Canonical Triad Research Articles

Variations of the canonical triad of IsPETase: In silico insights with molecular dynamics simulation

Plastic waste causes severe environmental problems worldwide, and biological recycling is an eco-friendly method to deal with it. The discovery of IsPETase has attracted interest in the scientific community. Its mesophilic nature is an exciting characteristic for new perspectives into PET degradation research. Here, we used a molecular dynamics approach and discussed the possibility of variations for the canonical catalytic triad at pH 7 and 300 K. We prepared three variants and performed a comparative molecular docking protocol of BHET in these three and the wild type. We performed molecular dynamics focusing on the nucleophilic distance and the protonation states of the residues chosen on our mutations. In all simulations, the ligand remained bound to the active site. The total binding energy on the variants diminished but always remained favorable for interaction. Upon analysis of the interaction contribution of each residue, the simulations with the wild type and D206E presented a more stable bond with basically the same binding energy pattern. However, the lysine variants showed a reduction in the unfavorable contributions – while D206E/H237K did not present any unfavorability whatsoever. The new charge distribution and side chains conformation for both lysine variants kept the nucleophilic distance while pushing the ligand away from the oxyanion hole. The single mutants studied here did not show promising results. However, the peculiar behavior of D206E/H237K provokes curiosity about what consequences may arise with empirical data. We believe the discussion here may benefit future efforts regarding PET degradation efficiency at ambient conditions.

When Novels Were Books

When Novels Were Books

Genetic, biochemical, and serological characterization of a new pneumococcal serotype, 6H, and generation of a pneumococcal strain producing three different capsular repeat units.

Streptococcus pneumoniae clinical isolates were recently described that produced capsular polysaccharide with properties of both serotypes 6A and 6B. Their hybrid serological property correlated with mutations affecting the glycosyltransferase WciP, which links rhamnose to ribitol by an α(1-3) linkage for serotypes 6A and 6C and an α(1-4) linkage for serotypes 6B and 6D. The isolates had mutations in the triad residues of WciP that have been correlated with enzyme specificity. The canonical triad residues of WciP are Ala192-Ser195-Arg254 for serotypes 6A and 6C and Ser192-Asn195-Gly254 for serotypes 6B and 6D. To prove that the mutations in the triad residues are responsible for the hybrid serotype, we introduced the previously described Ala192-Cys195-Arg254 triad into a 6A strain and found that the change made WciP bispecific, resulting in 6A and 6B repeat unit expression, although 6B repeat unit production was favored over production of 6A repeat units. Likewise, this triad permitted a 6C strain to express 6C and 6D repeat units. With reported bispecificity in WciN, which adds either glucose or galactose as the second sugar in the serogroup 6 repeat unit, the possibility exists for a strain to simultaneously produce all four serogroup 6 repeat units; however, when genes encoding both bispecific enzymes were introduced into a 6A strain, only 6A, 6B, and 6D repeat units were detected serologically. Nonetheless, this may be the first example of a bacterial polysaccharide with three different repeat units. This strategy of expressing multiple repeat units in a single polymer is a novel approach to broadening vaccine coverage by eliminating the need for multiple polysaccharide sources to cover multiple serogroup members.

Is Cryptochrome a Primary Sensor of Extremely Low Frequency Magnetic Fields in Childhood Leukemia?

