Campestris Yunck Research Articles

Study of Dodder (Cuscuta campestris Yuncker) as a Pharmaceutically Effective Natural Dyestuff Source

Study of Dodder (Cuscuta campestris Yuncker) as a Pharmaceutically Effective Natural Dyestuff Source

Metabolic changes induced by Cuscutacampestris Yunck in the host species Artemisia campestris subsp. variabilis (Ten.) Greuter as a strategy for successful parasitisation

Main conclusionsC. campestris parasitisation increases internal host defences at the expense of environmentally directed ones in the host species A. campestris, thus limiting plant defence against progressive parasitisation.Cuscuta campestris Yunck is a holoparasitic species that parasitises wild species and crops. Among their hosts, Artemisia campestris subsp. variabilis (Ten.) Greuter is significantly affected in natural ecosystems. Limited information is available on the host recognition mechanism and there are no data on the interactions between these species and the effects on the primary and specialised metabolism in response to parasitisation. The research aims at evaluating the effect of host–parasite interactions, through a GC–MS untargeted metabolomic analysis, chlorophyll a fluorescence, ionomic and δ13C measurements, as well as volatile organic compound (VOC) fingerprint in A. campestris leaves collected in natural environment. C. campestris parasitisation altered plant water status, forcing stomatal opening, stimulating plant transpiration, and inducing physical damages to the host antenna complex, thus reducing the efficiency of its photosynthetic machinery. Untargeted-metabolomics analysis highlighted that the parasitisation significantly perturbed the amino acids and sugar metabolism, inducing an increase in the production of osmoprotectants, which generally accumulate in plants as a protective strategy against oxidative stress. Notably, VOCs analysis highlighted a reduction in sesquiterpenoids and an increase in monoterpenoids levels; involved in plant defence and host recognition, respectively. Moreover, C. campestris induced in the host a reduction in 3-hexenyl-acetate, a metabolite with known repellent activity against Cuscuta spp. We offer evidences that C. campestris parasitisation increases internal host defences via primary metabolites at the expense of more effective defensive compounds (secondary metabolites), thus limiting A. campestris defence against progressive parasitisation.

Comparative in vitro biological activity analysis of Cuscuta reflexa Roxb. and C. campestris Yuncker.

Cuscuta reflexa Roxb. and C. campestris Yuncker are widely used as medicinal plants in different areas of Azad Jammu and Kashmir. Keeping in view of their local uses, antibacterial, antioxidant and phytochemical investigations were carried out in the stem extracts. The antibacterial activities were carried out by Disc diffusion method against Gram positive (Staphylococcus aureus) and Gram negative (Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumonia) bacteria. Ampicillin was used as positive control. It was found that ethanol extract of both the plants were most active as compared to other extracts and S. aureus (Gram positive) was most sensitive bacterium compared to other tested Gram-negative bacteria. The antioxidant potential of the crude extracts of these plants was examined on the source of their scavenging activity of the stable 1, 1-diphenyl-2-picrrazyl hydrazyl (DPPH) free radical and found to possess good antioxidant. Preliminary phytochemical screening has shown the presence of several phytochemicals.

Impact of various herbicides treatments on controlling field dodder (cuscuta campestris yuncker) parasitizing Fenugreek plants (Trigonella foenum-graecum L.)

This study was conducted to evaluate the effect of various herbicides on dodder control in Fenugreek field Glyphosate and Stomp herbicides were applied at different rates to control the parasitic weed Cuscuta campestris Yunck on fenugreek plants Trigonella foenum graecum L Results revealed that applying glyphosate post attachment at very low rates and g fed exhibited selective control for attached dodder with fenugreek plants Both glyphosate rates gave excellent dodder control and significant yield increases Also improved fenugreek plant height number of branches plant number of pods plant and number of seeds pod Whereas stomp pre emergence herbicide was effective only at L fed Data also showed that dodder control increased by increasing the rates of glyphosate and stomp although at higher rates g fed and L fed seed yield can severely reduced and phytotoxic injury to the host plant was clearly observed The obtained results also indicate that both herbicides were markedly increased the leaf contents of total carbohydrates reducing sugars chlorophylls and carotenoid anthocyanin proline total free amino acids total indoles crude proteins and total nitrogen contents in the leaves On the contrary all dodder control treatments decreased total phenols and non reducing sugars in leaves as compared to the control

