Cases Of Alveolar Soft Part Sarcoma Research Articles

Evaluation of TRIM63 RNA in situ hybridization (RNA-ISH) as a potential biomarker for alveolar soft-part sarcoma (ASPS)

Alveolar soft-part sarcoma (ASPS) is a rare soft tissue tumor with a broad morphologic differential diagnosis. While histology and immunohistochemistry can be suggestive, diagnosis often requires exclusion of other entities followed by confirmatory molecular analysis for its characteristic ASPSCR1-TFE3 fusion. Current stain-based biomarkers (such as immunohistochemistry for cathepsin K and TFE3) show relatively high sensitivity but may lack specificity, often showing staining in multiple other entities under diagnostic consideration. Given the discovery of RNA in situ hybridization (RNA-ISH) for TRIM63 as a sensitive and specific marker of MiTF-family aberration renal cell carcinomas, we sought to evaluate its utility in the workup of ASPS. TRIM63 RNA-ISH demonstrated high levels (H-score greater than 200) of expression in 19/20 (95%) cases of ASPS (average H-score 330) and was weak or negative in cases of paraganglioma, clear cell sarcoma, rhabdomyosarcoma, malignant epithelioid hemangioendothelioma, as well as hepatocellular and adrenal cortical carcinomas. Staining was also identified in tumors with known subsets characterized by TFE3 alterations such as perivascular epithelioid cell neoplasm (PEComa, average H-score 228), while tumors known to exhibit overexpression of TFE3 protein without cytogenetic alterations, such as melanoma and granular cell tumor, generally showed less TRIM63 ISH staining (average H-scores 147 and 96, respectively). Quantitative assessment of TRIM63 staining by RNA-ISH is potentially a helpful biomarker for tumors with molecular TFE3 alterations such as ASPS.

The dynamic contrast enhanced-magnetic resonance imaging and diffusion-weighted imaging features of alveolar soft part sarcoma.

Alveolar soft part sarcoma (ASPS) is a rare type of soft tissue sarcoma that predominantly affects adolescents and young adults. Early diagnosis of ASPS is crucial for optimal therapeutic planning and improving prognosis, but its diagnostic features are not well delineated. This study aimed to retrospectively analyze the imaging features of ASPS with an emphasis on the dynamic contrast-enhanced-magnetic resonance imaging (DCE-MRI) and diffusion-weighted imaging (DWI) findings to identify imaging findings that might suggest the diagnosis to radiologists. The imaging features of 34 patients with pathologically proven limb ASPS were retrospectively analyzed. A total of 23 underwent DCE-MRI, and 12 underwent DWI. Among the 34 cases of ASPS, 31 tumors were in the lower extremities, and 3 were in the upper extremities. The maximum tumor diameters ranged from 3.0 to 19.4 cm (mean, 8.7±3.96 cm). A total of 28 cases had well-defined borders. The masses demonstrated heterogeneous high signal intensity on T2-weighted imaging (T2WI) and the fat-suppressed (FS) T2WI sequence and slight hyperintensity on T1-weighted imaging (T1WI). A total of 25 lesions had thin hypointense bands on T1WI and T2WI. Intra- and peri-tumoral tubular areas of flow void were exhibited on both T1WI and T2WI in all cases. A total of 12 cases showed a high signal on DWI, and the mean apparent diffusion coefficient (ADC) value was (0.86±0.07)×10-3 mm2/s [range, (0.6-1.4)×10-3 mm2/s]. Persistent remarkable enhancement of the lesion was displayed on contrast-enhanced scans. The time-intensity curves (TICs) of 23 masses showed early arterial enhancement and slow washout of contrast. ASPS most commonly presents in the lower extremities of adolescents or young adults. Hyperintense T1WI, T2WI, and DWI signals, low ADC, flow voids, early arterial enhancement are frequent MRI features.

Correlation of Immunological and Molecular Profiles with Response to Crizotinib in Alveolar Soft Part Sarcoma: An Exploratory Study Related to the EORTC 90101 "CREATE" Trial.

