Buffered Listeria Enrichment Broth Research Articles

Microbiome Population Dynamics of Cold-Smoked Sockeye Salmon during Refrigerated Storage and after Culture Enrichment

Cold-smoked salmon is a ready-to-eat seafood product of high commercial importance. The processing and storage steps facilitate the introduction, growth, and persistence of foodborne pathogens and spoilage bacteria. The growth of commensal bacteria during storage and once the product is opened also influence the quality and safety of cold-smoked salmon. Here we investigated the microbial community through targeted 16S rRNA gene and shotgun metagenomic sequencing as means to better understand the interactions among bacteria in cold-smoked salmon. Cold-smoked salmon samples were tested over 30 days of aerobic storage at 4°C and cultured at each time point in a buffered Listeria enrichment broth (BLEB) commonly used to detect Listeria in foods. The microbiomes were composed of Firmicutes and Proteobacteria, namely, Carnobacterium, Brochothrix, Pseudomonas, Serratia, and Psychrobacter. Pseudomonas species were the most diverse species, with 181 taxa identified. In addition, we identified potential homologs to 10 classes of bacteriocins in microbiomes of cold-smoked salmon stored at 4°C and corresponding BLEB culture enrichments. The findings presented here contribute to our understanding of microbiome population dynamics in cold-smoked salmon, including changes in bacterial taxa during aerobic cold storage and after culture enrichment. This may facilitate improvements to pathogen detection and quality preservation of this food.

Evaluation of Methods of Enrichment and Compositing of Environmental Samples for Detection of Listeria monocytogenes

Various methods exist for the enrichment and detection of Listeria spp. and Listeria monocytogenes from environmental samples. Procedures for the compositing of environmental samples are not as well defined. In this study, different enrichment procedures involving buffered Listeria enrichment broth (BLEB), University of Vermont medium (UVM), and Fraser broth (FB) were evaluated to determine the limits of detection (LODs) for L. monocytogenes from culture and from swabs of stainless steel and to assess the efficacy of composite sampling by wet (pooling of primary enrichments) and dry (pooling of swabs) procedures. For detection of cells in pure culture, the computed values for the LOD at 95% probability (LOD95) using a single-step BLEB or two-step UVM-FB enrichment were 0.33 and 0.49 CFU/225 mL enrichment, respectively. No significant differences in detection were observed for procedures using either two-step BLEB-FB or UVM-FB enrichments for swabs of stainless steel when L. monocytogenes was inoculated at 2 to 6 log CFU; the LOD95 values were 3.82 and 3.62 log CFU per 4-in2 area, respectively. Wet compositing of L. monocytogenes from culture with and without romaine lettuce wash resident microbiota was conducted using BLEB-FB and UVM-FB enrichment methods; both allowed detection of the pathogen at ratios of 1:1, 1:2, 1:4, and 1:7 (1 positive sample to x negative samples) with no loss in sensitivity. From swabs of stainless steel, L. monocytogenes was detected similarly for both wet and dry composites of up to eight samples (1:7) with romaine lettuce wash. However, the BLEB-FB method allowed significantly faster detection (after 24 h of FB incubation) in composites of 1:4 and 1:7 samples compared with the UVM-FB method under the conditions tested. The results of this study provide data to evaluate the efficacies of the different enrichment procedures and aid in assessing the use of wet and dry compositing of environmental samples for use as part of a Listeria control plan in food production and processing facilities.

Short communication: Entrapment of Listeria cells within air pockets of ice cream mix matrix may lead to potentially heat-injured cells

