Brown Roots Research Articles

Pseudomonas ZY-1 and Bacillus FY-1 protecting the rice seedlings from the harm of Pseudomonas aeruginosa via indirect seawead lysis

The local ecosystems, fishery and human health are all threatened by water blooms, so effectively controlling water blooms has become an urgent and challenging issue. Biological control of water blooms is given priority due to its low cost, high efficiency and environmental friendliness. In this study, Pseudomonas ZY-1 and Bacillus FY-1, two highly-effective algicidal bacteria strains which are able to indirectly lyse algae by separating and screening from the vigorous water body in the paddy alga of Northeast China were obtained. The two bacterial strains have stronger ability to lyse alga in the bacterial liquid concentration of 106 CFU/ml, and the alga-lysing rate on 7 d reached 84.03% and 83.11% respectively. The active substance secreted by ZY-1 is not sensitive to the changes of temperature and pH value, while as FY-1 cell-free filtrate is not stable in high temperature above 50 ℃ and pH of 5, it requires the sun light to have the algaecidal effect. The cell-free filtrates of strains ZY-1 and FY-1 had the best lysis effect on Microcystis aeruginosa cells, and the chlorophyll a content of algae decreased to 0.13 ± 0.02 mg/L and 0.14 ± 0.03 mg/L respectively and the Fv/Fm of Microcystis aeruginosa decreased by 97.22% after 7 days. The algaecidal process of ZY-1 and FY-1 may be that the cell-free filtrate inhibits the photosynthesis of Microcystis aeruginosa, and meanwhile it avoids the regeneration and repair of photosynthesis of algal cells by affecting the gene expression and damaging the repair system of algal cells, so the membrane lipid peroxidation is exacerbated and then the membrane of algal cells is broken, the algal cells can’t do normal life activities, and finally the algal cell would be killed. The rice seedlings in the algal liquid treatment group are short and show root dysplasia, few roots and brown roots. After treated with cell-free filtrate of ZY-1 and FY-1, the oxidative damage of the rice is obviously reduced, and the harm from Microcystis aeruginosa is reduced, which has the repair effect to the roots of rice seedlings and its aboveground growth. The cell-free filtrate of FY-1 works better than ZY-1. The bacteria strains of ZY-1 and FY-1 have the indirect algaecide trait, which makes them the potential environmentally-friendly algaecidal bacteria and they show broad application in the agricultural production and the control of water blooms.

Nanoparticles and root traits: mineral nutrition, stress tolerance and interaction with rhizosphere microbiota.

This review article highlights a broader perspective of NPs and plant-root interaction by focusing on their beneficial anddeleterious impacts on root system architecture (RSA). The root performs a vital function by securing itself in the soil, absorbing and transporting water and nutrients to facilitate plant growth and productivity. In dicots, the architecture of the root system (RSA) is markedly shaped by the development of the primary root and its branches, showcasing considerable adaptability in response to changes in the environment. For promoting agriculture and combating global food hunger, the use of nanoparticles (NPs) may be an exciting option, for which it is essential to understand the behaviour of plants under NPs exposure. The nature of NPs and their physicochemical characteristics play a significant role in the positive/negative response of roots and shoots. Root morphological features, such as root length, root mass and root development features, may regulated positively/negatively by different types of NPs. In addition, application of NPs may also enhance nutrient transport and soil fertility by the promotion of soil microorganisms including plant growth-promoting rhizobacteria (PGPRs) and also soil enzymes. Interestingly the interaction of nanomaterials (NMs) with rhizospheric bacteria can enhance plant development and soil health. However, some studies also suggested that the increased use of several types of engineered nanoparticles (ENPs) may disrupt the equilibrium of the soil-root interface and unsafe morphogenesis by causing the browning of roots and suppressing the growth of root and soil microbes. Thus, this review article has sought to compile a broader perspective of NPs and plant-root interaction by focusing on their beneficial or deleterious impacts on RSA.

Fast, Easy, and Comprehensive Techniques for Microscopic Observations of Fungal and Oomycete Organisms Inside the Roots of Herbaceous and Woody Plants.