Alveolar soft part sarcoma (ASPS) is a rare subtype of soft tissue sarcoma characterized by an unbalanced translocation, resulting in ASPSCR1-TFE3 fusion that transcriptionally upregulates MET expression. The European Organization for Research and Treatment of Cancer (EORTC) 90101 “CREATE” phase II trial evaluated the MET inhibitor crizotinib in ASPS patients, achieving only limited antitumor activity. We performed a comprehensive molecular analysis of ASPS tissue samples collected in this trial to identify potential biomarkers correlating with treatment outcome. A tissue microarray containing 47 ASPS cases was used for the characterization of the tumor microenvironment using multiplex immunofluorescence. DNA isolated from 34 available tumor samples was analyzed to detect recurrent gene copy number alterations (CNAs) and mutations by low-coverage whole-genome sequencing and whole-exome sequencing. Pathway enrichment analysis was used to identify diseased-associated pathways in ASPS sarcomagenesis. Kaplan–Meier estimates, Cox regression, and the Fisher’s exact test were used to correlate histopathological and molecular findings with clinical data related to crizotinib treatment, aiming to identify potential factors associated with patient outcome. Tumor microenvironment characterization showed the presence of PD-L1 and CTLA-4 in 10 and 2 tumors, respectively, and the absence of PD-1 in all specimens. Apart from CD68, other immunological markers were rarely expressed, suggesting a low level of tumor-infiltrating lymphocytes in ASPS. By CNA analysis, we detected a number of broad and focal alterations. The most common alteration was the loss of chromosomal region 1p36.32 in 44% of cases. The loss of chromosomal regions 1p36.32, 1p33, 1p22.2, and 8p was associated with shorter progression-free survival. Using whole-exome sequencing, 13 cancer-associated genes were found to be mutated in at least three cases. Pathway enrichment analysis identified genetic alterations in NOTCH signaling, chromatin organization, and SUMOylation pathways. NOTCH4 intracellular domain dysregulation was associated with poor outcome, while inactivation of the beta-catenin/TCF complex correlated with improved outcome in patients receiving crizotinib. ASPS is characterized by molecular heterogeneity. We identify genetic aberrations potentially predictive of treatment outcome during crizotinib therapy and provide additional insights into the biology of ASPS, paving the way to improve treatment approaches for this extremely rare malignancy.

Role of pre-operative percutaneous embolization in orbital alveolar soft part sarcoma - An experience from a tertiary eye-care center.

Purpose:To describe the clinic-radiological, pathological profile, and management outcomes of primary alveolar soft-part sarcoma (ASPS) of the orbit.Methods:A retrospective analysis of all histopathologically proven cases of orbital ASPS that presented between May 2016 and September 2019 was done. Data collected included demographics, clinical features, imaging characteristics, metastatic workup, management, and follow-up.Results:Five patients, of which four were males, presented to us during the study period. The mean age of presentation was 12.6 years (range 3–22 years). The most common presenting features were abaxial proptosis (n = 4) and diminished vision (n = 4). Imaging showed a well-defined orbital mass in all patients with internal flow voids in three. Preoperative percutaneous embolization with cyanoacrylate glue was done in these three patients owing to high vascularity. Four patients underwent complete tumor excision. One patient underwent exenteration. Histopathology showed polygonal tumor cells arranged in a pseudo-alveolar pattern and Periodic Acid-Schiff (PAS) positive crystals in the cytoplasm in all patients. One patient had systemic metastasis at presentation and developed a local recurrence after 3 months. No recurrence or metastasis was noted in the remaining four patients at a mean final follow-up of 11.2 months (range 5–15 months).Conclusion:ASPS is a rare orbital neoplasm that poses a diagnostic and therapeutic challenge. Imaging might show a soft-tissue tumor with high vascularity. Multidisciplinary management with interventional radiologists for preoperative embolization of vascular lesions helps minimize intraoperative bleeding and aids in complete tumor resection. A localized orbital disease carries a better prognosis.

