Cervico-vaginal Mucus Samples Research Articles

Field application of a combined serological-molecular testing protocol for diagnosing genital leptospirosis in naturally infected cows with gestational losses.

Bovine genital leptospirosis (BGL) causes chronic reproductive disease in cattle. This study aimed to apply a combined serological-molecular testing protocol under field conditions for diagnosing BGL in cows with gestational losses. Three beef herds with reproductive failures were studied, and 60 cowswith gestational losses (20 from each herd) were randomly selected for laboratory diagnosis of BGL. In addition, 40 cows with normal pregnancy were included as a control. Blood samples were collected from all 100 cows for microscopic agglutination testing, and cervicovaginal mucus (CVM) samples were collected from 28 cows with gestational losses and 20 control cows for lipL32-PCR. All herds had high Leptospira seroreactivity (>65%), mainly against serogroup Sejroe. Ten of the 28 CVM samples from cows with gestational losses were PCR-positive, while all samples from the control group were negative (p < 0.05). Unfortunately, the positive samples did not amplify in secY-PCR for nucleotide sequencing, which would allow the identification of leptospiral strains. Serology was sufficient to indicate leptospirosis at the herd level, but the definitive diagnosis of BGL was only possible using CVM PCR. Although seroreactivity against serogroup Sejroe has been associated with gestational losses, this is the first study to conduct CVM PCR as a confirmatory test for BGL diagnosis in extensive beef herds under field conditions.

Bovine campylobacteriosis in heifer: pathogenesis study and insights in the conventional and molecular diagnosis in an experimental bovine model and field cases.

Campylobacter fetus spp. is a bacterium associated to reproductive losses in cattle worldwide. It is a venereal infectious disease known as bovine campilobacteriosis, with high impact mainly in countries with extensive production systems. Here, we show pathogenesis and diagnostic methods for Campylobacter fetus detection in cervico-vaginal mucus (CVM) samples from heifers experimentally infected and field cases from herds with low reproductive performance by campylobacteriosis infection. Bacterial culture, direct immunofluorescence test and qPCR were used as diagnostic methods to evaluate detection of C. fetus. In the experimental model 30 Aberdeen Angus and crossbred heifers and 4 Aberdeen Angus bulls for natural mating were assigned to 3 groups experimentally challenged with C. fetus subsp. fetus (Cff), C. fetus subsps venerealis (Cfv) and C. fetus subsp venerealis biovar intermedius (Cfvi), respectively, and a negative control group, all followed for 9 months. Also, field samples of CVM and aborted fetuses were recollected from seven beef cattle farms. Bacteriological culture had the higher C. fetus detection rate in CVM being the most appropriate, followed by qPCR (with commercial extraction DNA kit), direct immunofluorescence test and qPCR (with in-house extraction DNA method), in both, experimental model and field cases. From experimental model after natural mating, 62.5% and 25% heifers got pregnant from Cff and Cfvi groups, respectively, while from Cfv no pregnancy was detected. The strain more frequently detected was Cfvi, followed by Cff and Cfv. Colonization of Cff in female genital tract with high number of carriers and presence in aborted fetuses was evidenced, suggesting a high risk to bovine reproductive health. Bacteriemia was not detected after genital infection. Given the low detection rate of either test, we suggest the use of both, PCR based methods and bacterial culture could result in higher detection rate in farms with endemic campylobacteriosis.

Cervicovaginal mucus barrier properties during pregnancy are impacted by the vaginal microbiome.

Mucus in the female reproductive tract acts as a barrier that traps and eliminates pathogens and foreign particles via steric and adhesive interactions. During pregnancy, mucus protects the uterine environment from ascension of pathogens and bacteria from the vagina into the uterus, a potential contributor to intrauterine inflammation and preterm birth. As recent work has demonstrated the benefit of vaginal drug delivery in treating women's health indications, we sought to define the barrier properties of human cervicovaginal mucus (CVM) during pregnancy to inform the design of vaginally delivered therapeutics during pregnancy. CVM samples were self-collected by pregnant participants over the course of pregnancy, and barrier properties were quantified using multiple particle tracking. 16S rRNA gene sequencing was performed to analyze the composition of the vaginal microbiome. Participant demographics differed between term delivery and preterm delivery cohorts, with Black or African American participants being significantly more likely to delivery prematurely. We observed that vaginal microbiota is most predictive of CVM barrier properties and of timing of parturition. Lactobacillus crispatus dominated CVM samples showed increased barrier properties compared to polymicrobial CVM samples. This work informs our understanding of how infections occur during pregnancy, and directs the engineering of targeted drug treatments for indications during pregnancy.

