Carbonyl Residues Research Articles

Isospongian Diterpenoids from the Leaves of Amomum tsao-ko Promote GLP-1 Secretion via Ca2+/CaMKII and PKA Pathways and Inhibit DPP-4 Enzyme.

Three uncommon isospongian diterpenoids including a new one, 3-epi-kravanhin A (2), were isolated from the leaves of Amomum tsao-ko. Compounds 2 and 3 dose-dependently promoted GLP-1 secretion on STC-1 cells with promotion ratios of 109.7 % and 186.1 % (60 μM). Mechanism study demonstrated that the GLP-1 stimulative effects of 2 and 3 were closely related with Ca2+/CaMKII and PKA pathways, but irrelevant to GPBAR1 and GPR119 receptors. Moreover, compound 1 showed DPP-4 inhibitory activity with an IC50 value of 311.0 μM. Molecular docking verified the binding affinity of 1 with DPP-4 by hydrogen bonds between the γ-lactone carbonyl (C-15) and Arg61 residue. Bioinformatics study indicated that compound 1 exerted antidiabetic effects by improving inflammation, oxidative stress and insulin resistance. This study first disclosed the presence of isospongian diterpenoids in A. tsao-ko, which showed antidiabetic potency by promoting GLP-1 secretion and inhibiting DPP-4 activity.

Selective leaching and recovery of neodymium from NdFeB carbonyl residues

Neodymium iron boron (NdFeB) is a widely-used magnetic material; however, the production process generates significant amounts of rare earth element-rich waste. Refining the Fe via carbonylation leads to carbonylated slag containing 0.2–2.0 % rare earth elements. The extraction of trace rare earth elements from waste materials has not been reported, although the Nd recovery would be economically and environmentally beneficial. In this work, we calcinated NdFeB carbonylation slag (with less than 0.3 % rare earth content) and identified a green deep eutectic solvent (DES) that can selectively recover Nd. The best performing DES comprised a 2:1 M ratio of ethylene glycol to maleic acid and was highly selective for Nd and inert toward Fe, thus enabling effective separation. Specifically, the Nd/Fe selectivity factor exceeded 3000, i.e., under optimal conditions, 28.07 % of the Nd was extracted, while the Fe leaching rate was less than 0.01 %. The Nd in the DES was subsequently extracted and then enriched by reverse extraction using a di-(2-ethylhexyl)phosphoric acid (P204)-sulfonated kerosene system and hydrochloric acid. DES still had recyclability after extraction. Finally, the Nd was precipitated by adding oxalic acid to form the rare earth oxalate, which was calcined to obtain a high-purity Nd2O3. The strategy applied in this work based on DES and conventional organic extraction represents a promising and sustainable approach for the selective recovery of trace rare earth elements.

Purification, Identification, Chelation Mechanism, and Calcium Absorption Activity of a Novel Calcium-Binding Peptide from Peanut (Arachis hypogaea) Protein Hydrolysate.

A novel calcium-binding peptide was purified from peanut protein hydrolysate using gel filtration chromatography and identified using HPLC-MS/MS. Its amino acid sequence was determined as Phe-Pro-Pro-Asp-Val-Ala (FPPDVA, named as FA6) with the calcium-binding capacity of 15.67 ± 0.39 mg/g. Then, the calcium chelating characteristics of FPPDVA were investigated using ultraviolet-visible absorption spectroscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, particle size, and zeta potential. The results showed that FPPDVA interacted with calcium ions, the chelation of calcium ions induced FPPDVA to fold and form a denser structure, the calcium-binding sites may mainly involve oxygen atoms from the carboxyl residues of Asp and Ala, and Phe possessed contact energy and carbonyl residues of Val. Microstructure analysis showed that FPPDVA-calcium chelate exhibited a regularly ordered and tightly aggregated sheets or block structures. Additionally, FPPDVA-calcium chelate had good gastrointestinal digestive stability and thermal stability. The results of everted rat intestinal sac and Caco-2 cell monolayer experiments showed that FPPDVA-calcium chelate could promote calcium absorption and transport through the Cav1.3 and TRPV6 calcium channels. These data suggest that FPPDVA-calcium chelate possesses the potential to be developed and applied as calcium supplement.