THE UNTOLD STORY OF PRIMARY ALVEOLAR SOFT PART SARCOMA OF THE FIBULA: A RARE CASE REPORT WITH REVIEW OF THE LITERATURE

Alveolar soft part sarcoma (ASPS) is a rare soft-tissue tumor occurring in skeletal muscles or musculofascial planes with an incidence of 0.5–1%. In adults, the lower extremity is most commonly involved, whereas in children, the involvement of the head-and-neck region is more common. Metastasis to the brain, bone, and lungs is common; however, primary bone involvement is extremely rare. We report the case of a 25-year-old male who presented with a painless slowly progressive swelling in the left lower limb for 1 year with no history of trauma. The case was diagnosed as primary ASPS of the fibula after ruling out the involvement of soft tissue and other organs. To the best of our knowledge, only 11 cases of primary ASPS of bone have been reported so far.

Alveolar soft part sarcoma in children: a clinicopathological study of 13 cases

Objective: To investigate the clinicopathological manifestations, molecular genetic, diagnostic histology and differential diagnosis of alveolar soft part sarcoma (ASPS) in children. Methods: A total of 13 cases of ASPS diagnosed at Beijing Children's Hospital from August 2009 to November 2018 were collected. HE staining, histochemical staining for PAS and D-PAS, immunohistochemical (IHC) staining for TFE3, INI1 and CD68 and florescence in situ hybridization (FISH) for TFE3 gene translocation were performed. Results: There were four males and nine females, age ranged from 1 year and 2 months to 13 years and 8 months (mean 7.8 years); and four patients were under 5 years old. Histologically, the tumors showed a distinctive and characteristic nested or organoid growth pattern (11 cases) or solid, diffuse growth (2 cases). The tumor cells possessed abundant eosinophilic, or glycogen-rich and clear to vacuolated cytoplasm. The chromatin was relatively dispersed, with prominent and pleomorphic nucleoli; mitotic figures were rare. Vascular invasion was frequently seen. IHC staining showed specific nuclear TFE3 staining. The tumor cells were also positive for INI1,CD68 and vimentin; but were negative for MyoD1, Myogenin, CK and S-100 protein. Seven cases showed PAS and D-PAS staining, with fuchsia acicular or rod-shaped crystals in tumor cytoplasm. Nine cases showed TFE3 break-apart signals by FISH. Conclusions: ASPS is a rare soft tissue sarcoma in children. Compared with ASPA in adults, it has both similarities and unique clinicopathologic characteristics. The diagnosis needs to be confirmed by combining clinical, pathologic, IHC and genetic testing.

Orbital alveolar soft part sarcoma: A report of 8 cases and review of the literature.

Alveolar soft part sarcoma (ASPS) is a rare soft tissue neoplasm. The incidence of orbital involvement is the highest in ASPS arising in the head and neck region. However, limited information is available regarding its clinical characteristics. The present study presents the clinical manifestations, imaging findings, pathological features, treatment strategies and prognosis records of 8 cases of orbital ASPS over the last 15 years in a single hospital, along with a review of the literature. Included were 3 male and 5 female patients, with the median age at presentation being 9.5 years. The mean average largest tumour diameter was 3.6 cm. A total of 5 patients underwent surgical excision of the tumour, with 2 undergoing orbital exenteration and 1 undergoing partial orbital exenteration. In total, 6 patients received postoperative radiotherapy and 2 received chemotherapy. Upon follow-up, 6 patients were doing well with no evidence of recurrence or metastasis. Local recurrence developed in 2 patients, of whom 1 succumbed following withdrawal from treatment. According to the present series and the cases mentioned in the literature, orbital alveolar soft part sarcoma has characteristics distinct from those of alveolar soft part sarcoma which arises in other locations. Orbital alveolar soft part sarcoma presents itself in a younger population with a shorter course of disease, smaller tumour size, improved prognosis, a marked association with the extraocular muscles and with the Ki-67 proliferation index possibly associated with prognosis of the disease.

Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.

Exploring the Histogenesis and Diagnostic Strategy Using Immunoassay and RT-PCR in Alveolar Soft Part Sarcoma.