The roots of herbaceous and woody plants growing in soil are complex structures that are affected by both natural and artificial fungal colonization to various extents. To obtain comprehensive information about the overall distribution of fungi or oomycetes inside a plant root system, rapid, effective, and reliable screening methods are required. To observe both fine roots, i.e., a common site for penetration of fungi and oomycetes, and mature roots, different techniques are required to overcome visual barriers, such as root browning or tissue thickening. In our protocol, we propose using fast, cost-effective, and non-harmful methods to localize fungal or oomycete structures inside plant roots. Root staining with a fluorescent dye provides a quick initial indication of the presence of fungal structures on the root surfaces. The protocol is followed by clearing and staining steps, resulting in a deeper insight into the root tissue positioning, abundance, and characteristic morphological/reproductive features of fungal or oomycete organisms. If required, the stained samples can be prepared by using freeze-drying for further observations, including advanced microscopic techniques. Key features • The protocol enhances tissue-clearing techniques employing KOH or NaOH and is applicable to a broad range of roots from different plant species. • Hydroxides are mixed with hydrogen peroxide to obtain an efficient bleaching solution, which effectively clears roots without causing significant tissue damage. • The protocol could also be used for staining of fungi or oomycetes localized both on the root surface or inside the root tissues. • Simple combination of non-fluorescent methyl blue and fluorescent solophenyl flavine dyes allows the observation of fungal organisms in both brightfield and fluorescence microscopy.

First Report of Globisporangium ultimum Causing Pythium Damping-off and Root Rot on Pepper in Guizhou, China.

Pepper (Capsicum annuum L.) is a popular vegetable and condiment consumed around the world. In the Guizhou Province of China, peppers are the most commonly grown crop on 300,000 planted hectares. A variety of diseases routinely occur on peppers in this province, resulting in yield losses (Liu et al., 2022). Root rot is one of the most common symptoms and produces poor root growth and wilting of pepper. In April 2023, symptomatic pepper plants displaying stunting, dwarfism, wilting, and root browning were collected from five fields in Guizhou, with disease incidence ranging from 10% to 20%. The collected rotten roots were cleaned with sterilize distilled water and placed in selective V8 juice agar (V8A) medium (15% clarified V8 juice with 2.5 g/L CaCO3 and 2% agar) containing nystatin, ampicillin, rifampicin, and miconazole, and incubated at 25℃ for 1 to 2 days (Morita and Tojo, 2007). Eight isolates with similar colony morphology were transferred to V8A medium via hyphal tipping, and incubated at 25℃ in the dark. Colony and sexual structures were observed using a microscope. Mycelium was aseptate and formed white cottony colonies. Globose, intercalary, or terminal hyphal swellings were observed with a diameter of 20.5 to 25 µm (average: 22 µm), and aplerotic oospores had a diameter of 15 to 20 µm (average: 17.5 µm) with a wall thickness of approximately 2 µm. Three representative isolates HSLJ-3, LJG-1, and LJY-2 were chosen for further molecular identification. Sequences of the internal transcribed spacer (ITS) and mitochondrial cytochrome c oxidase subunit 1 (cox1) genes were identified using primer sets ITS4/ITS5 (White et al., 1990) and OomCoxI-Levup/OomCoxI-Levlo (Robideau et al., 2011), respectively. All sequences were deposited in GenBank (accession nos. OR554005, PP083310, and PP083420 for ITS, and OR529247, PP093821 and PP093822 for cox1). BLAST analysis revealed all ITS and cox1 sequences exhibited 100% identity with Globisporangium ultimum (Pythium ultimum) isolate BR850 (GenBank accession nos. HQ643892.1 and HQ708933.1 for ITS and cox1, respectively). Phylogenetic analysis was performed by the maximum-likelihood method on the CIPRES web portal (https://www.phylo.org/portal2/login!input.action, accessed on 9 January 2024). For pathogenicity tests, each isolate was cultured in V8A medium containing 50 autoclaved wheat seeds at 25℃ for 7 days. Budding pepper seedling (cv. Huaxi) was transplanted into a 0.4 L pot containing sterilized commercial potting mix (Seedling Cultivation Substrate, Hunan Xianghui Agricultural E-commerce Co., Ltd.) which was saturated with deionized water. Eight infected and non-infected wheat seeds were placed near the roots of five pepper seedlings, respectively. Plants were placed in an artificial climate chamber, with a 14 h photoperiod and approximately 75% relative humidity at 25℃. After 14 days, inoculated seedlings showed symptoms of stunting, wilting, and rotting roots similar to those observed in the field. No disease was observed on the non-inoculated control plants. The pathogen was isolated from infected pepper roots and confirmed as G. ultimum by morphological and molecular analyses as previously described. This is the first report of G. ultimum causing root rot on pepper in Guizhou, China. This finding is critical to the discover of treatment options for this pathogen, thereby improving management practices to reduce yield losses in pepper.