Graphene oxide-mediated copper reduction allows comparative evaluation of oxygenated reactive residues exposure on the materials surface in a simple one-step method

Graphene Oxide (GO) is the oxidized form of graphene rich in surface groups comprising carbonyl, carboxyl, hydroxyl, and epoxy residues. The solubility in water makes GO an ideal material in the biomedical field though the plethora of synthesis methods available can modify the balance of oxygen groups and, consequently, the effects on eukaryotic and prokaryotic cells. For this reason, GO materials are always characterized with spectroscopic methods such as X-ray photoelectron and Fourier-transform Infrared spectroscopy. However, these techniques have some limitations, being disruptive and not clearly indicating oxygen functionalities available to react with polymers or biological media.In this work, we exploit GO reactivity with copper ions to develop a colorimetric method for the facile evaluation of surface oxidation degree and accessibility in polymeric samples. In the presence of GO, Cu2+ is reduced to Cu1+ and can react with bicinchoninic acid and induce light absorption at 562 nm. We observed that this reaction is dependent both on concentration and oxidation degree, and can be used to estimate GO exposure in thick composite samples. This technique will be fundamental in the future for scaffold characterization in tissue engineering and all the surface science studies analyzing GO-related materials' interactions with biological entities.

Regulation of metabolism by protein modifications in autoimmunity

Abstract In type 1 diabetes (T1D), inflammation and oxidative stress in pancreatic islets amplifies various post-translational modifications (PTMs) of self-proteins. The loss of immune tolerance to islet PTMs triggers an autoreactive T cell response and contributes to the destruction of insulin-producing beta cells in T1D. The major function of beta cells is to secret insulin in response to glucose uptake in order to maintain glucose homeostasis. In this study, we identify autoantibodies against to beta subunit of prolyl-4-hydroxylase (P4Hb; native and carbonylated form) and glucokinase (GK; native and citrullinated form) in both human T1D and murine models. Glucokinase serves as a glucose sensor to initiate glycolysis and insulin signaling in beta cells. P4Hb is required for the accurate folding of insulin. By mass spectrometry, six carbonyl residues and eleven citrulline residues were mapped in oxidative rhP4Hb and PAD-treated rhGK, respectively. Of interest, autoreactive CD4+ T cells to citrullinated GK epitopes are present in the circulation of T1D patients. In regards to glucose metabolism, the carbonylated-P4Hb is amplified in stressed human islets coincident with decreased glucose-stimulated insulin secretion and disturb (increase) proinsulin to insulin ratios. The citrullination alters GK biologic activity (Km) and suppresses glucose-stimulated insulin secretion. Moreover, PAD2/4 inhibitors can partially restore IFNg +IL-1b suppressed glucose stimulated insulin secretion in INS-1E beta cells. Our studies implicate the crucial enzymes, glucokinase and P4Hb, as the biomarkers, providing new insights into creating autoantigens and define the impact of metabolic PTMs on the aberrant beta cell functions of T1D. This research was supported by the Juvenile Diabetes Research Foundation (Innovative Grant to M.J.M., 2-SRA-2018-551-S-B to E.A.J.), and National Institutes of Health (DK104205-01 to K.H. and M.J.M.).

Effect of Dipeptidyl-Peptidase 4 Inhibitors on Circulating Oxidative Stress Biomarkers in Patients with Type 2 Diabetes Mellitus.

Pre-clinical studies suggested potential cardiovascular benefits of dipeptidyl peptidase-4 inhibitors (DPP4i), however, clinical trials showed neither beneficial nor detrimental effects in patients with type 2 diabetes mellitus (T2DM). We examined the effects of DPP4i on several circulating oxidative stress markers in a cohort of 32 T2DM patients (21 males and 11 post-menopausal females), who were already on routine antidiabetic treatment. Propensity score matching was used to adjust demographic and clinical characteristics between patients who received and who did not receive DPP4i. Whole-blood reactive oxygen species (ROS), plasma advanced glycation end products (AGEs), advanced oxidation protein products (AOPP), carbonyl residues, as well as ferric reducing ability of plasma (FRAP) and leukocyte DNA oxidative damage (Fpg sites), were evaluated. With the exception of Fpg sites, that showed a borderline increase in DPP4i users compared to non-users (p = 0.0507), none of the biomarkers measured was affected by DPP4i treatment. An inverse correlation between estimated glomerular filtration rate and AGEs (p < 0.0001) and Fpg sites (p < 0.05) was also observed. This study does not show any major effect of DPP4i on oxidative stress, assessed by several circulating biomarkers of oxidative damage, in propensity score-matched cohorts of T2DM patients.