Alveolar soft part sarcoma (ASPS) is a rare soft tissue sarcoma, but it's easily misdiagnosed in rare locations. The derivation of ASPS is still uncertain, therefore we conducted this study to explore the histogenesis of ASPS by analyzing stem cell markers (ALDH1, CD29, CD133 and Nestin). Protein TFE3 and fusion gene ASPS-TFE3 were tested in paraffin to explore diagnostic strategy and molecular pathological features. In this study, nine cases of ASPS were immunostained with stem cell surface markers (ALDH1, CD29, CD133 and Nestin) and protein TFE3. Seven cases of ASPS mRNA were successfully extracted from nine paraffin-embedded tissues. The expression of fusion gene ASPL-TFE3 was examined by reverse transcriptase-polymerase chain reaction. The immunohistochemical staining of nine patients showed that CD29 and Nestin were negative in all nine cases (0/9). CD133 was weakly positive in one cases (1/9) and ALDH1 was weakly positive in one cases (1/9). TFE3 was positive in nine cases (9/9). Seven paraffin tissues could be successfully extracted with mRNA in nine cases. The results of Reverse Transcription Polymerase Chain Reaction (RT-PCR) showed that ASPL-TFE3 fusion transcripts could be tested in the seven cases (four cases being type 2 and three cases being type 1). The positive rate of CD133 and ALDH1 were less than 1% and the expression of CD29 and Nestin were negative in ASPS. Immunohistochemistry results indicated that the histogenesis of ASPS maybe not derive from mesenchymal stem cells. Immunohistochemistry staining showed that TFE3 protein expression was highly sensitive in ASPS. Furthermore, RT-PCR results showed that fusion gene ASPL-TFE3 (ASPL-TFE3 type 1 and ASPL-TFE3 type 2) was expressed in ASPS, which could provide information for clinical molecular pathological diagnosis and improve the diagnosis rate of rare atypical ASPS.

Immunoprofiling in alveolar soft part sarcoma.

11059 Background: Alveolar Soft Part Sarcoma (ASPS) is a distinctive tumor characterized by a canonical ASPL-TFE3 fusion. Treatment options are limited. We assessed tumor immune cell infiltrates, and correlated this with patients receiving PD-1 blockade. Methods: A retrospective institutional review was performed for 18 cases of ASPS. Immunohistochemistry was performed on paraffin-embedded tissue (PET) for T-lymphocyte markers (CD3/CD4/CD8), and PD-1/PD-L1 (Ventana). Expression was quantified by standard methods: (total cells per high power field: score; 0:0; 1-10:1; 11-50:2; 50-99:3; 100:4). Select cases underwent DNA sequencing analysis using whole exome (WES, > 80X, n = 4) and genome (WGS, > 30X, n = 1) sequencing. Indel analysis was conducted via mutect2 ( > 5% variant allele frequency) and mutational signature was performed using deconstructSigs. Results: The median age was 27 (15-54). Disease status at diagnosis was: 44% localized; 56% metastatic. The median overall survival was 17 yrs (2.9-31). Four patients (pts) received immunotherapy with PD-1 blockade with 1 complete response (CR), 2 durable partial responses (PR) and 1 stable disease (SD). PET was available in 12 cases. PD-1/PD-L1 expression (≥1) was seen in 50% and 17%, respectively. Composite CD3, CD4 and CD8 infiltration were 2, 1, and 1, respectively. Patients with CR/PR to PD-1 blockade (n = 3) had no clear correlation with PD-1, PD-L1 or lymphocyte markers. Exomic characterization (n = 4) demonstrated no clear excess mutation burden compared to Ewing sarcoma (5.7 vs 6.4 mut/MB). Mutational signatures via COSMIC were identified in the mismatch repair (MMR) pathway in 2 of 4 cases (Pt A: Signature (S) 26; pt B: S6 and S15). Pt B also underwent WGS which confirmed a COSMIC signature in the MMR pathway. Indel analysis did not confirm aberrations in standard MMR or polymerase genes. Conclusions: Preliminary findings suggest activity with PD-1 blockade in ASPS; however, this does not appear to correlate with tumour-infiltrating T lymphocytes. Genomic analysis suggests an MMR signature may account for these responses, but standard MMR aberrations were not identified. Further validation is underway.