Streptomycin treatment of genital carriers of Leptospira in experimentally infected sheep on different estrous phases

Leptospirosis in ruminants presents as a chronic disease that causes several reproductive disorders leading to severe economic losses. The current recommended treatment can be efficient to eliminate the renal carrier state, however little is known about the effect of this drug in removing the genital carrier state and the hormonal influence on it. A total of 12 primiparous sheep experimentally infected with a strain of Leptospira santarosai serogroup Sejroe, FV52 strain, were used and distributed as group A (estrus; n = 5), group B (metaestrus; n = 4) and group C (control; n = 3). At D0, groups A and B were treated with streptomycin (25 mg/kg) single dose. Samples of cervicovaginal mucus (CVM) were collected on days 0, 3, and 35 post-treatment, while uterine fragment (UF) samples were collected on days 3 and 35, for PCR. Even after antibiotic treatment, all groups presented infected animals, at D3 and D35, with no significant difference between the treated and control groups. Based on these results, it was conducted a second protocol of treatment with streptomycin, IM (25 mg/kg) for three consecutive days, which was 100% effective to eliminate the genital carrier state; therefore, that protocol should be recommended.

Conventional and molecular diagnosis of Campylobacteriosis associated with bovine abortion

Campylobacteriosis is responsible for genital tract infections of beef and dairy herds, causing a significant economic loss in livestock sector. Campylobacter foetus species is one of the important pathogens because of its potential impact in Veterinary and Human health. This study was designed to determine the regional incidence of C. foetus infection in Kerala, India by isolation, detection of C. foetus in clinical samples by Polymerase Chain Reaction (PCR), real time PCR (qPCR), and Enzyme Linked Immunosorbent Assay (ELISA) for the detection of C. foetus antibodies in sera of bovines with the history of abortion/infertility. Clinical samples (aborted materials (50), serum (50), Cervico-Vaginal Mucus (CVM) (30) and semen samples (30)) from a total of 160 cattle and buffaloes with the history of abortion and infertility were collected. Aborted materials including placenta, foetal membranes, liver, lungs and stomach contents of the aborted foetus, semen and CVM samples were processed and subjected to isolation and identification of Campylobacter foetus subsp. foetus (Cff) and Campylobacter foetus subsp. venerealis (Cfv) and molecular confirmation by PCR and qPCR respectively. Serum samples from aborted dams were tested using indirect ELISA. All the suspected clinical samples were found negative for Cff and Cfv on both culturing and PCR. All the serum samples tested were negative by ELISA as well. Conclusively the study indicated the infection of C. foetus spp. responsible for abortion in bovine are rare in the location where the study was conducted, which might be due to insignificant endemic levels. As per the breeding policy, only artificial insemination is practiced in Kerala in bovines, which is often considered as a simple control method for Bovine Genital Campylobacteriosis (BGC) and might be one of the factors that prevented extensive spread of C. foetus spp. infection.

A simple and reliable refractometric method to determine the total solids concentration of the cervico-vaginal bovine mucus samples

Cervico-vaginal mucus (CVM) is a viscoelastic substance continuously produced by secretory cells of the endocervix and the vagina of cows. Its physicochemical composition varies depending on the hormonal status of the estrous cycle. In veterinary medicine refractometry is a widely diffused technique to determine total solids (TS) content of biological samples, but there are not published data of CVM total solids from refractometric measures. Refractometric TS determination contributes to the qualitative constituents analysis of CVM, additionally it is an easier and more inexpensive technique than gravimetric TS determination. The main goal of the present paper was to validate a refractometric method to estimate TS concentration of the soluble fraction of CVM samples. Samples were collected from seventy-three Holando Argentino cows of Santa Fe province farms in Argentina. Cows were classified in three experimental groups: healthy, subclinical (SE) and clinical endometritis (CE) group. To achieve a solubilisation protocol for CVM samples, four Triton™ X-100 concentrations were tested. Refractive index (RI) and gravimetric total solid (gTS) concentration of solubilised samples were determined for the three experimental groups. A mathematical equation was determined with the experimental data from the healthy group, in order to obtain calculated total solid concentration (cTS) from refractivity (R) values. To validate the RI method for CVM samples, cTS concentrations were compared with gTS concentrations from endometritis group samples. Triton™ X-100 0.01% (V/V) improved CVM samples handling and did not change physicochemical parameters (gTS, Na+ and K+ concentration, and RI values). The linear regression equation obtained was: cTS (g/dL) = (R – 0.67)/16.2, r2 = 0.91. Correlation between gTS and cTS concentration was: r = 0.97 for SE group and r = 0.97 for CE group. The homogenization protocol allowed the measurement of physicochemical parameters without altering their values. A high correlation coefficient between cTS and gTS postulates refractometry as an accurate method to determine TS concentration for solubilised CVM samples.