Cuscuta chinensis and C. campestris Attenuate Scopolamine-Induced Memory Deficit and Oxidative Damage in Mice

The seeds of Cuscuta chinensis Lam. and C. campestris Yuncker have been commonly used as Chinese medical material for preventing aging. Our previous studies have found that C. chinensis and C. campestris possess anti-inflammatory activities in rodents. However, their other biological activities, such as memory-improving properties, have not yet been explored. In the present study, we examined the memory-improving effects of the extracts of C. chinensis and C. campestris on scopolamine (SCOP)-induced memory deficit and explored their underlying mechanism in mice. Both Cuscuta species improved SCOP-induced memory deficits in the passive avoidance test, elevated plus-maze, and spatial performance test of the Morris water maze in mice. In addition, compared with mice injected with SCOP, mice pretreated with both Cuscuta species stayed for a longer time on the platform for the probe test of the Morris water maze. Moreover, both Cuscuta species reduced brain acetylcholinesterase activity and malondialdehyde levels that were increased by SCOP, and the species restored the activities of antioxidant enzymes (superoxide dismutase and catalase) and the levels of glutathione that were decreased by SCOP in the brains of mice. Both Cuscuta species further decreased brain interleukin-1β and tumor necrosis factor-α levels that were elevated by SCOP. We demonstrated that both Cuscuta species exhibited a protective activity against SCOP-induced memory deficit, cholinergic dysfunction, oxidative damage, and neuroinflammation in mice, and C. campestris has better potential than C. chinensis. In addition, we provided evidence that the seeds of C. campestris can be used as Cuscutae Semen in Traditional Chinese Medicine.

Phytochemical Profiling and Evaluation of the Hepatoprotective Effect of Cuscuta Campestris by High-Performance Liquid Chromatography with Diode Array Detection

ABSTRACTPlant-derived antioxidant compounds have the potential to prevent cell damage caused by free radicals. As a holoparasitic plant, Cuscuta campestris Yuncker is being valorized for treatment of liver injury and cancer prevention in traditional medicine. The main purpose of this present study is to elucidate the antioxidant- and anticancer-associated contents of C. campestris by spectroscopic and chromatographic methods. Diethyl ether, ethyl acetate, methanol, n-butanol, and water were used as extraction solvents to reach a wide range of secondary metabolites synthesized by this plant. Antioxidant potentials of these extracts were characterized by (2,2-diphenyl-1-picrylhydrazyl)-free radical scavenging activity. Their anticancer activities were evaluated on SNU-398 hepatocellular carcinoma cells and controlled on the normal adult human dermal fibroblasts (hDFs) cells. Their phenolic compounds were analyzed by high-performance liquid chromatography with diode array detector to illuminate the responsible anticancer agent(s). The ethyl acetate extract revealed the most significant antioxidant effect. Methanol and ethyl acetate extracts were found to be cytotoxic on the SNU-398 cell lines with CC50 values of 18.7 and 19.6 µg mL−1, respectively, whereas these extracts were not cytotoxic to the adult hDFs cells. Due to their abundance in the extracts, isorhamnetin, kaempferol, and quercetin may have caused this anticancer activity. Methanol extract has the highest concentration of phenolic compounds. Based on chromatographic analyses, we propose that these anticancer effects were positively correlated with plant phenolic compounds. The results showed that this plant is worth further study for its therapeutic uses.