Alveolar soft part sarcoma: a clinicopathologic analysis of 48 cases

To study the clinicopathologic features and differential diagnosis of alveolar soft part sarcoma (ASPS). The clinical data and pathologic features of 48 cases of ASPS were evaluated. Immunohistochemical study, PAS staining and fluorescence in-situ hybridization (FISH) were carried out in selected examples. Relevant literature was reviewed. Amongst the 48 cases studied, there were 17 males and 31 females, with male-to-female ratio of 1.0∶1.8. The age of patients ranged from 2 to 60 years (median=26 years). The tumor was most commonly located in deep soft tissue, especially that of lower extremities. Histologically, the tumor cells were arranged in alveolar or solid patterns and separated by sinusoidal vessels. They were large and contained abundant eosinophilic granules or crystals in cytoplasm. The nuclei were round to polygonal and vesicular, often with prominent nucleoli. Intravascular tumor extension was common. Some cases showed necrosis, hemorrhage and cystic changes. Immunohistochemical study showed that the tumor cells were positive for TFE3 (100%, 33/33). FISH assay was carried out in 4 cases and all of them had TFE3-ASPL gene fusion. ASPS is a rare malignant neoplasm, often occurs in young patients. TFE3 is a useful immunohistochemical marker for diagnosis. The diagnosis is further confirmed by other markers.

Alveolar soft part sarcoma: Clinicopathological analysis and imaging results.

Alveolar soft part sarcoma (ASPS) is a rare, malignant, soft-tissue tumor that accounts for ~1.2% of all soft-tissue sarcomas. Due to its low incidence, clinicians often overlook the diagnosis. However, it is difficult to form an accurate diagnosis prior to surgery due to the lack of experience in imaging diagnosis. The present study reviewed the pathological images, and the computed tomography and magnetic resonance imaging data of 6 ASPS cases in order to investigate the clinicopathological and imaging characteristics of the tumor. The present study indicated that the magnetic resonance imaging (MRI) appearances of ASPS are nonspecific, but malignancy may be determined to a certain degree, which may aid in diagnosis prior to surgery and provides information for treatment guidance.

ASPL-TFE3 Translocation in Vulvovaginal Alveolar Soft Part Sarcoma

Alveolar soft part sarcoma of the vulvovaginal region is limited to only 8 reported vaginal cases and 1 vulvar case in the English literature. The histogenesis of the tumor remains intriguing with postulates favoring a myogenic versus nonmyogenic origin. A reciprocal translocation for ASPL-TFE3 gene fusion, frequently detected in ~90% of cases, combined with TFE3 protein immunoexpression are highly sensitive and specific methods for diagnostic confirmation. The current report describes a unique case of vulvovaginal alveolar soft part sarcoma showing the classic morphologic features with documentation of TFE3 protein expression and the ASPL-TFE3 gene rearrangement. Furthermore, a brief review of the literature of vulvar and vaginal alveolar soft part sarcoma cases with the various treatment modalities is outlined.

Alveolar Soft-Part Sarcoma of the Orbit

Alveolar soft-part sarcoma (ASPS) is a translocation-associated sarcoma that occurs most commonly in the lower extremities and rarely in orbit. Only 34 orbital cases have been reported in the literature, and it is often misdiagnosed due to its rare occurrence and nonspecific clinical findings. The optimal treatment remains controversial, although in general, aggressive surgical resection is advocated. Here, the authors present 2 cases of orbital ASPS and a review of the literature.