The potential of volatile organic compound analysis in cervicovaginal mucus to predict estrus and ovulation in estrus-synchronized heifers

Cervicovaginal mucus is a mixture of mucins, ions, salts, and water, the proportions of which change during the reproductive cycle. It is suspected that this mucus emits an important volatile signal indicative of the reproductive state of the female. The objective of this study was to identify volatile organic compounds (VOC) in bovine cervicovaginal mucus that are modulated during the estrous cycle and could potentially be used as biomarkers of estrus and ovulation. Cervicovaginal mucus was collected from crossbred beef heifers (n = 8), which were synchronized using an 8-d controlled internal drug release (CIDR) protocol and in which onset of estrus and time of ovulation were determined by visual observation and ultrasonography, respectively. Mucus samples were collected between 0 and 96 h after CIDR removal (estrus onset occurred at 49.1 ± 3.3 h after CIDR removal). A validation study was performed on an independent group of 15 heifers from which cervicovaginal mucus samples were collected every 8 h from 40 to 80 h after CIDR removal. The VOC in mucus were identified using gas chromatography-mass spectrometry and selected compounds were quantified using selected-ion flow-tube mass spectrometry. The presence of 47 VOC was detected in mucus samples by gas chromatography-mass spectrometry with those exhibiting highest abundance including 2-butanone, acetone, 2-pentanone, 4-methyl-2-pentanone, 1-(1-methylethoxy)-2-propanone, ethanol, 2-methyl-2-propanol, and 2-butanol. All VOC peaked between 24 to 47 h after the onset of estrus (ovulation occurred 26.6 ± 5.6 h after estrus onset). Two VOC, 2-pentanone and 4-methyl-2-pentanone, exhibited a significant increase at the onset of estrus, whereas concentration of 2-butanone increased significantly just after estrus onset, indicating that these VOC may be used as putative biomarkers of estrus. The results of our study may contribute to the development of a sensor device based on VOC to aid the detection of estrus and ovulation in cattle, with particular relevance for the dairy industry where the majority of females are bred by artificial insemination.

Identification of Campylobacter fetus subsp. venerealis virulence genes in cervical mucus from cows.

We used the polymerase chain reaction to identify virulence genes in cervico-vaginal mucus samples from cows positive for Campylobacter fetus subsp. venerealis. There was positivity for the pldA, racR, dnaJ, cdtA, and cdtB genes. No samples showed the cdtC, ciaB, cadF, wlaN, and virB11 genes.

Improved detection of biomarkers in cervico-vaginal mucus (CVM) from postpartum cattle

BackgroundIn the postpartum cow, early diagnosis of uterine disease is currently problematic due to the lack of reliable, non-invasive diagnostic methods. Cervico-vaginal mucus (CVM) is an easy to collect potentially informative source of biomarkers for the diagnosis and prognosis of uterine disease in cows. Here, we report an improved method for processing CVM from postpartum dairy cows for the measurement of immune biomarkers. CVM samples were collected from the vagina using gloved hand during the first two weeks postpartum and processed with buffer alone or buffer containing different concentrations of the reducing agents recommended in standard protocols: Dithiothriotol (DTT) or N-Acetyl-L-Cysteine (NAC). Total protein was measured using the bicinchoninic acid (BCA) assay; interleukin 6 (IL-6), IL-8 and α1-acid glycoprotein (AGP) were measured by ELISA.ResultsWe found that use of reducing agents to liquefy CVM affects protein yield and the accuracy of biomarker detection. Our improved protocol results in lower protein yields but improved detection of cytokines and chemokines. Using our modified method to measure AGP in CVM we found raised levels of AGP at seven days postpartum in CVM from cows that went on to develop endometritis.ConclusionWe conclude that processing CVM without reducing agents improves detection of biomarkers that reflect uterine health in cattle. We propose that measurement of AGP in CVM during the first week postpartum may identify cows at risk of developing clinical endometritis.

