냈다. 반면에 Cf-4 품종인 '슈퍼도태랑'에서는 5개의 균주만이 병원성을 나타내었고, 나머지 균주들에 대해서 이 품종은 저항성을 보였다. 그리고 Cf-9 품종에는 감수성을 그리고 Cf-4 품종엔 저항성을 나타내는 두 균주를 선발하여 Cf-9 품종으로 보고된 시판 중인 토마토 17개 품종에 대한 이들의 병원성을 조사하였다. 이들 중 15개 품종은 감수성을, 그리고 2개 품종은 저항성을 보였다. 이는 저항성 두 품종이 다른 저항성 유전자를 가지고 있기 때문으로 생각되었다. 본 논문은 우리나라에서 Cf-9 토마토 품종에 잎곰팡이병을 일으키는 F. fulva 균주의 발생을 처음으로 보고하는 것이다. Leaf mold symptoms were found on commercial tomato cultivars carrying the Cf-9, a resistance gene to leaf mold pathogen Fulvia fulva in 2012 at Buyeo, Chungnam in Korea. Fifteen-fungal isolates were obtained from four Cf-9 cultivars of tomato including 'Cutie', 'otaerangdia', 'Unicorn' and 'Rapito'. Due to their same morphological appearances and colony color, nine isolates were selected and identified as F. fulva based on molecular analysis of the internal transcribed spacer rDNA sequence. Pathogenicity of the 15 isolates on five commercial cultivars carrying Cf-4, Cf-5, and Cf-9 were tested. All the isolates showed strong pathogenicity on Cf-9 cultivars, 'Cutie' and 'Dotaerangdia', and Cf-5 cultivar, 'Yoyocaptain'. In contrast, on Cf-4 cultivar, 'Superdotaerang', five isolates were virulent and the other isolates were not. In addition, two fungal isolates, infecting Cf-9 cultivar and non-infecting Cf-4 cultivar, were selected and their pathogenicity was tested on 17 commercial cultivars reported as tomato having Cf-9 resistance gene. Among them, 15 cultivars were susceptible and 2 cultivars were resistant. It is likely that the two cultivars include other resistance gene. To our knowledge, this is the first report on the occurrence of Cf-9 infecting F. fulfva strains in Korea.

Positive selection and intragenic recombination contribute to high allelic diversity in effector genes of Mycosphaerella fijiensis, causal agent of the black leaf streak disease of banana

Previously, we have determined the nonhost-mediated recognition of the MfAvr4 and MfEcp2 effector proteins from the banana pathogen Mycosphaerella fijiensis in tomato, by the cognate Cf-4 and Cf-Ecp2 resistance proteins, respectively. These two resistance proteins could thus mediate resistance against M. fijiensis if genetically transformed into banana (Musa spp.). However, disease resistance controlled by single dominant genes can be overcome by mutated effector alleles, whose products are not recognized by the cognate resistance proteins. Here, we surveyed the allelic variation within the MfAvr4, MfEcp2, MfEcp2-2 and MfEcp2-3 effector genes of M. fijiensis in a global population of the pathogen, and assayed its impact on recognition by the tomato Cf-4 and Cf-Ecp2 resistance proteins, respectively. We identified a large number of polymorphisms that could reflect a co-evolutionary arms race between host and pathogen. The analysis of nucleotide substitution patterns suggests that both positive selection and intragenic recombination have shaped the evolution of M. fijiensis effectors. Clear differences in allelic diversity were observed between strains originating from South-East Asia relative to strains from other banana-producing continents, consistent with the hypothesis that M. fijiensis originated in the Asian-Pacific region. Furthermore, transient co-expression of the MfAvr4 effector alleles and the tomato Cf-4 resistance gene, as well as of MfEcp2, MfEcp2-2 and MfEcp2-3 and the putative Cf-Ecp2 resistance gene, indicated that effector alleles able to overcome these resistance genes are already present in natural populations of the pathogen, thus questioning the durability of resistance that can be provided by these genes in the field.

Occurrence of a new race 2.9 of leaf mold of tomato in Japan

Leaf mold symptoms were found on tomato varieties carrying the Cf-9 resistance gene against Passalora fulva, the causal agent of leaf mold, in Japan in 2008. Disease symptoms and morphological characteristics of the isolates were similar to those of P. fulva. After inoculating a set of tomato differentials with the isolates, all isolates were identified as race 2.9 of P. fulva, previously unreported.

IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF VF-LIKE CANDIDATE GENES IN CULTIVATED APPLES AND SELECTIONS FROM MALUS SIEVERSII

The genetic locus for resistance to apple scab most frequently used in apple breeding is Vf, derived from Malus floribunda 821. For the Vf locus a cluster of four resistance gene paralogs encoding receptor-like proteins (RLP) with similarity to the tomato Cf resistance genes is known. Based on nucleotide alignments of published sequences of HcrVf1, HcrVf2, and HcrVf3, PCR primers were designed from the variable leucine-rich repeat (LRR) C1 subdomain. PCR products with high amino acid identity (85 to 100%) to HcrVf1 and HcrVf2 were obtained not only from M. floribunda 821 and Vf cultivars, but also from other apple scab resistance sources, such as ‘Russian Seedling’ R12740-7A or some ‘Antonovka’ accessions tested. A series of thirteen HcrVf candidate genes have been partly cloned from the PCR fragments spanning N-terminal LRRs 20 - 30. Expression analyses and mapping were focused on two specific Vf-homologous candidate genes, Vf1RSA and Vf2ARD, identified in resistant Malus genotypes known for carrying other scab resistance genes than Vf. RT-PCR experiments showed that Vf1RSA as well as the Vf2ARD are expressed under pathogen-free conditions. The results of a quantitative PCR-based transcription profiling performed for Vf2ARD suggest that this gene is scab-inducible in some resistant cultivars. Vf1RSA has been mapped, so far, without any recombination to the known Vf gene cluster on linkage group LG 1. The second candidate gene Vf2ARD is separated from the Vf gene cluster with a genetic distance of about 2 cM and might be a member of a second Vf-like locus on apple linkage group LG 1.

Quantitative Phosphoproteomics of Tomato Mounting a Hypersensitive Response Reveals a Swift Suppression of Photosynthetic Activity and a Differential Role for Hsp90 Isoforms

An important mechanism by which plants defend themselves against pathogens is the rapid execution of a hypersensitive response (HR). Tomato plants containing the Cf-4 resistance gene mount an HR that relies on the activation of phosphorylation cascades, when challenged with the Avr4 elicitor secreted by the pathogenic fungus Cladosporium fulvum. Phosphopeptides were isolated from tomato seedlings expressing both Cf-4 and Avr4 using titanium dioxide columns and LC-MS/MS analysis led to the identification of 50 phosphoproteins, most of which have not been described in tomato before. Phosphopeptides were quantified using a label-free approach based on the MS peak areas. We identified 12 phosphopeptides for which the abundance changed upon HR initiation, as compared to control seedlings. Our results suggest that photosynthetic activity is specifically suppressed in a phosphorylation-dependent way during the very early stages of HR development. In addition, phosphopeptides originating from four Hsp90 isoforms exhibited altered abundances in Cf-4/Avr4 seedlings compared to control seedlings, suggesting that the isoforms of this chaperone protein have a different function in defense signaling. We show that label-free relative quantification of the phosphoproteome of complex samples is feasible, allowing extension of our knowledge on the general physiology and defense signaling of plants mounting the HR.

Identification and molecular analysis of candidate genes homologous toHcrVfgenes for scab resistance in apple

AbstractThe genetic locus for resistance to apple scab most frequently used in apple breeding isVf, derived fromMalus floribunda821. For theVflocus a cluster of four resistance gene paralogs (called asHcrVfgenes) encoding receptor‐like proteins (RLP) with similarity to the tomatoCfresistance genes is known. Based on published sequences forHcrVf1andHcrVf2PCR primers were designed from the domain B and the variable leucine‐rich repeat (LRR) C1 subdomain. PCR products with high amino acid identity (85–100%) toHcrVf1andHcrVf2were obtained not only fromM. floribunda821 andVfcultivars but also from other apple scab resistance sources, such as ‘Russian Seedling’ R12740‐7A (Vrresistance) or ‘Antonovka polutorafuntovaya’ (VAresistance). A series of 13HcrVfcandidate genes have been partly cloned from the PCR fragments spanning N‐terminal LRRs 20–30. A considerable number of amino acid exchanges within the solvent‐exposed xxLxLxx structural motives were detected among the homologous sequences. Expression analyses and mapping focused on a selectedVf‐homologous candidate gene (calledVf2ARD) identified in resistantMalusgenotypes known for carrying other scab resistance genes thanVf. RT‐PCR experiments showed thatVf2ARDis expressed under pathogen‐free conditions. The results of a quantitative PCR‐based transcription profiling suggest that this gene is scab‐inducible in some resistant cultivars.Vf2ARDhas been mapped on linkage group LG 1. It is separated from theVfgene cluster with a genetic distance of about 2 cM and might be a member of a secondVf ‐like locus on apple linkage group LG 1.

Tomato mitogen-activated protein kinases LeMPK1, LeMPK2, and LeMPK3 are activated during the Cf-4/Avr4-induced hypersensitive response and have distinct phosphorylation specificities.