2-Hydroxy-(4-methylseleno)butanoic Acid Is Used by Intestinal Caco-2 Cells as a Source of Selenium and Protects against Oxidative Stress

Selenium (Se) participates in different functions in humans and other animals through its incorporation into selenoproteins as selenocysteine. Inadequate dietary Se is considered a risk factor for several chronic diseases associated with oxidative stress. The role of 2-hydroxy-(4-methylseleno)butanoic acid (HMSeBA), an organic form of Se used in animal nutrition, in supporting selenoprotein synthesis and protecting against oxidative stress was investigated in an in vitro model of intestinal Caco-2 cells. Glutathione peroxidase (GPX) and thioredoxin reductase (TXNRD) activities, selenoprotein P1 protein (SELENOP) and gene (SELENOP) expression, and GPX1 and GPX2 gene expression were studied in Se-deprived (FBS removal) and further HMSeBA-supplemented (0.1-625 μM, 72 h) cultures. The effect of HMSeBA supplementation (12.5 and 625 μM, 24 h) on oxidative stress induced by H2O2 (1 mM) was evaluated by the production of reactive oxygen species (ROS), 4-hydroxy-2-nonenal (4-HNE) adducts, and protein carbonyl residues compared with a sodium selenite control (SS, 5 μM). Se deprivation induced a reduction (P<0.05) in GPX activity (62%), GPX1 expression, and both SELENOP (33%) and SELENOP expression. In contrast, an increase (P<0.05) in GPX2 expression and no effect in TXNRD activity (P=0.09) were observed. HMSeBA supplementation increased (P<0.05) GPX activity (12.5-625 μM, 1.68-1.82-fold) and SELENOP protein expression (250 and 625 μM, 1.87- and 2.04-fold). Moreover, HMSeBA supplementation increased (P<0.05) GPX1 (12.5 and 625 μM), GPX2 (625 μM), and SELENOP (12.5 and 625 μM) expression. HMSeBA (625 μM) was capable of decreasing (P<0.05) ROS (32%), 4-HNE adduct (49%), and protein carbonyl residue (75%) production after H2O2 treatment. Caco-2 cells can use HMSeBA as an Se source for selenoprotein synthesis, resulting in protection against oxidative stress.

&lt;p&gt;Isolation, pharmacological evaluation and molecular docking studies of bioactive compounds from Grewia optiva&lt;/p&gt;

BackgroundTraditionally, Grewia optiva is widely used for the treatment of many diseases like dysentery, fever, typhoid, diarrhea, eczema, smallpox, malaria and cough.MethodsShade-dried roots of G. optiva were extracted with methanol. Based on HPLC results, chloroform and ethyl acetate fractions were subjected to silica column isolation and four compounds: glutaric acid (V), 3,5 dihydroxy phenyl acrylic acid (VI), (2,5 dihydroxy phenyl) 3',6',8'-trihydroxyl-4H chromen-4'-one (VII) and hexanedioic acid (VIII) were isolated in pure form. Ellman’s assay was used to determine the anticholinesterase potential of isolated compounds while their antioxidant potential was estimated by DPPH and ABTS scavenging assays.ResultsAmongst the isolated compounds, VI and VII exhibited excellent percent inhibition of acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) (83.23±1.11, 82.72±2.20 and 82.11±2.11, 82.23±1.21, respectively, at 1000 µg/mL) with IC50 of 76, 90, 78 and 92 µg/mL, respectively. Highest percent radicals scavenging against DPPH and ABTS (87.41±1.20 and 86.13±2.31) with IC50 of 64 and 65 µg/mL, respectively, were observed for compound VII. Molecular docking studies also supported the binding of compound VI and VII with the target enzyme. The para-hydroxyl group of the phenolic moiety is formed hydrogen bonds with the active site water molecule and the side chain carbonyl and hydroxyl residues of enzyme.ConclusionThe isolated compounds inhibited the DPPH and ABTS-free radicals, and AChE and BChE enzymes. It was concluded that these compounds could be used in relieving the oxidative stress and pathological symptoms associated with excessive hydrolysis of acetyl and butyryl choline. The results of the study were supported by docking studies for compounds VI and VII.