First observation of field dodder and its host range in Meghalaya

The present paper reports the first observation of a field dodder, Cuscuta campestris Yuncker from Meghalaya, Northeast India. Detailed field study has revealed a total of 51 host plant species, with Mikania micrantha Kunth., Parthenium hysterophorus L. and Duranta erecta L. being most favorable hosts. Anatomical study revealed that the parasite deteriorates the host plant by infiltrating its haustoria deep into the vascular bundles. It may also act as an economic threat to agricultural and horticultural sector in the state, as it largely reduces the host vigour and crop production. Therefore, there is an urgent need to control its invasion in the state.

Allelopathic activity of some parasitic weeds

Allelopathic activity of Cuscuta epithymum L. (CVCEY), Cuscuta campestris Yuncker (CVCCA), Phelipanche ramosa (L.) Pomel (ORARA), Phelipanche mutelii (Schultz) Reuter (ORARM) and Phelipanche spp. (PHESS) on germination and initial development of test plats of Lactuca sativa L. cultivar 'Great Lakes' was studied under laboratory conditions. It was found that, water exracts of the parasitic weed species in concentrations 0.4, 0.8, 1.6, 3.2, 6.4 and 12.8% w/v have a relatively high inhibitory effect on the seed germination of test plants. The inhibiting rate of parasitic weed species from family Convolvulaceae ranges from 6.24 to 100.0% and for the species of family Orobanchaceae from 42.1 to 100.0%. Parasitic weed species from family Orobanchaceae (Ph. ramosa, Ph. mutelii and Phelipanche spp.) showed a considerably stronger allelopathic effect (GIaverage 17.9), as compared with the applied concentrations of water exracts of species from family Convolvulaceae (C. epithymum and C. campestris) (GIaverage 22.7).

Simultaneous Quantification of Pharmacologically Active Markers Quercetin, Kaempferol, Bergenin and Gallic Acid from Cuscuta Campestris Yuncker Using HPTLC

Background: Cuscuta campestris Yuncker (Cuscutaceae), is a rootless obligate stem holoparasite that subsists on various plant species worldwide, including economically important crops and reduces their yields substantially causing damage in agriculture. Cuscuta campestris has been reported for its analgesic, anthelminthic, antipyretic, anti-inflammatory activity. Cuscuta campestris is reported to contain cuscutin, quercetin, kaempferol, kaempferol-3- O-glycoside, hyperoside, β-sitosterol, pinoresinol, arbutin, astragalin. Aims and objective: This project work aims at capitalising the therapeutic potential of the plant by quantitating the various phytoconstituents present in the plant. Materials and methods: Separation and detection of four markers was achieved using Toluene: ethyl acetate: methanol: formic acid (6: 6: 2: 1, v/v/v/v). The method was validated as per the norms of the International Conference on Harmonisation (ICH) guidelines. Results: The amount of quercetin, kaempferol, bergenin and gallic acid was found to be 0.5520 ± 0.0090 mg g-1, 0.4980 ± 0.0126 mg g-1, 3.5630 ± 0.0633 mg g-1, 1.3498 ± 0.0234 mg g-1 respectively. Conclusion: The method was found sensitive, accurate and reproducible. Therefore it can be recommended for marker-based standardization and quality assurance of Cuscuta campestris. The present research work is an attempt for simultaneous quantification of quercetin, kaempferol, bergenin and gallic acid from Cuscuta campestris in a single mobile phase. The validated HPTLC method can be further applied to evaluate the quality of any plant reported to possess these phytochemicals.