Multicontamination Toxicity Evaluation in the Model Plant Lactuca sativa L.

Many contaminated soils contain several toxic elements (TEs) in elevated contents, and plant-TE interactions can differ from single TE contamination. Therefore, this study investigated the impact of combined contamination (As, Cd, Pb, Zn) on the physiological and metabolic processes of lettuce. After 45 days of exposure, TE excess in soil resulted in the inhibition of root and leaf biomass by 40 and 48%, respectively. Oxidative stress by TE accumulation was indicated by markers-malondialdehyde and 5-methylcytosine-and visible symptoms of toxicity (leaf chlorosis, root browning) and morpho-anatomical changes, which were related to the change in water regime (water potential decrease). An analysis of free amino acids (AAs) indicated that TEs disturbed N and C metabolism, especially in leaves, increasing the total content of free AAs and their families. Stress-induced senescence by TEs suggested changes in gas exchange parameters (increase in transpiration rate, stomatal conductance, and intercellular CO2 concentration), photosynthetic pigments (decrease in chlorophylls and carotenoids), a decrease in water use efficiency, and the maximum quantum yield of photosystem II. These results confirmed that the toxicity of combined contamination significantly affected the processes of lettuce by damaging the antioxidant system and expressing higher leaf sensitivity to TE multicontamination.

Tissue and cellular localization of condensed tannins in poplar roots and potential association with nitrogen uptake.

Condensed tannins are common in vegetative tissues of woody plants, including in roots. In hybrid poplar (Populus tremula x alba; also known as P. x canescens) CT assays indicated they were most concentrated in younger white roots and at the root tip. Furthermore, CT-specific staining of embedded tissue sections demonstrated accumulation in root cap cells and adjacent epidermal cells, as well as a more sporadic presence in cortex cells. In older, brown roots as well as roots with secondary growth (cork zone), CT concentration was significantly lower. The insoluble fraction of CTs was greatest in the cork zone. To determine if CT accumulation correlates with nutrient uptake in poplar roots, a microelectrode ion flux measurement (MIFE™) system was used to measure flux along the root axis. Greatest NH4 + uptake was measured near the root tip, but NO3- and Ca2+ did not vary along the root length. In agreement with earlier work, providing poplars with ample nitrogen led to higher accumulation of CTs across root zones. To test the functional importance of CTs in roots directly, CT-modified transgenic plants could be important tools.

Substrate specificity of polyphenol oxidase and its selectivity towards polyphenols: Unlocking the browning mechanism of fresh lotus root (Nelumbo nucifera Gaertn.).

Polyphenol oxidase (PPO) causes the browning of lotus roots (LR), negatively affecting their nutrition and shelf-life. This study aimed to explore the specific selectivity of PPO toward polyphenol substrates, thus unlocking the browning mechanism of fresh LR. Results showed that two highly homologous PPOs were identified in LR and exhibited the highest catalytic activity at 35 ℃ and pH 6.5. Furthermore, the substrate specificity study revealed (-)-epigallocatechin had the lowest Km among the polyphenols identified in LR, while (+)-catechin showed the highest Vmax. The molecular docking further clarified that (-)-epigallocatechin exhibited lower docking energy and formed more hydrogen bonds and Pi-Alkyl interactions with LR PPO than (+)-catechin, while (+)-catechin entered the active cavity of PPO more quickly due to its smaller structure, both of which enhance their affinity to PPO. Thus, (+)-catechin and (-)-epigallocatechin are the most specific substrates responsible for the browning mechanism of fresh LR.

First Report of Root Rot Caused by Ilyonectria robusta in the Medicinal Herb Aconitum carmichaelii in China.