TRPV1 Contributes to Cerebral Malaria Severity and Mortality by Regulating Brain Inflammation

Transient receptor potential vanilloid 1 (TRPV1) is a Ca+2-permeable channel expressed on neuronal and nonneuronal cells, known as an oxidative stress sensor. It plays a protective role in bacterial infection, and recent findings indicate that this receptor modulates monocyte populations in mice with malaria; however, its role in cerebral malaria progression and outcome is unclear. By using TRPV1 wild-type (WT) and knockout (KO) mice, the importance of TRPV1 to this cerebral syndrome was investigated. Infection with Plasmodium berghei ANKA decreased TRPV1 expression in the brain. Mice lacking TRPV1 were protected against Plasmodium-induced mortality and morbidity, a response that was associated with less cerebral swelling, modulation of the brain expression of endothelial tight-junction markers (junctional adhesion molecule A and claudin-5), increased oxidative stress (via inhibition of catalase activity and increased levels of H2O2, nitrotyrosine, and carbonyl residues), and diminished production of cytokines. Plasmodium load was not significantly affected by TRPV1 ablation. Repeated subcutaneous administration of the selective TRPV1 antagonist SB366791 after malaria induction increased TRPV1 expression in the brain tissue and enhanced mouse survival. These data indicate that TRPV1 channels contribute to the development and outcome of cerebral malaria.

Modification of lipase from Candida cylindracea with dextran using the borane-pyridine complex to improve organic solvent stability

In this study, a commercial lipase derived from Candida cylindracea was chemically modified with dextran by conjugating ε-amine in the lysine residue with the carbonyl residue in oxidized dextran using the borane-pyridine complex as a reducing agent to increase the hydrophilicity of the microenvironment around the lipase in the presence of organic solvents. The degree of modification (53.2%), amount of dextran (0.66 g/g-lipase), specific activity (similar to that of the unmodified lipase), and stability in the presence of ethanol and 2-propanol (the half-lives were 2.24 and 1.86 times longer than those of the unmodified lipase) were higher for the lipase modified at pH 8.0 than for the lipases modified at other pH levels. Following modification with dextran at pH 8.0, the stability of the modified lipase was higher than that of the unmodified lipase in the presence of 25% (v/v) DMSO, ethanol, 2-propanol, toluene, n-hexane, and isooctane (the half-lives were 1.45, 2.24, 1.86, 1.76, 2.67 and 2.95 times longer than those of the unmodified lipase). Therefore, chemical modification with polysaccharides such as dextran using the borane-pyridine complex as a reducing agent could be a promising approach for improving the organic solvent stability of enzymes.

Anticholinesterase, antioxidant potentials, and molecular docking studies of isolated bioactive compounds from Grewia optiva

ABSTRACTGrewia optiva Drummond ex Burret (Tiliceae) is extensively applied for the treatment of typhoid, diarrhea, malaria, etc., in traditional medication. In this study, four bioactive compounds I (β- sitosterol), II (1, 2, 3 benzene triol), III (7-O-methyl cathachin) and VI (betulinic acid) were isolated from the root of G. optiva. The compounds were characterized through UV, FTIR, NMR, and mass spectroscopic techniques. The isolated compounds were tested for the inhibition of synthetic-free radicals: ABTS and DPPH, and anticholinesterases: AChE and BChE. Compound III demonstrated highest percent free radicals scavenging activities against DPPH and ABTS (86.11 ± 2.20, 85.23 ± 1.61, respectively, for 1000 µg/ml concentrations) with IC50 of 63 µg/ml which were comparable to the IC50 value (35 µg/ml) of ascorbic acid. All isolated compounds also showed excellent inhibitory potential against AChE and BChE. However, β-sitosterol amongst them exhibited highest percent inhibition (87.66 ± 1.93, 85.71 ± 1.17, respectively, at 1000 µg/ml concentration) with IC50 of 62 µg/ml, which was close to the standard galanthamine IC50 values (40 µg/ml). To support the findings of the study silico docking model was applied that predicted possible binding modes of β-sitosterol with AChE and BChE. The para hydroxyl group of the phenolic moiety interacted with the active site water molecule and the side chain carbonyl residues through H-bonding. The remaining part of the active compound packed in a shallow pocket through H-bond.