Effect of native Trichoderma viride and Pseudomonas fluorescens on the development of Cuscuta campestris on chickpea, Cicer arietinum

Cuscuta campestris Yuncker is a serious parasite on several leguminous crops including chickpea in India. Chickpea is an important pulse crop in India and severe incidence of Cuscuta may result in yield loss of about 85.7%. Management of Cuscuta is very difficult because of their intricate relationship with the host, wide host range and lack of resistant genes in the host. Thus induced systemic resistance (ISR) by plant growth promoting microbes (microbial elicitors) may be an effective alternative method for the management of Cuscuta. In the current study, to induce systemic resistance, native isolates of Trichoderma viride Pers. and Pseudomonas fluorescens Flügge were used as seed treatments and foliar spray on chickpea and then infested with C. campestris. Salicylic acid and thiobenzamidazole (synthetic elicitors) were used as standard inducing agents for comparison. Results indicated that fresh seeds of C. campestris germinated rapidly even without scarification and that the germination was not influenced by the proximity of the seeds to the host. Seed treatment followed by foliar sprays with the bioagents and synthetic elicitors induced at 20 and 40 days after sowing (DAS) induced increased production of defense enzymes in chickpea (Cicer arietinum L.) and thus delayed the development (1.8-5 days) and flowering (2.4-4.2 days) of C. campestris. Treatment with both the elicitors also resulted in the enhanced activities of scavengers of enzymes related reactive oxygen species (ROS). Thus the above work would help in the integration of the application of bioagents for effective management of Cuscuta in chickpea.

First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States.

Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5'TCCGTAGGTGAACCTGCGG) and ITS4 (5'TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be "mainly" associated with legumes is C. epithymum Murr., and C. pentagona is "especially" associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2).

Allelopathic Potentials of Cuscuta campestris Yuncker Extracts on Germination and Growth of Radish (Raphanus sativus L.) and Lettuce (Lactuca sativa L.)

Cuscuta campestris Yuncker, commonly known as Golden dodder is an annual problematic parasitic weed in abandoned and derelict areas in Malaysia. The weed is leafless plant, glabrous, yellow-white in colour, with haustoria, sucker-like attachments to the aerial parts of a wide range of host plants. This study was instituted to assess the allelopathic potentials of C. campestris on lettuce and radish as test plants. Three types of treatment using aqueous extract of fresh (fc), and dried s (dc) and ethanol extract of dried C. campestris (ec) were assayed for their allelopathic effects on radish (Raphanus sativus) and lettuce (Lactuca sativa) seeds. These extracts reduced seed germination, root and shoot lengths of both radish and lettuce. The roots of radish were more sensitive vis-à-vis the shoots when exposed to fc, while shoots were more sensitive than roots when exposed to dc. Dose-mediated differences in shoot and root lengths of radish were registered when treated with ec. The roots of lettuce were more sensitive compared with the shoots when exposed to ec, while no measurable effect was observed when roots and shoots of lettuce were exposed to fc and dc. The results demonstrated the allelopathic effects of dodder on the tested host plants. The potentials of these extracts and their chemical constituents as bioactive ingredients for new herbicides are implied.

CuscutasubgenusGrammica(Convolvulaceae) on the Palni Hills with a new record

Cuscuta campestris Yuncker is recorded as a novum on the Palni Hills (India). The parasite occurs in great quantities along the edge of roads, agricultural fields (mostly coffee plantations) and along the bank of streams. The species parasitized every herbaceous plant which came into contact with it. In the examined herbaria every specimen that was collected from the hills under the name of C. chinensis Lam. was reidentified as C. campestris . In addition, despite of the systematic field research there was not found any C. chinensis specimen on the Palni Hills. In this study, several illustrations of C. chinensis are collected and displayed, furthermore the international literature of the morphology and taxonomy of the species are reviewed.