Aconitum carmichaelii Debeaux is used as a traditional Chinese medicine with antiarrhythmic, antiinflammatory and other pharmacological functions. It is widely cultivated in China. According to our survey, about 60% of A. carmichaelii in Qingchuan, Sichuan, suffered from root rot, reducing yields by 30% in the past five years. Symptomatic plants exhibited stunted growth, dark brown roots, reduced root biomass, and fewer root hairs. The disease caused root rot and plant death in 50% of the infected plants. In October 2019, ten symptomatic 6-month-old plants were collected from fields in Qingchuan. Diseased pieces of the roots were surface sterilized with sodium hypochlorite solution (2%), rinsed three times in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in the dark. Six single-spore isolates of a Cylindrocarpon-like anamorp were obtained. The colonies on PDA were 35 to 37 mm diam after seven days with regular margins. The plates were covered with felty aerial mycelium, white to buff, and the reverse side chestnut near center with a ochre to yellowish leading edge. On spezieller nährstoffarmer agar (SNA), macroconidia were 1 to 3 septate, straight or slightly curved, cylindrical, with rounded ends, and varied in size: 1-septate 15.1 to 33.5 × 3.7 to 7.3 μm (n=250), 2-septate 16.5 to 48.5 × 3.7 to 7.6 μm (n=85), and 3-septate 22.0 to 50.6 × 4.9 to 7.4 μm (n=115). Microconidia were ellipsoid to ovoid, and 0 to 1 septate; aseptate spores were 4.5 to 16.8 × 1.6 to 4.9 μm (n=200), and 1-septate spores were 7.4 to 20.0 × 2.4 to 5.1 μm (n=200). The chlamydospores were brown, thick-walled, globose to subglobose, 7.9 to 15.9 μm (n=50). The morphology of these isolates was consistent with the previous description of Ilyonectria robusta (Cabral et al. 2012). Isolate QW1901 was characterized by sequencing the ITS, TUB, H3, and tef1α loci using previously reported primer pairs: ITS1/ITS4 (White et al. 1990), T1/Bt-2b (O'Donnell and Cigelnik 1997), CYLH3F/CYLH3R (Crous et al. 2004), and EF1/EF2 (O'Donnell et al. 1998). A Blastn search of the sequences of ITS, TUB, H3, and tef1α showed that QW1901 shared 99.26, 97.89, 97.79, and 99.17 % identities, respectively, with the ex-type strain of I. robusta (CBS308.35). The ITS, TUB, H3, and tef1α sequences were deposited in GenBank under accession nos. MW534715, and MW880180 to MW880182, respectively. A phylogenetic tree was constructed from a neighbor-joining analysis on the alignment of the combined ITS, TUB, H3, and tef1α sequence. QW1901 was clustered with the ex-type strain of I. robusta. To confirm the pathogenicity of I. robusta, bare roots of healthy 6-month-old A. carmichaelii were inoculated with mycelial plugs of 7-day-old QW1901 colonies selected randomly (Lu et al. 2015). Five needle-wound lateral roots and five intact roots were inoculated as replicates with pathogen-free agar plugs as a control. Then, all plants were grown in sterile soil in a growth chamber at 20±1°C and watered regularly. Pathogenicity assays were repeated twice. After 20 days of cultivation, infected plants exhibited symptoms similar to those observed in the field. All control plants remained asymptomatic. Sequencing confirmed the re-isolation of I. robusta from the inoculated plants, satisfying Koch's hypothesis. Ilyonectria robusta has been reported to cause root rot of plants such as Codonopsis tangshen and Panax ginseng ( Lu et al. 2015; Zheng et al. 2021), and has also been reported to be isolated from Aconitum kongboense in China (Wang et al. 2015). However, this is the first report of the pathogen causing root rot of A. carmichaelii. Management measures, such as growing disease-free seedlings in sterile soil, should be used to minimize the risk of this pathogen.

First report of Fusarium falciforme causing root rot of pomegranate (Punica granatum L.) in China.