Tomato (Solanum lycopersicum) plants with the Cf-4 resistance gene recognize strains of the pathogenic fungus Cladosporium fulvum that secrete the avirulence protein Avr4. Transgenic tomato seedlings coexpressing Cf-4 and Avr4 mount a hypersensitive response (HR) at 20 degrees C, which is suppressed at 33 degrees C. Within 120 min after a shift from 33 degrees C to 20 degrees C, tomato mitogen-activated protein (MAP) kinase (LeMPK) activity increases in Cf-4/Avr4 seedlings. Searching tomato genome databases revealed at least 16 LeMPK sequences, including the sequence of LeMPK1, LeMPK2, and LeMPK3 that cluster with biotic stress-related MAP kinase orthologs from Arabidopsis (Arabidopsis thaliana) and tobacco (Nicotiana tabacum). LeMPK1, LeMPK2, and LeMPK3 are simultaneously activated in Cf-4/Avr4 seedlings, and, to reveal whether they are functionally redundant or not, recombinant LeMPKs were incubated on PepChip Kinomics slides carrying peptides with potential phosphorylation sites. Phosphorylated peptides and motifs present in them discriminated between the phosphorylation specificities of LeMPK1, LeMPK2, and LeMPK3. LeMPK1, LeMPK2, or LeMPK3 activity was specifically suppressed in Cf-4-tomato by virus-induced gene silencing and leaflets were either injected with Avr4 or challenged with C. fulvum-secreting Avr4. The results of these experiments suggested that the LeMPKs have different but also overlapping roles with regard to HR and full resistance in tomato.

An NB‐LRR protein required for HR signalling mediated by both extra‐ and intracellular resistance proteins

Tomato (Solanum lycopersicum) Cf resistance genes confer hypersensitive response (HR)-associated resistance to strains of the pathogenic fungus Cladosporium fulvum that express the matching avirulence (Avr) gene. Previously, we identified an Avr4-responsive tomato (ART) gene that is required for Cf-4/Avr4-induced HR in Nicotiana benthamiana as demonstrated by virus-induced gene silencing (VIGS). The gene encodes a CC-NB-LRR type resistance (R) protein analogue that we have designated NRC1 (NB-LRR protein required for HR-associated cell death 1). Here we describe that knock-down of NRC1 in tomato not only affects the Cf-4/Avr4-induced HR but also compromises Cf-4-mediated resistance to C. fulvum. In addition, VIGS using NRC1 in N. benthamiana revealed that this protein is also required for the HR induced by the R proteins Cf-9, LeEix, Pto, Rx and Mi. Transient expression of NRC1(D481V), which encodes a constitutively active NRC1 mutant protein, triggers an elicitor-independent HR. Subsequently, we transiently expressed this auto-activating protein in N. benthamiana silenced for genes known to be involved in HR signalling, thereby allowing NRC1 to be positioned in an HR signalling pathway. We found that NRC1 requires RAR1 and SGT1 to be functional, whereas it does not require NDR1 and EDS1. As the Cf-4 protein requires EDS1 for its function, we hypothesize that NRC1 functions downstream of EDS1. We also found that NRC1 acts upstream of a MAP kinase pathway. We conclude that Cf-mediated resistance signalling requires a downstream NB-LRR protein that also functions in cell death signalling pathways triggered by other R proteins.

CDNA-AFLP Combined with Functional Analysis Reveals Novel Genes Involved in the Hypersensitive Response

To identify genes required for the hypersensitive response (HR), we performed expression profiling of tomato plants mounting a synchronized HR, followed by functional analysis of differentially expressed genes. By cDNA-AFLP analysis, the expression profile of tomato plants containing both the Cf-4 resistance gene against Cladosporium fulvum and the matching Avr4 avirulence gene of this fungus was compared with that of control plants. About 1% of the transcript-derived fragments (442 out of 50,000) were derived from a differentially expressed gene. Based on their sequence and expression, 192 fragments, referred to as Avr4-responsive tomato (ART) fragments, were selected for VIGS (virus-induced gene silencing) in Cf-4-transgenic Nicotiana benthamiana. Inoculated plants were analyzed for compromised HR by agroinfiltration of either the C. fulvum Avr4 gene or the Inf1 gene of Phytophthora infestans, which invokes a HR in wild-type N. benthamiana. VIGS using 15 of the ART fragments resulted in a compromised HR, whereas VIGS with fragments of ART genes encoding HSP90, a nuclear GTPase, an L19 ribosomal protein, and most interestingly, a nucleotide binding-leucine rich repeat (NB-LRR)-type protein severely suppressed the HR induced both by Avr4 and Inf1. Requirement of an NB-LRR protein (designated NRC1, for NB-LRR protein required for HR-associated cell death 1) for Cf resistance protein function as well as Inf1-mediated HR suggests a convergence of signaling pathways and supports the recent observation that NB-LRR proteins play a role in signal transduction cascades downstream of resistance proteins.