Cytodiagnosis of alveolar soft part sarcoma: Report of two cases with special emphasis on the first orbital lesion diagnosed by aspiration cytology

Alveolar soft part sarcoma (ASPS) is a rare neoplasm of uncertain cell of origin. Known to occur in adolescents and young adults, this tumor usually involves the muscles and deep soft tissues of the extremities and trunk. Orbital localization is rare and not yet subjected to cytological assessment, as per our literature search. We present here two cases of ASPS diagnosed by aspiration cytology, one in the orbit and the other in the lower extremity. The cells displayed abundant clear to finely vacuolated cytoplasm, often with disrupted margins and flowing of the cytoplasmic material; prominent nucleoli and scattered bare nuclei were also seen in the background. Two close cytological differential diagnoses include metastatic renal cell carcinoma and paraganglioma. Intracytoplasmic periodic acid schiff (PAS) positive, diastase-resistant, needle-shaped crystals and corresponding rhomboid crystals with regular lattice pattern on ultrastructure are the hallmarks of this neoplasm. Due to its slowly progressive clinical course and poor outcome, preoperative diagnosis of ASPS through fine-needle aspiration cytology may be essential for deciding therapy, especially in rare and difficult locations like orbit, where adjuvant radiation may not be possible.

Validation of a TFE3 Break-apart FISH Assay for Xp11.2 Translocation Renal Cell Carcinomas

Renal cell carcinomas (RCCs) with an Xp11.2 translocation predominantly affect young patients, and can present at an advanced stage. However, more cases in older patients and incidentally detected cancers at earlier stages are also being identified. As the histology of Xp11.2 RCCs overlaps with clear cell and papillary RCCs, it is not infrequent that Xp11.2 RCCs are overlooked and misdiagnosed. The objective of this study was to validate the use of fluorescence in-situ hybridization (FISH) for identifying Xp11.2 RCCs. One hundred fifty-eight consecutive, unselected renal tumors were evaluated in tissue microarrays, including 109 clear cell RCCs, 20 papillary RCCs, 3 RCCs with mixed papillary and clear cell features, 1 Xp11.2 translocation RCC, 8 chromophobe RCCs, 10 oncocytomas, and 7 angiomyolipomas. FISH evaluation was performed blinded to karyotype data, available in about two-thirds of cases. Furthermore, conventional sections of 4 Xp11.2 RCCs, 4 RCCs with mixed papillary and clear cell features, and 4 cases of alveolar soft part sarcoma (the latter for control purposes) were also assessed by FISH. Break-apart signals were homogeneously identified throughout tumor cells in 2 cases from the tissue microarrays including 1 known Xp11.2 RCC and 1 misdiagnosed Xp11.2 RCC. All conventional sections from the Xp11.2 RCC and alveolar soft part sarcoma cases were positive for the TFE3 rearrangement by FISH. All remaining cases were negative. Our study shows the clinical application of FISH in formalin-fixed, paraffin-embedded tissue for detection of Xp11.2 translocation RCCs and other tumors with this genetic aberration.

Cytopathological diagnosis of alveolar soft part sarcoma, a rare soft tissue neoplasm

Alveolar soft part sarcoma (ASPS) is a rare soft tissue neoplasm, having various morphological mimics, especially on fine needle aspiration cytology (FNAC). Because no definite immunohistochemical markers are available to aid a correct diagnosis, knowledge of the cytomorphological features is essential for correct patient management. Cytological features of five cases of ASPS are discussed, along with the ultrastructural findings available in one of them. Cytology records from 1997 to 2009 were reviewed for cases with a diagnosis of ASPS on cytology. The histology slides of the cases were also assessed for confirmation of the diagnosis. All the slides were reviewed by three pathologists. There were five cases of ASPS diagnosed on FNAC. Their cytological features were noted in detail. The diagnoses in all the cases were confirmed on histology, and ultrastructural findings available in one of them were also assessed. The knowledge of cytological features may aid in diagnosing this rare tumour correctly on FNA smears, thus enabling correct patient management.