Effects of RF plasma modification on the thermal and mechanical properties of electrospun chitosan/poly(vinyl alcohol) nanofiber mats

On the design and fabrication of biomedical devices, the mechanical integrity and the thermal stability of the materials used are of paramount consideration. In this study, the effects of 13.56 MHz radio frequency plasma modification using argon (Ar) and oxygen (O2) discharges on the morphology, thermal properties, and tensile properties of the nonwoven electrospun chitosan/poly(vinyl alcohol) nanofiber mats were investigated. The scanning electron microscope images showed a significant change in the morphology of the nanofiber mats due to the Ar and O2 plasma treatment. The thermogravimetric-differential thermogravimetry data revealed two major degradation steps for both the pristine samples and the Ar plasma-treated samples due to the molecular backbone degradation and decomposition of polyene and carbonyl residues. However, a third peak was observed for O2 plasma-treated samples which may be due to the oxygen functionalities imparted by the discharge as seen from the Fourier-transform infrared spectroscopy data. Differential scanning calorimetry (DSC) results have shown the glass transition temperature at 65–68 °C and a melting temperature at around 200–220 °C. Also, a decrease in the crystallinity of the plasma-treated samples were noted from the DSC thermograms. A significant (p &amp;lt; 0.05) decrease in the tensile strength, yield strength, Young's modulus, and elongation at break were noted for the plasma-treated samples due to the etching and ablation effects induced by energetic particle interactions. However, the mechanical properties are still comparable with the tensile properties of human tissues such as the skin. These nonwoven mats with tunable properties have potential use in biomedical engineering, particularly as tissue scaffolds, wound dressings, sutures, and antibacterial gauzes.

Sulfur(lone-pair)…π interactions with FAD in flavoenzymes

AbstractThe interactions of π-systems with lone-pairs of electrons are known and have been described in biological systems, involving lone-pairs derived from metals, metalloids, sulfur, oxygen and nitrogen. This study describes a bibliographic survey of the disulfide-bound sulfur(lone-pair) interactions with π-systems residing in the flavin adenine dinucleotide (FAD) cofactor of oxidoreductase enzymes (flavoenzymes). Thus, of the 172 oxidoreductase enzymes evaluated for gamma-S(lone-pair)…π(FAD) interactions, 96 proteins (56%) exhibited these interactions corresponding; 61% of 350 the constituent monomers featured at least one gamma-S(lone-pair)…π(FAD) interaction. Two main points of association between the S(lone-pair) and the isoalloxazine moiety of FAD were identified, namely at the centroid of the bond linking the uracil and pyrazine rings (60%), and the centroid of the uracil ring (37%). Reflecting the nature of the secondary structure in three prominent classes of oxidoreductase enzymes: glutathione disulfide reductases (GR; 21 proteins), trypanothione disulfide reductases (TR, 14) and sulfhydryl oxidases (SOX, 22), the approach of the gamma-S(lone-pair) to the FAD residue was to the si-face of the isoalloxazine ring system, i.e. to the opposite side as the carbonyl residue, for all GR and TR examples, and to the re-face for all SOX examples. Finally, the attractive nature of the gamma-S(lone-pair)…π(FAD) interactions was confirmed qualitatively by an examination of the non-covalent interaction plots.