Pomegranate (Punica granatum L.) is a deciduous shrub or small tree that is native to Iran and Afghanistan. It is also a commercially important fruit tree in China and worldwide. In the summer of 2022, a serious root rot disease occurred in some pomegranate orchards in Xichuan County(32º42´ N, 111º48´ E), Henan Province, China, with an incidence of ~30%. Symptoms included leaf yellowing and wilting, root browning and rotting, and stem-base cracking, eventually leading to defoliation and death. To isolate the causal agent, small pieces (5×5 mm) of diseased root from six trees were surface-sterilized by dipping in 2% NaClO for 8 min followed by 70% ethanol for 15 s, rinsed five times with sterile water, and plated on potato dextrose agar (PDA), then incubated at 28°C in the dark for 5 days. Fifteen pure fungal isolates with the same morphological characteristics were obtained from 24 pieces of roots. All isolates produced white fluffy mycelia. Microconidia were hyaline, oval or reniform, with zero to one septa and dimensions of 7.1 to 19.9 (average 14.5 )× 3.8 to 8.0 (average 5.6) μm (n = 100). Macroconidia were sickle-shaped, one to four septate, and 20.1 to 40.8 (average 26.5) × 4.8 to 8.6 (average 6.5) μm (n = 100). Chlamydospores were spherical, single, in pairs or chains, and 5.6 to 9.8 (average 6.8) µm in diameter (n = 100). Based on the above characteristics, the pathogens were identified as Fusarium sp. (Leslie and Summerell 2006). Genomic DNA was extracted from mycelia of two representative isolates Fs1 and Fs3. The internal transcribed spacer (ITS), translation elongation factor 1-alpha (TEF-1α) and RNA polymerase II second largest subunit (RPB2) sequences were PCR amplified using primer pairs of ITS1/ITS4, EF1/EF2, and RPB2-5f2/RPB2-7cr, RPB2-7cf/RPB2-11ar (O'Donnell et al., 2022), respectively. BLAST analysis showed that the ITS, TEF-1α and RPB2 sequences of isolates Fs1(GenBank accession nos. OK001765, OQ921726 and OQ928396) and Fs3 (GenBank accession nos. OK001771, OQ921727 and OQ928397) showed 99%-100% identity with multiple GenBank sequences of Fusarium falciforme (KY617066, MN064683, KF255514, OQ933361, KY556711 and ON331935). A phylogenetic tree based on concatenated sequences of ITS, TEF-1α and RPB2 using maximum-likelihood analysis revealed that both isolates Fs1 and Fs3 were in the same clade with F. falciforme strains. Based on the morphological and molecular characteristics, the isolates were identified as members of F. falciforme. For pathogenicity testing, conidial suspensions (1×108 spores /mL) of isolates Fs1 and Fs3 were poured onto the roots of healthy pomegranate that had been planted in pots two months previously. Ten plants were inoculated for each isolate. Control plants were drenched with sterile water. After 3 months, inoculated plants developed leaf yellowing and wilting accompanied by root browning and rotting, much like symptoms observed in field plants. The same fungi re-isolated from the experimental plants were confirmed to be F. falciforme by morphology and sequence analysis. This is the first report of F. falciforme causing root rot on pomegranate. F. falciforme is a ubiquitous soil-borne pathogen that causes root rot on multiple plants around the world (Xu F., et al. 2022; Qiu R., et al. 2023). The results of pathogen identification are essential precursors to development of effective control of the disease.

A review on common root rot of wheat and barley in Australia

AbstractCommon root rot (CRR) caused by the soilborne pathogen Bipolaris sorokiniana (teleomorph Cochliobolus sativus) is becoming increasingly prevalent worldwide. Identification of CRR is difficult and time‐consuming for human assessors due to the non‐distinctive above‐ground symptoms, with browning of subcrown internodes and roots the most distinguishing symptom of infection. CRR disease has been recognized as a significant disease for cereal crops in many countries. In 2009, CRR in Australia was estimated to cause $30 million average annual yield loss for wheat and $13 million for barley. Recent evidence indicates CRR may be more prevalent than expected in Australian wheat cropping areas due to lack of research on this disease. Low levels of B. sorokiniana survive in the soil for up to 10 years and attack plants at early stages of growth. Therefore, mitigating CRR in wheat and barley may not be practical at the late stages of infection due to lack of effective methods; however, early detection might be viable to alleviate the impact of this disease. A comprehensive overview of CRR caused by B. sorokiniana, including disease background, worldwide economic losses, management methods, potential CRR detection using multispectral and hyperspectral sensors and the research focus over the past 50 years is provided in this article. This review paper is expected to provide thorough supplemental information for current studies about CRR and proposes recommendations for whole‐of‐field disease scouting methods to farmers, enabling reduced time and cost for CRR management and increasing wheat and barley production worldwide.