In our previous study, we observed the sporadic presence of potentially heat-injured cells of Listeria innocua in ice cream mix following a selective enrichment protocol. Although injured cells have not yet been reported to cause any disease outbreaks, it is important to understand their presence in heat-treated food matrices. In this study, we propose a possible protective role of air pockets that may help explain the sporadic presence of potentially heat-injured cells following heat treatment. Challenge studies were conducted by inoculating ice cream mix samples (42% total solids, 16.3% fat, 22.2% total sugar, and 3.4% protein) with Listeria innocua (an established surrogate) at a mean spiking level of 4.0 log cfu/g. The inoculated samples were heat-treated at 69°C for 30 min and potentially heat-injured cells were detected using buffered Listeria enrichment broth, followed by plating on modified Oxford and Rapid'LMono agars. Scanning electron microscopy and atomic force microscopy were conducted on the air-dried, spiked ice cream mix samples, before and after the thermal treatment stages. Although direct plating did not reveal any intact cells in the heat-treated ice cream mix, a more sensitive enrichment protocol was able to identify cells that were potentially heat-injured. The scanning electron micrographs showed air pockets of different sizes in the ice cream mix samples. The spiked mix samples before heat treatment showed some Listeria cells unevenly distributed in the mix matrix and some entrapped within the larger air pockets. After heat treatment, scanning electron and atomic force micrographs showed cells entrapped only within the larger air pockets. The mix matrix, however, did not show any Listeria cells. Confirmation of Listeria at all stages of analysis was done using MALDI-TOF. These observations suggest that the Listeria cells could be entrapped within the larger air pockets and thus may undergo inadequate thermal effect. This could have resulted in their detection as potentially heat-injured cells, as evident under the conditions of the experiment. These results are preliminary observations and further studies are necessary to draw conclusions and understand the true implications of these findings.

Bio-Plex suspension array immuno-detection of Listeria monocytogenes from cantaloupe and packaged salad using virulence protein inducing activated charcoal enrichment media

Listeria monocytogenes, the causative agent of listeriosis in humans, is a Gram-positive bacterium that is contracted via the ingestion of contaminated foods. Two of the largest outbreaks of listeriosis occurred following consumption of tainted cantaloupe and packaged salads. Molecular methods and immuno-based techniques for detection of L. monocytogenes in these food matrices can be difficult due to the presence of assay inhibiting elements. In this study, we utilized a novel enrichment media containing activated charcoal as the key ingredient that induces hyperactive expression and secretion of L. monocytogenes virulence proteins. The Bio-Plex suspension array system, based on Luminex xMAP technology, was subsequently employed to specifically detect accumulated L. monocytogenes secreted and membrane bound proteins via paramagnetic microsphere-antibody complexes. Cantaloupe and packaged salad samples were treated with a dilution series of L. monocytogenes and incubated in activated charcoal media following a short pre-enrichment step in Buffered Listeria Enrichment Broth. Secreted L. monocytogenes lysteriolysin O was captured using magnetic microsphere-antibody conjugates and measured using the Bio-Ple×200 analyzer. As few as 100 CFU/g of L. monocytogenes was detected from both spiked cantaloupe and packaged salad samples. In addition, antibody conjugated microspheres targeting a membrane protein present on both pathogenic and nonpathogenic Listeria species was used to identify as few as 100 CFU/g of both pathogenic and nonpathogenic species in cantaloupe and packaged salad. This method presumptively identifies L. monocytogenes from cantaloupe and packaged salad in less than 24 h and non-pathogenic Listeria species within 22 h.

Rapid Detection of Listeria in Ice Cream in 13 Hours Using the Roka Listeria Detection Assay.

Background: Listeria contamination is a major concern in the ice cream industry; therefore, early and accurate detection is vital. Current detection methods require about a 24 h enrichment period for detection. Objective: Enhance the early detection of Listeria in ice cream using the highly sensitive isothermal ribosomal RNA-based Roka/Atlas Listeria Detection Assay. Methods: The R2 Medium was developed for Listeria enrichment by Molecular Epidemiology, Inc. (Seattle, WA). Comparative growth curve studies were performed on the new R2 Medium for Listeria and the currently validated media for the Roka Listeria Detection Assay. Subsequently, a method comparison between the Roka Listeria Detection Assay and the U.S. Food and Drug Administration's (FDA) Bacteriological Analytical Manual (BAM) Chapter 10 reference method on ice cream was carried out. Results: The R2 Medium supports the growth of L. monocytogenes better than Buffered Listeria Enrichment Broth, Demi-Fraser broth, and Modified University of Vermont Broth, as indicated by the faster growth rate of the organism. When used as an enrichment medium in a method comparison study of ice cream, the results showed that R2 Medium-enriched samples tested with the Roka Listeria Detection Assay gave an equivalent performance compared with the 24 h FDA-BAM reference method at 10 and 18 h post-enrichment for Listeria. Conclusions: The results from this study indicate that the new R2 Medium and the highly sensitive Roka Listeria Detection Assay allowed for the rapid detection of Listeria species in ice cream in 13 h. Highlights: The Roka Listeria Detection Assay, in conjunction with a new media formulation (R2 Medium), allowed for the early detection of Listeria in ice cream and may be applied in other food matrixes and environmental samples.