Systematic study of the correlation between surface chemistry, conductivity and electrocatalytic properties of graphene oxide nanosheets

A main advantage of graphene oxide (GO) over other materials is the high tunability of its surface functional groups and of its electric conductivity. However, the complex chemical composition of GO renders difficult to unravel the correlation between structural and electric properties. Here, we use a combination of electron spectroscopy and electrochemistry to correlate the surface chemistry of GO to its electrical conductivity and electrocatalytic properties with respect to two molecules of high biological interest: β-nicotinamide adenine dinucleotide (NADH) and vitamin C. We demonstrate that the electrocatalytic properties of the material are due to hydroxyl, carbonyl and carboxyl groups residues that, even if already present on pristine GO, become electroactive only upon GO reduction.The results of this study demonstrate the advantages in the use of GO in amperometric biosensing and in enzymatic biofuel cells: it allows the oxidation of the target molecules at low potential values, with a sensitivity >15 times higher with respect to standard, carbon-based electrode materials.Finally, we demonstrate that the right amount of chemical groups to achieve such high performance can be obtained also by direct electrochemical exfoliation of bulk graphite, without passing through GO production, thus rendering this approach suitable for cheap, large-scale applications.

New Fluorescent Conjugates Displaying Solvatochromic Properties

AbstractFour new fluorescent dyes based on bis(phenyl‐ethynyl‐)‐2‐naphthyl (BPEN) were designed and synthesized. To improve the solvatochromic property and enhance the brightness of the fluorescent BPEN, an electron‐donating unit of azetidine and/or an electron deficient group of ‐NO2 was introduced. The corresponding fluorophores are denoted as T1, T2, T3 and T4, respectively. Moreover, to facilitate derivatization of the probes, two ethoxy carbonyl residues were grafted onto the side positions of BPEN. Spectroscopic studies demonstrated that introduction of azetidine leads to superior solvatochromic properties and largely enhanced fluorescence quantum yields as evidenced by the fact that T3 shows more than 150 nm shift in its maximum emission when dissolved in solvents of very different polarities and displays high fluorescence quantum yields in the solvents studied. However, T2, which is the one bearing a ‐NO2 group, is non‐fluorescent. Theoretical analysis and Lippert‐Mataga modeling revealed the intra‐molecular charge transfer (ICT) nature of the solvatochromic behavior of the compounds. Further test reveals that the fluorophores, in particular T3, are sensitive to the presence of trace water in less polar solvents, such as THF and 1,4‐dioxane. Moreover, it is believed that the new fluorophores may serve as building blocks for creating environment‐sensitive fluorescent sensors.

Calcium Dobesilate Is Protective against Inflammation and Oxidative/Nitrosative Stress in the Retina of a Type 1 Diabetic Rat Model

Calcium dobesilate (CaD) has been prescribed to some patients in the early stages of diabetic retinopathy to delay its progression. We previously reported that the treatment of diabetic animals (4 weeks of diabetes) with CaD, during the last 10 days of diabetes, prevents blood-retinal barrier breakdown. Here, we aimed to investigate whether later treatment of diabetic rats with CaD would reverse inflammatory processes in the retina. Diabetes was induced with streptozotocin, and 6 weeks after diabetes onset, CaD (100 mg/kg/day) was administered for 2 weeks. The treatment with CaD significantly increased glial fibrillary acidic protein (GFAP) levels in the retina of nondiabetic animals (138.6 ± 12.8% of control) and enhanced the diabetes-induced increase in GFAP levels (174.8 ± 5.6% of control). In addition, CaD prevented the increase in mRNA and protein expression of tumor necrosis factor and interleukin-1β, as well as the formation of oxidized carbonyl residues and the increase in nitrotyrosine immunoreactivity, particularly in the ganglion cell layer of diabetic animals. We demonstrate that the treatment of diabetic animals with CaD can reverse the established proinflammatory processes in the retina. These beneficial effects appear to be attributed, at least partially, to the antioxidant properties of CaD.