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods &amp; Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.

Fern Pattern of Cervico-Vaginal Mucus in Relation to Fertility in Crossbred Cows and Heifers

This study was carried out on crossbred cows (n=20) and heifers (n=20) belonging to Dairy farm of the College of Veterinary Sciences and A.H. Mhow and clinical cases of progressive farmers brought for AI to the Teaching Veterinary Clinical Complex and at the doorstep of farmers in nearby villages. The cervico-vaginal mucus (CVM) samples were collected from the animals at oestrus before AI and were immediately evaluated for physical properties particularly fern pattern. Pregnancy was confirmed by rectal palpation after 2 months of insemination. Physical profile revealed that the variations in per cent incidence of typical, atypical and nil fern patterns of CVM samples were highly significant (P less than 0.01) in both the groups of conceived and non-conceived cows and he

Prevalence and risk factors associated with Tritrichomonas foetus infection in cattle in the state of Paraíba, Brazil.

The objective of this study was to determine the prevalence of Tritrichomonas foetus infection and to evaluate risk factors associated with this infection among cattle in the state of Paraíba in northeastern Brazil. Samples of cervicovaginal mucus from 290 females and smegma from 59 males [beef, 31; mixed aptitude (beef and dairy), 10; and dairy, 18] from 31 farms were collected. Modified Diamond's medium and polymerase chain reaction (PCR) were used for the laboratory diagnosis of T. foetus infection. Univariate analysis and logistic regression were performed to test for potential risk factors in addition to prevalence mapping. No sample was positive for T. foetus in culture, and the prevalence of T. foetus infection using PCR was 3.7% (13/349) [confidence interval (CI) 95%, 2.1%-6.4%]. In total, 19.3% (6/31) of the farms had at least one animal positive for T. foetus. The contact of females with males from other farms [Odds ratio, 5.9; 95% CI, 1.5-22.4; p = 0.009] was identified as a risk factor for T. foetus infection. This study demonstrates that T. foetus infection is prevalent among dairy cows in the state of Paraíba, Brazil. Sexual resting, removal of positive females, and avoiding contact of females with males from other farms are recommended to reduce the risk of infection.

Eficiencia del cultivo bacteriológico y de la inmunofluorescencia en la detección de Campylobacter fetus en fluidos genitales bovinos

Bovine genital campylobacteriosis is a reproductive disease that affects cattle production. It is caused by Campylobacter fetus subspecies, C. fetus fetus (Cff) and C. fetus venerealis (Cfv). The aim of this study was to identify the presence of C. fetus in genital fluids by bacteriological culture and direct immunofluorescence (DIF) and to compare the results. Two groups of 6 heifers and 5 bulls, one infected with Cff (Cff group) and the other with Cfv (Cfv group) were formed. Two heifers and 2 bulls, all of them uninfected, made up the control group. Samples of cervicovaginal mucus and preputial fluid were processed by culture and DIF. In the Cff group, 100% of the heifers and 80% of the bulls were infected, while in the Cfv group, 50% of the heifers and 60% of the bulls were infected. The degree of agreement (Kappa values) from benchmarking diagnostic techniques were 0.57 for heifers in the Cff group and 0.52 for heifers in the Cfv group, whereas the values for bulls were 0.17 and 0.27, respectively. Heifers yielded more positive results in the DIF assay than in the culture, exhibiting 5.6% increase in the Cff group and 7.4% in the Cfv group. The lowest percentage of positive results for DIF in bulls, 40% less for the Cff group and 5.2% for the Cfv group, could be due to improper sampling. Kappa values showed moderate agreement for the heifers and low for the bulls.

Prevalence and risk factors associated with bovine genital campylobacteriosis and bovine trichomonosis in the state of Pernambuco, Brazil.