Listeria cross contamination levels in raw ice cream mix can serve as a predictor of their potential presence as heat-injured cells

Listeriosis is a life-threatening infection caused by foods contaminated with Listeria monocytogenes. Some of the major ice cream recalls in recent years reaffirm the ability of this food-borne pathogen to survive in diverse dairy processing environments and cause cross contamination. Inspection reports revealed certain lapses in implementing adequate hygienic practices for Listeria persistence in the processing environment, leading to cross contamination of ice cream. The higher levels of cross contamination of raw ice cream mix might result in random heat-injured cells when exposed to minimum heat treatment (69°C for 30 min). These heat-injured cells could later recover under abusive storage and handling conditions and pose a health risk. Evidence about the presence of injured cells in ice cream mix may thus prove useful to establish the overall Listeria risk, which was the aim of this study. Challenge studies were conducted to evaluate the dose-dependent presence of heat-injured cells of Listeria. Ice cream mix formulations of 4 different types (36, 40, 42, and 45% total solids) were inoculated at 2.0, 3.0, and 4.0 log cfu/g levels of Listeria innocua (an established surrogate). The dose levels were selected based on a likely cross contamination on the raw side from environmental Listeria, especially due to their resident nature and growth in harborage sites. The samples were exposed to minimum heat treatment (69°C for 30 min) and the survivors, including heat-injured cells, were enumerated using standard protocols. A binary logistic regression model was fitted for evaluating the severity of risk. The influence of total solids, water activity, and pH variability were also studied on Listeria survival. The enrichment protocol, using buffered Listeria enrichment broth, followed by plating on modified oxford agar and Rapid L'mono medium, revealed the random presence of heat-injured cells in buffered Listeria enrichment broth, only at the highest dose level of 4+ logs. Any potential risk from heat-injured cells was thus limited only to the highest levels of cross contamination, irrespective of the type of the mix. Significantly, none of the pasteurized ice cream mix samples supported the recovery of any heat-injured cells of Listeria during 72 h holding at 7°C, even at the highest dose level of 4+ logs, under the conditions of experimentation. The level of cross contamination (dose) emerged as a predictor of the potential presence of heat-injured cells of Listeria exposed to minimum pasteurization treatment.

Comparison of three enrichment schemes for the detection of low levels of desiccation-stressed Listeria spp. from select environmental surfaces

Three commonly used enrichment schemes were evaluated for the detection of Listeria spp. from environmental surfaces: one-step 48 h enrichment in buffered Listeria enrichment broth (BLEB); 26 h primary enrichment in University of Vermont modified (UVM) broth, followed by a transfer of 100 μl primary enrichment culture to Fraser broth (FB) for 24–48 h secondary enrichment; and 26 h primary enrichment in half-Fraser broth (HF), followed by a transfer of 100 μl primary enrichment culture to FB for 24–48 h secondary enrichment. Low levels (20–300 CFU/sample) of Listeria were artificially inoculated onto eight types of surfaces, desiccation stressed, and then collected by swab/sponge samplers for subsequent analysis. Results showed that low levels of desiccation-stressed Listeria recovered and grew rather slowly: 26 h primary enrichment in UVM and HF could not consistently yield 1 cell in 100 μl of enrichment culture, as demonstrated by enumeration of 100 μl primary enrichment culture and transfer of 100 μl enrichment culture to secondary enrichment. We further discovered that, using 20 samples per scheme and for certain Listeria strains on certain surfaces, one-step 48 h enrichment in BLEB generated significantly higher numbers of positive results than the two-step enrichment schemes when there were no competing background microflora. Higher numbers of positive results from two-step schemes were achieved by increasing the duration of primary enrichment for an additional 22 h. Therefore, to improve the detection of desiccation-stressed Listeria in the environment, we must allow sufficient time for primary enrichment and/or transfer a sufficient amount of primary enrichment culture to the secondary enrichment. The study also highlights the importance of using low levels of inoculum and physiologically injured cells for method comparison and evaluation.