G protein coupled receptor interactions with cholesterol deep in the membrane

G protein coupled receptors (GPCRs) are located in membranes rich in cholesterol. The membrane spanning surfaces of GPCRs contain exposed backbone carbonyl groups and residue side chains potentially capable of forming hydrogen bonds to cholesterol molecules buried deep within the hydrophobic core of the lipid bilayer. Coarse-grained molecular dynamics (CGMD) simulations allow the observation of GPCRs in cholesterol-containing lipid bilayers for long times (50μs), sufficient to ensure equilibration of the system. We have detected a number of deep cholesterol binding sites on β2 adrenergic and A2A adenosine receptors, and shown changes in these sites on agonist binding. The requirements for binding are modest, just a potential hydrogen bond partner close to a cleft or hole in the surface. This makes it likely that similar binding sites for cholesterol will exist on other classes of membrane protein.

Cereblon Splicing of Exon 10 Mediates IMiDs Resistance in Multiple Myeloma: Clinical Validation in the CoMMpass Trial

Background: IMiDs neomorphe the substrates binding of CRL4_DDB1_ROC1 E3 ligase through their interaction with the adaptor protein Cereblon (CRBN) triggering the proteasomal degradation of IKZF1/IKZF3. This binding results from hydrogen bonds forming between the carbonyl residues of the IMiDs' glutarimide moiety and several amino acids within a hydrophobic pocket on the surface of CRBN. This pocket is formed by three tryptophan residues (W380, W386 and W400) mapping to CRBN c-terminus exons 10-11. Others and us, have previously shown that in vitro silencing or knock-out of CRBN is clearly associated with resistance to IMiDs, however CRBN mutations mapping to its thalidomide binding domain are rarely seen. We have previously identified through paired sequencing of the transcriptome of primary myeloma cells (pre- and post IMiDs) the expression of a CRBN mRNA splice variant (CRBN-005 or ENST00000424814) lacking exon 10. We also demonstrated that this isoform is translated into a stable protein that retains its binding to DDB1/Cul4a ligase but was no longer capable of interacting with IMiDs. Functionally, in HEK293 we have also shown that stable expression of CRBN-005 at higher levels relative to the full-length variant (CRBN-004 or ENST00000231948) abrogated IMiDs-induced degradation of Ikaros. In the current work, we validated in myeloma cell lines in vitro that the splicing of CRBN exon 10 was sufficient to reverse the cytotoxicity of lenalidomide. We also interrogated the longitudinal CoMMpass trial for the expression of CRBN-005 transcripts and its impact on survival.Methods and Results: We initially confirmed that lentiviral CRISPR mediated stable knock-out of CRBN using gRNA targeting exon 2 in the MM1S and OPM2 lenalidomide sensitive cell lines, resulted in complete resistance to IMiDs. In order to examine the role of CRBN exon 10 splicing in IMiDs resistance, we next cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into lentiviral plasmid pLX304 and stably transduced JJN3 and KMS28BM myeloma cells. The Δ10-CRBN plasmid expressed a ~ 45 kDa proteins detectable by western blotting with CRBN65 antibody (Celgene, binds aa 65-76). Stable expression of Δ10-CRBN in JJN3 and KMS28BM cells significantly reduced Aiolos and Ikaros degradation in response to lenalidomide treatment and partially reversed (~ 30%) KMS28BM cell death (JJN3 are resistant to lenalidomide despite IKZF1 degradation). Consistent with our previous studies in HEK293 cells, high expression of Δ10-CRBN relative to endogenous WT-CRBN was required for the reversal of lenalidomide effects. Furthermore, we used the CRIPSR technology to induce splicing of endogenous CRBN exon 10 using two lentiviral gRNAs targeting intron9-exon10 (TTTATCCTTATGTGGGCCGA) and exon10-intron10 junctions (CAGAACACAGCTGGTTTCCT) in lenalidomide-sensitive MM1S and OPM2 cells stably engineered to express Cas9. Single cell clones expressing the exon 10 spliced CRBN were identified by cDNA cloning and sanger sequencing. The viability of the clones in response to lenalidomide as well as Ikaors degradation were nearly fully reversed in comparison to Cas9 only expressing MM1S and OPM2 cells. Lastly, in order to clinically validate the role of Δ10-CRBN in IMiDs resistance we interrogated the transcriptome of patients enrolled in the CoMMpass trial where in addition to genomic profiling (shallow genome long-insert sequencing, WES, RNAseq) clinical data and outcomes are captured. In the CoMMpass IA8, clinical and molecular data is available on 549 subjects, of which 486 were identified as ever receiving IMiDs-based regimen. We analyzed the survival of these patients based on the ratio of transcript levels (TPM) of spliced CRBN (ENST00000424814) to that of full-length CRBN. Using a cut-off ratio of 0.75, the survival of patients treated with IMiDs based regimen and high levels of spliced CRBN was significantly worse (Figure). Importantly, in 20 patients were RNA was available pre- and post IMiDs, we show that the levels of the CRBN spliced variants were significantly increased at the time of disease progression (Figure boxplot).Conclusions: In the current work, we have confirmed the role CRBN exon 10 splicing in IMiDs resistance using functional in vitro validation studies and demonstrated its predictive effects on IMiDs activity in the CoMMpass clinical dataset. [Display omitted] DisclosuresNeri:Celgene and Jannsen: Consultancy, Honoraria. Lonial:Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy; Janssen: Consultancy; Celgene: Consultancy; Millenium: Consultancy; BMS: Consultancy; Novartis: Consultancy; BMS: Consultancy; Merck: Consultancy; Onyx: Consultancy; Onyx: Consultancy. Bahlis:Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Onyx: Consultancy, Honoraria; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; BMS: Honoraria; Amgen: Consultancy, Honoraria.