The aim of the present study was to determine the prevalence and risk factors associated with Campylobacter fetus subsp. venerealis and Tritrichomonas foetus infection in cows from dairy herds in the state of Pernambuco, Brazil. In total, 383 samples of cervico-vaginal mucus were collected from cows on 21 herds in 19 districts. Genomic DNA was extracted from the samples and submitted for polymerase chain reaction analysis. An investigative questionnaire was used to analyze the risk factors, using questions related to reproductive and hygiene/sanitation management. A prevalence of 1.8% (0.8-3.9%; confidence interval (CI) 95%) and 33.4% (28.7-38.4%; CI 95%) was found for C. fetus subsp. venerealis and T. foetus, respectively. In terms of the number of foci, 28.6% of the herds contained at least one animal that was positive for C. fetus subsp. venerealis and 90.5% for T. foetus. The present study identified herds larger than 100 animals as a risk factor for bovine genital campylobacteriosis (OR = 7.2; CI 1.3-38.4%; p = 0.020) and the use of natural breeding as a risk factor for bovine trichomonosis (OR = 2.4; CI 1.1-5.9%; p = 0.041). In conclusion, C. fetus subsp. venerealis and T. foetus infections occurred in the region studied and high numbers of foci were found. Thus, prophylaxis and control measures, such as diagnosis, separation, and sexual rest for infected females, are suggested. An artificial insemination program with early rigorous sanitary care should be implemented on the properties in order to avoid the spread of agents in the herds.

IgG in cervicovaginal mucus traps HSV and prevents vaginal herpes infections.

IgG is the predominant immunoglobulin in cervicovaginal mucus (CVM), yet how IgG in mucus can protect against infections is not fully understood. IgG diffuses rapidly through cervical mucus, slowed only slightly by transient adhesive interactions with mucins. We hypothesize this almost unhindered diffusion allows IgG to accumulate rapidly on pathogen surfaces, and the resulting IgG array forms multiple weak adhesive crosslinks to mucus gel that effectively trap (immobilize) pathogens, preventing them from initiating infections. Here, we report herpes simplex virus serotype 1 (HSV-1) readily penetrated fresh, pH-neutralized ex vivo samples of CVM with low or no detectable levels of anti-HSV-1 IgG, but was trapped in samples with even modest levels of anti-HSV-1 IgG. In samples with little or no endogenous anti-HSV-1 IgG, addition of exogenous anti-HSV-1 IgG, affinity purified from intravenous immunoglobulin, trapped virions at concentrations below those needed for neutralization and with similar potency as endogenous IgG. Deglycosylating purified anti-HSV-1 IgG, or removing its Fc component, markedly reduced trapping potency. Finally, a non-neutralizing IgG against HSV-gG significantly protected mice against vaginal infection, and removing vaginal mucus by gentle lavage abolished protection. These observations suggest IgG-Fc has a glycan dependent “muco-trapping” effector function that may provide exceptionally potent protection at mucosal surfaces.

Studies on physical and rheological properties of cervico-vaginal mucus during early pregnancy in buffaloes (Bubalus bubalis)

Aim: The present work was carried out to study and compare the variation in physical and rheological (study of stretch and elasticity) properties of cervico-vaginal mucus of pregnant and non pregnant animals which could be used for early pregnancy diagnosis in buffaloes. Materials and Methods: Cervico-vaginal mucus samples were obtained from 30 buffaloes (n=12 pregnant, n=18 non pregnant) and a comparison was made between values of different parameters obtained from pregnant and non pregnant animals. Transparency, consistency, and elasticity of mucus were studied during early pregnancy. Results: Transparency and consistency did not show any remarkable difference between pregnant and non pregnant animals during any phase of estrous cycle. However, rheological property i.e. elasticity, showed a significant difference in its value on th th 9 day of estrous cycle. Spinnbarkeit value decreased significantly in pregnant animals on 9 day (3.9±0.45 cm), whereas non th pregnant group did not show a remarkable difference (8.4±0.43). Spinnbarkeit value was unidentifiable from 12 day onward in both the groups. Conclusion: These results conclude that significant variation in mucus elasticity could be helpful in designing user friendly tool for early pregnancy diagnosis in buffalo in future.

Human cervicovaginal mucus contains an activity that hinders HIV-1 movement.

Cervical and vaginal epithelia are primary barriers against human immunodeficiency virus type I (HIV-1) entry during male-to-female transmission. Cervical mucus (CM) is produced by the endocervix and forms a layer locally as well as in the vaginal compartment in the form of cervicovaginal mucus (CVM). To study the potential barrier function of each mucus type during HIV-1 transmission, we quantified HIV-1 mobility in CM and CVM ex vivo using fluorescent microscopy. Virions and 200-nm PEGylated beads were digitally tracked and mean squared displacement was calculated. The mobility of beads increased significantly in CVM compared to CM, consistent with the known decreased mucin concentration of CVM. Unexpectedly, HIV-1 diffusion was significantly hindered in the same CVM samples in which bead diffusion was unhindered. Inhibition of virus transport was envelope-independent. Our results reveal a previously unknown activity in CVM that is capable of impeding HIV-1 mobility to enhance mucosal barrier function.