Extremely low frequency magnetic fields (ELF MF) are classified as possibly carcinogenic to humans, but the biophysical mechanisms of a causal relationship remain unclear. A cryptochrome-based radical pair mechanism (RPM) has been invoked as the primary MF sensor in animal magnetoreception to explain effects from MF strengths in the nT range. Model studies of the RPM in aprotic solution require cryogenic temperatures and MFs in the µT range to elicit marginal responses, implying that physiological responses evoked by radical pairs in biological milieu are unlikely. We explore ideas about how signals from transient radical pairs in cryptochrome might be transduced and amplified in mutagenic responses. The cryptochrome-based RPM involves blue light activation of the flavin adenine dinucleotide (FAD) cofactor followed by electron transfer (ET) from a conserved triad of tryptophan residues. However, intramolecular ET involving additional conserved aromatic residues in cryptochrome likely extends beyond the canonical triad. Further, ascorbate, which is present at millimolar concentrations in leukocytes, is likely to transfer an electron to the ultimate amino acid radical formed during one-electron reduction of FAD. The ascorbyl radical has been proposed as a potential radical pair partner in the RPM. The flavin semiquinone radical may be reoxidized to the resting state via ET to O2 to form O2•−. Increased levels of the ascorbyl radical and O2•− would contribute to oxidative stress pathways in the cell. Oxidative stress responses in cancer are thought to be mediated in part by the mitogen activated protein kinase (MAPK) signaling pathway. We have presented evidence for alteration of MAPK activation in response to ELF MF. Acknowledgement: This project has received funding from the European Union's Seventh Programme for research, technological development, and demonstration under grant agreement No. 282891.

The Spirit and the Story: Some Pentecostal Musings on Robert W. Jenson's View of Scripture

AbstractThis essay examines Robert W. Jenson's understanding of how Scripture functions for the Church, particularly in terms of how the canonical triad of Scripture, creed, and office form an interpretive synergism for helping the church fulfill its task of gospel-speaking in the post-apostolic world. Jenson's views are then brought into a brief conversation with various strands of Pentecostal belief regarding the role Scripture plays within that tradition. This interchange highlights areas in which both parties are in agreement as well as areas where the positions of each might inform the other's views. Given that each in their own way seeks to understand the role of the Spirit in helping the church remain faithful to its apostolic roots, an exchange of ideas between the two parties might give each a greater appreciation for the multifaceted work of the Spirit in the preservation and proclamation of the gospel in the world.

Structures of the PIN domains of SMG6 and SMG5 reveal a nuclease within the mRNA surveillance complex

SMG6 and SMG5 are essential factors in nonsense-mediated mRNA decay, a conserved pathway that degrades mRNAs with premature translation termination codons. Both SMG5 and SMG6 have been predicted to contain a C-terminal PIN (PilT N-terminus) domain, present in proteins with ribonuclease activity. We have determined the structures of human SMG5 and SMG6 PIN domains. Although they share a similar overall fold related to ribonucleases of the RNase H family, they have local differences at the putative active site. SMG6 has the canonical triad of acidic residues that are crucial in RNase H for nuclease activity, while SMG5 lacks key catalytic residues. The structural differences are reflected at the functional level. Only the PIN domain of SMG6 has degradation activity on single-stranded RNA in vitro. This difference in catalytic activity is conserved in Drosophila, where an SMG6 with an inactive PIN domain inhibits NMD in a dominant-negative manner. Our findings suggest that the NMD machinery has intrinsic nuclease activity that is likely to contribute to the rapid decay of mRNAs that terminate translation prematurely.

Cockroach allergen Bla g 2: An unusual aspartic proteinase

Enzymatic activity of mite, fungal, and bee venom allergens is thought to potentiate their allergenicity. Bla g 2 is a potent cockroach allergen, but despite sharing sequence homology with aspartic proteinases, it contains critical amino acid substitutions that impair proteolytic activity. The biologic function of Bla g 2 remains unclear. We sought to investigate the effects of specific amino acid substitutions on enzymatic activity, and the peptide-binding capability of Bla g 2. Site-directed mutagenesis was used to produce a recombinant Bla g 2 mutant (Mut) with corrected canonical triads and a flap region. Another mutant (MutF - ) was expressed after additional mutations in the flap region of Mut. Bla g 2 wild-type (Wt), Mut, and MutF - were assayed for aspartic proteinase activity, and Bla g 2 Wt was tested for pepstatin binding. Recombinant Bla g 2 Wt and Mut did not show enzymatic activity in a milk-clotting and hemoglobin assay. By using a modified hemoglobin assay, residual activity inhibited by pepstatin was detected for MutF - and Wt at 20 microg/mL, whereas pepsin was active at a 1000-fold lower concentration. Most of Bla g 2 binding to pepstatin-agarose was nonspecific. Residual proteolytic activity was found for Bla g 2 at concentrations of approximately 4 mM. This weak activity suggests that proteolysis is not the primary function of this allergen and that it is unlikely to contribute to the allergenicity of Bla g 2. Bla g 2 has a cleft that might specifically bind ligands other than pepstatin.