Dual-color, Break-apart FISH Assay on Paraffin-embedded Tissues as an Adjunct to Diagnosis of Xp11 Translocation Renal Cell Carcinoma and Alveolar Soft Part Sarcoma

Both Xp11.2 translocation renal cell carcinoma (RCC) and alveolar soft part sarcoma (ASPS) are characterized by various translocations disrupting chromosome Xp11.2, which result in gene fusions involving the TFE3 transcription factor gene. Diagnostic tools to detect translocations involving the TFE3 gene on chromosome X would be valuable in the evaluation of these tumors. We developed a dual-color, break-apart fluorescence in situ hybridization (FISH) assay to identify the chromosomal break point in paraffin-embedded tissue. This assay was validated using 4 cases of Xp11.2 RCC [proven by karyotype and/or reverse-transcriptase polymerase chain reaction (RT-PCR)], 2 cases of ASPS (proven by karyotype or RT-PCR), the UOK109 cell line carrying the inv(X) (p11;q12), and several negative controls (both neoplastic and non-neoplastic). This break-apart FISH assay is a relatively quick procedure for detecting Xp11.2 RCC and ASPS translocations and can be applied to archival paraffin-embedded tissue.

Alveolar soft part sarcoma of the thyroid gland in a child

Background : Soft tissue sarcomas, including rhabdomyosarcomas (RMS) and non-RMS (NRSTS), are rare in children with less than 1000 new cases diagnosed yearly in the United States. RMS is the most common soft tissue sarcoma in young children and NRSTS is more common in adolescents and young adults. Alveolar soft part sarcoma (ASPS) is a form of NRSTS. ASPS is an extremely rare malignancy, comprising less than 0.1% of head and neck sarcomas. In children, ASPS has a tendency for the head and neck region (27%), with most cases involving the orbit and the tongue. Methods : A 2-year-old boy presented with respiratory distress. Imaging revealed a 5.5 cm × 4.0 cm × 2.5 cm mass arising from the thyroid gland compressing the trachea and bilateral pulmonary metastases. Results : The patient underwent tracheostomy, thyroid lobectomy, and excision of paralaryngeal/paratracheal tissue. Pathology revealed positive margins and extensive lymphovascular permeation. Discussion : Cases of ASPS of the larynx, buccal space, paravertebral space, orbit, and tongue have been described. This is the first case of primary ASPS of the thyroid gland. Surgery is the mainstay of treatment for NRSTS, and radiation and chemotherapy are reserved for the subset of NRSTS that are high grade or unresectable. Median survival time of patients with ASPS is 3 years if metastatic disease is present at the time of diagnosis and 11 years if there is no metastatic disease at presentation. Our patient survived 2 years after diagnosis. Conclusion : Even though very rare, ASPS should be considered in the differential diagnosis of thyroid tumors.

Cytopathology of alveolar soft part sarcoma

Alveolar soft part sarcoma (ASPS) rarely is subjected to cytopathologic evaluation. With the exception of some very small series, the literature is limited to case reports. The objectives of the current study were to evaluate the cytomorphology of 10 ASPS cases on fine-needle aspiration (FNA) or imprint cytology, review the literature, and highlight potential diagnostic pitfalls. The authors searched their files for all lesions that were signed out as ASPS or suspicious for ASPS and searched the surgical pathology files for any cases of ASPS that had corresponding cytology. FNA was performed using the standard technique. Scrape preparations were performed on tissues that were sent fresh for frozen section examination. Ten cases of ASPS were retrieved from 7 patients (male-to-female ratio, 4:3; mean age, 22 years). All had subsequent tissue confirmation. Six specimens were from primary lesions, 3 specimens were from metastases, and 1 intraoperative smear was from a previously aspirated primary mass in a newly diagnosed patient. Anatomic sites of involvement included extremities (5 specimens), trunk/pelvis (3 specimens), oral cavity (1 specimen), and lung (1 specimen). Eight specimens were aspirates, and 2 specimens were intraoperative smears. Nine cases were diagnosed correctly as ASPS/consistent with ASPS, and 1 specimen was diagnosed as "tumor, not otherwise specified". Cytomorphology included variably cellular smears composed of large cells with an enormous amount of finely granular or vacuolated cytoplasm, markedly enlarged nuclei/nucleoli, and bare nuclei. The cytomorphology of some cases revealed a strong similarity to renal cell carcinoma, clear cell type. The results of the current study indicated that ASPS has cytomorphology that overlaps with several other neoplasms, including renal cell carcinoma. Nonetheless, the morphologic features, when combined with the clinical presentation, radiologic findings, and ancillary testing, may allow for a specific diagnosis.