The prevalence of bovine venereal campylobacteriosis in cattle herds in the Lake Chad basin of Nigeria

The prevalence of bovine venereal campylobacteriosis (BVC) was investigated in the Lake Chad basin of Nigeria. Preputial washings and cervico-vaginal mucus samples were obtained from 270 cattle presenting a history of abortion and lowered fertility, kept in traditional and institutional farms. All the samples investigated were cultured using standard bacteriological technique. Campylobacter fetus was isolated from six bulls and four cows. In all cattle sampled, the isolation rates were 2.2% for C. fetus subsp. venerealis and 1.5% for C. fetus subsp. fetus; the herd and within-herd prevalence rates for C. fetus were 22.2% and 3.4%, respectively, while the overall active infectivity rate was 3.7%. BVC probably contributes to lowered fertility and abortions found in cattle in the Lake Chad basin of Nigeria, associated more with C. fetus subsp. venerealis than C. fetus subsp. fetus.

Tetratrichomonas spp. and Pentatrichomonas hominis are not persistently detectable after intravaginal inoculation of estrous heifers

Virgin heifers (44) were intravaginally inoculated at estrus with low (10 6) or high (10 8) doses of live Tetratrichomonas sp., Pentatrichomonas hominis ( P. hominis), or Tritrichomonas foetus ( T. foetus). Controls were inoculated with Diamond's trypticase yeast extract maltose media. Genital infection was determined by culture of cervico-vaginal mucus (CVM) in Schneider's media and InPouch TF ® as well as by polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP). The presence of trichomonads in fecal samples was determined by culture in Schneider's medium and PCR/RFLP. In CVM samples, tetratrichomonads were found by PCR/RFLP and Schneider's culture only sporadically at intermittent weeks. The presence of tetratrichomonads was not associated with the dose in the experimental vaginal inoculation since Tetratrichomonas sp. appeared more frequently in heifers inoculated with a low dose of tetratrichomonads than in heifers inoculated with a high dose of tetratrichomonads. Moreover, Tetratrichomonas spp. were isolated not only in heifers inoculated with tetratrichomonads but also in control heifers and in heifers inoculated with P. hominis. In feces, Tetratrichomonas spp. were frequently identified by culture in Schneider's and by PCR/RFLP in heifers of all groups. P. hominis was never found in CVM or feces by any method. Based on the common appearance of tetratrichomonads in feces and vaginal secretions, it appears that tetratrichomonads were detected periodically in the vagina of heifers as a consequence of repeated contamination from feces and not as a result of experimental infection. In summary, in this study, the strains of Tetratrichomonas sp. and P. hominis did not establish persistent infection in heifers.

Effect of Administration of Garlic Extract and PGF2慣 on Hormonal Changes and Recovery in Endometritis Cows

The efficacy of garlic extract and PGF 2 α in the treatment of endometritis in cows was evaluated. A total of 26 parous cows affected with endometritis were randomly allocated into three groups. Group I (n = 10) animals were infused (IU) with 10 ml garlic extract mixed with 90 ml normal saline, three times at 12 h interval starting from the day of estrum, whereas the animals of Group II (n = 10) were treated with a single injection of PGF 2 α (25 mg Lutalyse) on the 10 th to 12 th day after estrus, and group III (n = 6) remained as control. Cervico-vaginal mucus (CVM) was collected from each animal at pre- and post-treatment estrus and subjected to white side test, pH determination and total bacterial load. The clinical recovery of cows was assessed by negative white side test reaction, pH value and total bacterial count of CVM at subsequent estrus. The recovered animals were inseminated with frozen-thawed semen twice at 12 h intervals and pregnancy was confirmed at 45-60 days following insemination. A significant decline (p<0.05) in pH of CVM was observed in both the treatment groups at subsequent estrus. After treatment there was a significant (p<0.05) reduction in bacterial load, whereas, it was increased in control group. A total number of 65 isolates were identified in CVM samples comprising mostly of facultative anaerobic bacteria. Plasma T 4 and T 3 concentrations were increased in all the treated animals, whereas, a decline was observed in cortisol levels following treatment. The overall conception rate was 50% in treated groups as compared to nil pregnancy in the control.