Contribution of Selective Conditions to Microbial Competition in Four Listeria Selective Enrichment Formulations

Microbial competition during selective enrichment negatively affects Listeria monocytogenes populations and may hinder the subsequent detection or recovery of this organism. Competition assays among 10 selected strains of Listeria and Citrobacter braakii were performed in buffered Listeria enrichment broth, 3-(N-morpholino)propanesulfonic acid-buffered Listeria enrichment broth, University of Vermont medium-modified Listeria enrichment broth, and Fraser broth. The individual contributions of each selective agent in these media were also assessed, as well as the contribution of incubation temperature. Acriflavine hydrochloride and sodium nalidixate were ineffective at preventing the overgrowth of C. braakii ; this resulted in substantially lower populations of Listeria than when the competitor was absent. At the higher levels, both of these selective agents were detrimental to Listeria populations. The highest enrichment populations of Listeria were observed when either NaCl or LiCl was present. In the absence of selective agents, the final populations of Listeria following competitive growth with C. braakii were not substantially affected by temperature; however, in the presence of selective agents, the Listeria populations were statistically higher at the higher incubation temperature. There are a limited number of selective agents available for use in Listeria -specific enrichment media, resulting in formulations that are only somewhat selective for this species. The optimization of current formulations may help researchers to improve Listeria recovery, particularly from products with a high microbial load. The understanding of the behavior and interactions between target and nontarget microorganisms in the presence of these available selective agents is a necessary step in the optimization of Listeria selective enrichment formulations.

Enterobacteriaceae complicate the recovery of Listeria monocytogenes from food product enrichments using buffered Listeria enrichment broth

Buffered Listeria enrichment broth (BLEB) is the preferred enrichment formulation of the U.S. Food and Drug Administration (FDA) for the recovery of Listeria monocytogenes. BLEB, which relies on sodium nalidixate, cycloheximide and acriflavine-HCl for selectivity, permits the growth of all foodborne species of Listeria and several non-Listeria species including some members of the family Enterobacteriaceae. Five species of Enterobacteriaceae and four strains of non-pathogenic Listeria species were evaluated to determine which ones most suppressed to L. monocytogenes 48 hour populations in BLEB; these were subsequently used in spiked-food enrichment competition studies. L. monocytogenes recovery was complicated by the simultaneous presence of both Listeria innocua and Enterobacteriaceae competitors. The overall mean L. monocytogenes enrichment populations (n=15 per matrix) were 4.2 ± 0.6, 3.1 ± 0.4, and 2.4 ± 0.7 log CFU/mL for guacamole, asadero cheese, and refrigerated crabmeat, respectively. The overall mean L. innocua enrichment populations (n=15 per matrix) were 8.0 ± 0.7, 6.4 ± 0.7, and 6.5 ± 0.3 log CFU/mL for the same three matrices, respectively. L. monocytogenes was not recovered from any spiked-food enrichment when using either Oxford or chromogenic agars. L. innocua was recovered from all enrichments. Matrix-free competition assays using non-pathogenic Listeria species and Citrobacter braakii, simultaneously, indicate the potential for Enterobacteriaceae competitors to contribute considerably to both L. monocytogenes population suppression and to large Listeria inter-species population differentials. In some instances, Enterobacteriaceae competitors suppressed L. monocytogenes populations more than the non-pathogenic Listeria species. The ability to recover L. monocytogenes from food matrices with complex microflora, including multiple species of Listeria, is an important issue for regulatory agencies since detection without recovery is considered a false positive test result.https://doi.org/10.21423/jrs-v04n01p010 (DOI assigned 7/23/2019)

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth

The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua.

The effects of competition from non-pathogenic foodborne bacteria during the selective enrichment of Listeria monocytogenes using buffered Listeria enrichment broth

The growth of Listeria monocytogenes during the pathogen specific enrichment of food samples can be limited by the presence of additional microorganisms that are resistant to the selective conditions being applied. If growth is severely limited and minimum post-enrichment threshold levels are not met then the presence of L. monocytogenes may go undetected. Several food products were screened for non-pathogenic commensal or spoilage microorganisms that are capable of growth under the conditions commonly used by regulatory testing laboratories to select for Listeria species. The effect of these potential competitor microorganisms on the ability to detect L. monocytogenes by several common molecular screening assays was then determined. Eight species of bacteria were isolated from foods that demonstrated the ability to grow in buffered Listeria enrichment broth under selective conditions. Growth of these competitor microorganisms during the enrichment incubation resulted in a decrease ranging from 1 to 4 logs in the 48 h population of L. monocytogenes. Three strains of L. monocytogenes representing serotypes 1/2a, 1/2b, and 4b were included in this study but no one serotype appeared to be most or least sensitive to the presence of competitor microorganisms. One additional strain of L. monocytogenes was identified as displaying minimal growth during the enrichment period in the presence of the Citrobacter braakii with the final population only reaching approximately 2.6 log CFU/ml after 48 h which was a 2 log increase over the initial population. This particular strain was subsequently shown to be difficult to detect following enrichment by an automated immunofluorescence assay and an antibody-based lateral flow device assay. In some enrichments, this strain was also difficult to detect by real-time PCR.