Phytochelatins govern zinc/copper homeostasis and cadmium detoxification in Cuscuta campestris parasitizing Daucus carota

Cuscuta sp., known with the common name of “dodder”, is an obligate parasite capable of invading stems and leaves of a wide range of host plants. Dodder stem usually coils counterclockwise around the host and, within a few days, develops haustorial structures at each point of contact. As soon as dodder haustoria reach host vascular bundles, they start tapping water, photosynthates and minerals. Metal ions such as zinc (Zn) and copper (Cu) are essential for dodder growth and metabolism, although an exceedingly high (over-homeostatic) supply of these micronutrients can result in growth inhibition and cellular toxicity. Even more so, non-essential metals such as cadmium (Cd), if transferred from the host to the parasite, need to be neutralized by timely detoxification mechanisms. In this work, we showed that Cuscuta campestris Yuncker establishes effective haustorial connections with leaf petioles and blades of Daucus carota L. (carrot), with the consequent transfer of Cd and essential metals (such as Zn and Cu) from the host vascular bundles to the parasite. Following up to this point, we detected the presence in the parasite of significant amounts of glutathione and phytochelatins, even in the absence of Cd exposure. This suggests that thiol peptides in dodder might be particularly important for Zn and Cu homeostasis as well as for Cd detoxification. Finally, we demonstrated that dodder is capable of synthesizing phytochelatins on its own, rather than massively importing them from the host, and also provided evidence for the existence of an endogenous, constitutively expressed, dodder's phytochelatin synthase.

The response of two legume crops (hyacinth bean and Kidney bean) to the parasitism of field dodder (Cuscuta campestris)

AbstractAbstract: Microscopic examinations and chemical studies were performed to study the response of two legume crops, hyacinth bean (Lablab purpureus L.) Sweet and kidney bean (phaseolus vulgaris L.) to the filed dodder (FD) (Cuscuta campestris Yuncker) parasitism. Hyacinth bean, showing no effective resistance mechanisms,was found to be a highly susceptible host to FD. However, kidney bean, displaying resistant reactions towards the parasitism of FD,was found to be an incompatible host.The possible reasons for the resistance of kidney bean to FD were anatomical (hypersensitivity) and chemical (high contents of phenolic acids and lignin) stimulated defence mechanisms, which developed during the actual intrusion of FD haustorial cells inside its tissues.

The genusCuscuta(Convolvulaceae) in the Andaman Islands with a new record

Cuscuta campestris Yuncker is recorded as a novum in the Andaman Islands (India). Its habitat was dominated by the association of weeds and adventive species. It has been found that C. campestris is not host specific, but rather habitat specific. The species parasitised every plant which came into contact with it. A new taxonomic key and illustrations is provided to distinguish it from the other species of Cuscuta in the archipelago.

Are herbicide‐resistant crops the answer to controlling Cuscuta?

Herbicide-resistant crop technology could provide new management strategies for the control of parasitic plants. Three herbicide-resistant oilseed rape (Brassica napus L.) genotypes were used to examine the response of attached Cuscuta campestris Yuncker to glyphosate, imazamox and glufosinate. Cuscata campestris was allowed to establish on all oilseed rape genotypes before herbicides were applied. Unattached seedlings of C. campestris, C. subinclusa Durand & Hilg. and C. gronovii Willd. were resistant to imazamox and glyphosate and sensitive to glufosinate, indicating that resistance initially discovered in C. campestris is universal to all Cuscuta species. Glufosinate applied to C. campestris attached to glufosinate-resistant oilseed rape had little impact on the parasite, while imazamox completely inhibited C. campestris growth on the imidazolinone-resistant host. The growth of C. campestris on glyphosate-resistant host was initially inhibited by glyphosate, but the parasite recovered and resumed growth within 3-4 weeks. The ability of C. campestris to recover was related to the quality of interaction between the host and parasite and to the resistance mechanism of the host. The parasite was less likely to recover when it had low compatibility with the host, indicating that parasite-resistant crops coupled with herbicide resistance could be highly effective in controlling Cuscuta.