Gender-related drug effect on several markers of oxidation stress in diabetes patients with and without complications

We previously reported that circulating lipid (malondialdehyde, MDA) and protein oxidation (carbonyl residues, CO) products can be used as markers of risk for complications in poorly controlled type 2 diabetics. Now, we aimed to evaluate the existence of a gender effect on classical disease markers and oxidative stress parameters and on the effectiveness of metformin and/or statins in reducing CV risk in poorly controlled type 2 diabetics with and without complications. Our results show that diabetics with complications had higher plasma levels of FRAP, SOD and hs-CRP than those without complications, with FRAP and SOD found increased in both genders. Interestingly, male and female patients with complications had higher plasma levels of hs-CRP and MDA respectively, over patients without complications. Multivariate analysis indicated metformin and statin treatments effective in reducing plasma hs-CRP only in female and not in male diabetics with complications. In these latter females, a positive correlation between hs-CRP and triglycerides (TG) levels was found suggesting a causal relationship between them. Statin treatment was effective in reducing MDA in diabetics with complications irrespective of the gender. These data support the addition of statins to diabetic standard therapy to control oxidation injury and inflammation and, for the first time, indicate female patients with complications more responsive than males to the CV protection offered by metformin.

Aldehyde modification and alum coadjuvancy enhance anti-TNF-α autovaccination and mitigate arthritis in rat.

Experimental vaccination to induce antibodies (Abs) capable of cytokine antagonism shows promise as a novel immunotherapy for chronic inflammatory disease. We prepared a hybrid antigen consisting of residues 141-235 of rat TNF-α fused to the C-terminus of glutathione-S-transferase (GST), chemically modified to incorporate aldehyde residues, for development of an auto-vaccine eliciting anti-rTNF-α Abs. In rat immunization the soluble aldehyde-modified fusion protein did not generate observable Ab responses. By contrast, vaccination with the aldehyde-modified fusion protein adsorbed on alum induced anti-TNF-α autoAbs with high titer and neutralizing activity. Induction of adjuvant arthritis in rats pre-immunized with unmodified fusion protein or a control protein in alum resulted in severe inflammation and joint damage, whereas the disease induced in rats immunized with the aldehyde-bearing fusion protein in alum was markedly attenuated. Similar results were obtained in a collagen-induced rat arthritis model. Anti-collagen II IgG Ab titers did not deviate significantly in groups pre-immunized with modified fusion protein and control protein, suggesting that anti-TNF vaccination did not skew the immune response related to disease induction. This study demonstrates synergy between particulate alum and protein bound carbonyl residues for enhancement of protein immunogenicity. The antigen-specific co-adjuvant system could prove advantageous for breaking tolerance in emerging auto-vaccination therapies targeting inflammatory cytokines as well as for enhancing a broader category of subunit vaccines. Aldehyde adduction introduces a minimal modification which, together with the established use of alum as a safe adjuvant for human use, could be favorable for further vaccine development.