Delivery of Selective Agents via Time-Delayed Release Tablets Improves Recovery of Listeria monocytogenes Injured by Acid and Nitrite

Listeria selective enrichment media are designed to enhance the isolation of the organism and increase the chances of detection. Drawbacks include the requirements for prolonged sample incubation (48 to 72 h) and manual addition of selective agents, which may be a source of contamination. Modified Listeria recovery broth (mLRB) is a proprietary enrichment medium formulated to facilitate the recovery of injured cells; its selective agents are incorporated into a format that allows delayed release until 6 h of incubation. We evaluated the change in cell populations over time for acid- and nitrite-injured Listeria monocytogenes in mLRB with the selective agents added manually at 0 h (mLRBS0) and 6 h (mLRBS6). Recovery of injured cells in mLRB plus time-delayed tablets (mLRBTD) was also compared with that in enrichment media recommended by the U.S. Department of Agriculture (University of Vermont broth), the U.S. Food and Drug Administration (buffered Listeria enrichment broth), and the International Organization for Standardization (demi-Fraser broth). Nitrite- or acid-injured Listeria at approximately 10 CFU/ml were inoculated into each broth medium, and Listeria populations were enumerated at various times from 12 to 48 h of incubation at 37°C. Analysis of variance revealed that acid-injured Listeria populations in mLRBS6 at 24 h were significantly higher (P < 0.05) than those in mLRBS0; however, the differences in populations on these two media were not significant for nitrite-injured cells. Cell populations of four strains of Listeria inoculated into mLRBTD were significantly higher at 24 h than when those strains were enriched in buffered Listeria enrichment broth, demi-Fraser broth, and University of Vermont broth. Comparison between artificially contaminated milk and meat samples with a four-strain cocktail of Listeria resulted in cell populations that were significantly higher (P < 0.05) at 24 h on mLRBTD for contaminated meat than on mLRB for contaminated milk. Delivery of selective agents via time-delayed release tablets into mLRB maximizes recovery of acid- and nitrite-injured Listeria and saves analyst time during food sample analysis.

InstantLabs Listeria monocytogenes food safety kit. Performance tested method 051304.

The InstantLabs Listeria monocytogenes Food Safety Kit was validated against the International Organization for Standardization (ISO) reference method 11290-1 for the detection of Listeria monocytogenes and other Listeria species. The matrixes (stainless steel, sealed concrete, ice cream, whole milk, cheddar cheese, raw shrimp, hot dogs, deli turkey, and lettuce) were inoculated with approximately 1 CFU/test portion of L. monocytogenes to generate fractional positives (5-15) in 20 inoculated samples. Enrichments were also fractionally inoculated with L. grayii for side-by-side testing of the Listeria Species Food Safety Kit. Stainless steel and sealed concrete samples were validated using 4 x 4" and 1 x 1 " test areas, respectively, and enriched in Buffered Listeria Enrichment Broth (BLEB) at 35 +/- 1degreesC for 22-28 h. All food samples were tested at 25 g and enriched in BLEB at 35 +/- 1 degreesC for 24-28 h. All samples were confirmed using the ISO reference method, regardless of initial screen result. The InstantLabs test method performed as well as or better than the reference method for the detection of L. monocytogenes on stainless steel and sealed concrete and in ice cream, whole milk, cheddar cheese, raw shrimp, hot dogs, deli turkey, and lettuce. Inclusivity and exclusivity testing revealed no false negatives and no false positives among the 50 L. monocytogenes serovars and 30 non-L. monocytogenes species examined. The method was shown to be robust when the enrichment times, volumes for DNA extraction, and heat block times were varied.

InstantLabs Listeria species food safety kit. Performance tested methods 041304.