The influence of the holoparasitic plant Cuscuta campestris on the growth and photosynthesis of its host Mikania micrantha

The influence of the holoparasite Cuscuta campestris Yuncker on the growth and photosynthesis of Mikania micrantha H.B.K. was studied. The results indicate that C. campestris infection significantly reduced the light use efficiency and light saturation point of the host. It significantly reduced the net photosynthetic rate (P(n)) of the 1st and 8th mature leaves of M. micrantha at light saturation point, the apparent quantum yield of the 1st mature leaves, the carboxylation efficiency and CO(2) saturated P(n) of the 8th mature leaves, but increased the light compensation point of the 1st mature leaves. Diurnally, it significantly reduced P(n) between 08.00 h and 16.00 h and stomatal conductance and transpiration from 10.00 h to 16.00 h for the 8th mature leaves. Moreover, the significantly adverse effects of C. campestris infection on P(n) were observed 18 d after parasitization (DAP) for the 4th, 8th and 12th, and 25 DAP for the 1st mature leaves of M. micrantha, and they became greater with infection time. The infection also significantly reduced the number of leaves, leaf area, stem length, and biomass, and prevented flowering of M. micrantha in the growing season, and caused almost complete death of the aerial parts of the host about 70 DAP, but the uninfected plants grew and developed normally. Furthermore, the total biomass of the infected host and the parasite was significantly less than that of the uninfected plants. Therefore, besides resource capture by C. campestris, the reduced growth of the infected plants must also be due to the negative effects of the parasite on host photosynthesis.

Distribution and harmfulness of field dodder (Cuscuta campestris Yuncker) at sugar beet fields in Slovakia

During 2002-2004, field surveys of field dodder (Cuscuta campestris Yunck e r) in croplands were done in southwestern Slovakia. From among 150 localities surveyed, 80 were found infested by the field dodder. Within crop plants, C. campestris infested sugar beet (Beta vulgaris), alfalfa (Medicago sativa) tobacco (Nicotiana tabacum), potato (Solanum tuberosum), lentil (Lens esculenta), parsley (Pastinaca sativa) and onion (Allium cepa). Besides the crops, 18 weed species were also recorded. The species from the genus Polygonum (Polygonaceae) were the most important and acted as a significant reservoir of field dodder in cropland. C. campestris was not found in cold climatic regions with altitude higher than 240 m. The impact of field dodder infestation on sugar beet yield was studied during the year of 2004 in two localities (Salov and Zitavce) in southwestern Slovakia. The presence of field dodder markedly reduced both, quantity and quality of sugar beet yield. Weight of heavily infested beets was reduced from 21.6 to 37.4% and sugar content from 12.0 to 15.2%. Such decline of both parameters was also recorded when field dodder was removed together with leaves of sugar beet during growing season at the end of July. The aim of the infested leaves removal was to decrease mass of field dodder seeds. Although the leaf area of sugar beet regenerates, the decrease of quality and quantity was observed. The decline was the same at both localities, no matter whether the fields were irrigated (Salov) or not (Zitavce).

Molecular, functional and ultrastructural characterisation of plastids from six species of the parasitic flowering plant genus Cuscuta.

Plastids of Cuscuta reflexa Roxb., C. subinclusa D. et H., C. gronovii Willd. and C. campestris Yunck. possess thylakoids and contain both chlorophyll a and b in a ratio similar to that of stem tissue of the systematically closely related but 'normal' green Ipomoea tricolor. In contrast, plastids of C. odorata R. et P. and C. grandiflora H.B.K. do not contain any chlorophyll or possess thylakoids. Light-driven electron transport, as measured by oxygen evolution and indicated by analysis of chlorophyll fluorescence, was present in all chlorophyll-containing species. The photosystem II efficiency was low and ranged from 0.511 to 0.687. The plastid rbcL gene could not be detected in C. odorata, but was present in all other tested species. Neither rbcL transcripts nor the large subunit of ribulose-1,5-bisphosphate carboxylase-oxygenase (Rubisco) could be detected in C. odorata and C. grandiflora. Low amounts of the large subunit of Rubisco were detected immunologically in all other Cuscuta species. Apparently, the genus Cuscuta comprises species with different degrees of plastid functionality, ranging from intact chloroplasts, via plastids with impaired protein production and gene expression to plastids with reduced plastome gene content.