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads.

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.

Proton exchange and local stability in a DNA triple helix containing a G.TA triad.

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C(+).GC triad. The results indicate that, in the G.TA triad, the stability of the Watson-Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6-1.8 kcal/mol at 1 degrees C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

Sequencing and characterization of the citrus weevil, Diaprepes abbreviatus, trypsin cDNA. Effect of Aedes trypsin modulating oostatic factor on trypsin biosynthesis.

Trypsin mRNA from the citrus weevil, Diaprepes abbreviatus, was reverse transcribed and amplified by PCR. A cDNA species of 513 bp was cloned and sequenced. The 3' and 5' ends of the gene (262 bp and 237 bp, respectively) were amplified by rapid amplification of cDNA ends, cloned and sequenced. The deduced sequence of the trypsin cDNA (860 bp) encodes for 250 amino acids including 11 amino acids of activation and signal peptides and exhibited 16.8% identity to trypsin genes of selected Lepidoptera and Diptera. A three-dimensional model of Diaprepes trypsin contained two domains of beta-barrel sheets as has been found in Drosophila and Neobellieria. The catalytic active site is composed of the canonical triad of His41, Asp92 and Ser185 and a specificity pocket occupied by Asp179 with maximal activity at pH 10.4. Southern blot analysis indicated that at least two copies of the gene are encoded by Diaprepes midgut. Northern blot analysis detected a single RNA band below 1.35 kb at different larval ages (28-100 days old). The message increased with age and was most abundant at 100 days. Trypsin activity, on the other hand, reached a peak at 50 days and fell rapidly afterwards indicating that the trypsin message is probably regulated translationally. Feeding of soybean trypsin inhibitor and Aedes aegypti trypsin modulating oostatic factor affected trypsin activity and trypsin biosynthesis, respectively. These results indicate that Diaprepes regulates trypsin biosynthesis with a trypsin modulating oostatic factor-like signal.

Molecular sequencing and modeling of Neobellieria bullata trypsin. Evidence for translational control by Neobellieria trypsin-modulating oostatic factor.

Trypsin mRNA from the grey fleshfly (Neobellieria bullata) was reversed transcribed and amplified by means of PCR. Two cDNA species of 600 bp and 800 bp were cloned and sequenced. The 3' end of the gene (300 bp) was amplified by means of the rapid-amplification-of-cDNA-ends method, cloned and sequenced. The deduced protein sequence of 254 amino acids exhibited 46% identity to Drosophila trypsin and 32% identity to Anophiline trypsin and Aedes trypsin. Three-dimensional models of Neobellieria trypsin and Drosophilia trypsin were built and compared. Both models contain two domains of beta-barrel sheets as was shown by means of X-ray crystallography of mammalian trypsin. The catalytic active site is composed of the canonical triad of His42, Asp87 and Ser182 whereas Asp176 sits as the bottom of the specificity pocket. Southern blot analysis suggested that Neobellieria trypsin is encoded by one gene. Northern blot analysis showed that an early trypsin transcript is found in the midgut of sugar-fed females. This message disappeared after a liver meal, and was replaced by a late transcript. Injection of trypsin-modulating oostatic factor (TMOF) at 10(-9) M prevented the disappearance and the translation of the early transcript. TMOF did not prevent the appearance of the late transcript. However, in the presence of the hormone the late transcript was not translated. Thus, TMOF is the biological signal that terminates the translation of trypsin mRNA in the fleshfly gut and probably in the mosquito gut.