The InstantLabs Listeria Species Food SafetyKitwas validated against the International Organization for Standardization (ISO) reference method 11290-1 for the detection of Listeria monocytogenes and other Listeria species. The matrixes (stainless steel, sealed concrete, cheddar cheese, raw shrimp, and hot dogs) were inoculated with approximately 1 CFU/test portion of various Listeria species to generate fractional positives (5-15) in 20 inoculated samples. Enrichments were also fractionally inoculated with L. monocytogenes for side-by-side testing of the InstantLabs Listeria monocytogenes Food Safety Kit. Stainless steel and sealed concrete samples were validated using 4 x 4" and 1 x 1" test areas, respectively, and enriched in Buffered Listeria Enrichment Broth (BLEB) at 35 +/- 1 degrees C for 22-28 h. All food samples were tested at 25 g or 25 mL and enriched in BLEB at 35 +/- 1 degrees C for 24-28 h. All samples were confirmed using the ISO reference method, regardless of initial screen result. The InstantLabs test method performed as well as or better than the reference method for the detection of Listeria species on stainless steel, sealed concrete, cheddar cheese, raw shrimp, and hot dogs. Inclusivity and exclusivity testing revealed no false negatives and no false positives among the 80 Listeria species and 30 non-Listeria species examined. The method was shown to be robust when variations were introduced to the enrichment time, the volume for DNA extraction, and the heat block time (data not shown).

Postenrichment Population Differentials Using Buffered Listeria Enrichment Broth: Implications of the Presence of Listeria innocua on Listeria monocytogenes in Food Test Samples

The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U. S. Food and Drug Administration's enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 μL and 50 μL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Prevalence and Risk Factors forListeria monocytogenesin Broiler Flocks in Shiraz, Southern Iran

Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.

Development and Evaluation of a Real-Time Polymerase Chain Reaction Assay Targetingiapfor the Detection ofListeria monocytogenesin Select Food Matrices

Listeria monocytogenes is an intracellular foodborne pathogen that has been associated with severe human illnesses. Various rapid detection methods have been developed for the specific detection of this pathogen. In the present study, a real-time quantitative polymerase chain reaction (PCR) assay targeting iap, a gene encoding extracellular protein p60, was developed for L. monocytogenes. The PCR efficiency is above 85% and the limit of detection (LOD) is 30 copies of genome per reaction for all strains tested. The assay exhibited 100% inclusivity and exclusivity rates. The detection of L. monocytogenes in five food matrices, whole milk, soft cheese, turkey deli meat, smoked salmon, and alfalfa sprouts, was evaluated with and without enrichment. Without enrichment, the LOD for all food matrices were 4×10(3) CFU/mL food enrichment mix for whole milk and 4×10(4) CFU/mL for all other foods. With 24 h incubation in Buffered Listeria Enrichment Broth, the LOD was 3 CFU/25 g food for whole milk, turkey deli meat, and smoked salmon and 9 CFU/25 g food for soft cheese and alfalfa sprouts. With 48 h incubation, the LOD was 3 CFU/25 g food for all matrices. This quantitative PCR appears to be a promising alternative for rapid detection of L. monocytogenes in select foods.

Differential expression of InlB and ActA in Listeria monocytogenes in selective and nonselective enrichment broths

To investigate the effect of selective and nonselective media on the expression of ActA and InlB proteins in Listeria monocytogenes. Polyclonal antibodies to InlB and ActA were used in western blotting to determine the effect of selective (BLEB, UVM, and FB) or nonselective (BHI and LB) enrichment broths or hotdog exudates. Of the 13 L. monocytogenes serotypes tested, 11 and 12 serotypes showed a strong InlB expression in brain heart infusion (BHI) and Luria-Bertani (LB), respectively, while only seven and one serotypes showed a strong ActA expression in these two respective broths, and others showed a weaker or no expression. On the contrary, in selective broths, expression of InlB was either very weak or undetectable. However, ActA expression was stronger in 12 serotypes when grown in buffered Listeria enrichment broth (BLEB), 11 in University of Vermont medium (UVM), and 10 in Fraser broth (FB). When tested in hotdog exudates, InlB and ActA were detected in serotypes grown at 37 degrees C but not at 4 degrees C. Transmission electron microscopy, enzyme-linked immunosorbent assay, and mRNA analysis further supported these observations. Overall, selective enrichment broths promote ActA while nonselective broths promote InlB expression. As commonly recommended enrichment broths show differential InlB and ActA expression, proper media must be selected to avoid false results during antibody-based detection of L. monocytogenes.