First Report of Penicillium subrubescens Causing Root Rot of Knoxia roxburghii in China.

Knoxia roxburghii (syn. Knoxia valerianoides), locally known as 'Zi Daji', is a perennial herb that belongs to the Rubiaceae family, cultivated in different areas of China and recognized for its medicinal properties in traditional Chinese medicine (Chen et al. 2022). In 2021, root rot was observed during summer on K. roxburghii in Xiangyun and Dali, Yunnan Province (25°25'N, 100°40'E), China. Root rots were characterized by dark brown tissue from stem base to root, loss of vitality in tender leaves and wither. Three symptomatic root samples of K. roxburghii collected from different fields were rinsed with running water, and 0.5-1 cm2 fragments of diseased tissues were cut and surface-disinfested with 75% ethanol for 30 s, and 1% NaClO for 180 s. The fragments were then washed with sterile water, transferred to potato dextrose agar (PDA, 4.6%) and incubated at 28℃ in the dark for 3 days. A total of 13 isolates with consistent appearances were obtained by single spore isolation. These colonies on PDA showed gray and light brown obverse, and light green reverse after 10 days. The average growth rate was 3 mm per day. Conidia were nearly spherical or broadly elliptic, greyish-green, and 1.4-2.4×1.3-2.2 μm in size (n=50). The conidiophore has symmetrical or asymmetrical broom branches from the tip, with 2-4 small stems. The conidiophore branching patterns were predominantly biverticillate; stipes coarsely roughened, 80-210×2.6-3.0 μm; metulae were usually appressed verticils of 3-6, 6.4-12.5×1.6-3.0 μm; phialides were short and wide neck, 3.8-4.8×1.1-1.8 μm (n=30). The morphological characteristics of the fungus were identical to Penicillium (Mansouri et al. 2013). To further identify the isolate, one isolate (ByF10) was randomly selected for identification. DNA was extracted from mycelia using a simplified CTAB method. Primer pairs, ITS1/ITS4 and Bt2a/Bt2b were used to amplify the partial regions of rDNA internal transcribed spacer (ITS) and β-tubulin (TUB), respectively (White et al. 1990; Glass and Donaldson 1999). Blast searches showed that the sequences of ITS (OQ954757) and TUB (OQ970059) of isolate ByF10 were 99% (MH865456) and 100% (KC797611) identical with P. subrubescens CBS 130205 and CBS 129617, respectively. A concatenated phylogenetic tree (ITS+TUB) constructed using the maximum likelihood method showed that ByF10 was closely grouped next to isolates of P. subrubescens. Pathogenicity test was carried out using 1-year-old healthy seedlings of K. roxburghii cv. Yunji-1 growing on autoclaved soil (n=10). Ten plants were inoculated with mycelial blocks (5 mm2), which were taken from the colony margins of a 10-day-old culture (PDA) colony, and placed on the roots near the soil. Five control plants were inoculated with non-colonized PDA plugs. The pathogenicity test was repeated three times. All plants were kept at 25℃, 70% relative air humidity, and 12 h light/12 h regime dark for 35 days. After that period 95% of inoculated plants showed typical symptoms of root browning. P. subrubescens was only re-isolated from the inoculated plants, and identified based on morphological and molecular characteristics. No symptoms were observed in the controls. To the best of our knowledge, this is the first report of P. subrubescens causing root rot on K. roxburghii in China and the world.

Pharmacological and Pharmacognostical Studies of Cassia fistula Linn

This study aims to present an extensive and up-to-date review of pharmacological activities, Pharmacognostical studies and traditional medicinal uses of Cassia fistula. The golden shower tree Cassia fistula (Amaltas), which is 8–15 meters tall, is a member of the Leguminosae family. Reddish brown roots, compound leaves with three to eight leaflets each, cylindrical pods, and ovoid seeds are all characteristics of the Cassia fistula stem. Alkaloids, flavonoids, proteins, lipids, and carbohydrates are among the ingredients of Cassia fistulas bioactive. It has a greater impact on treating various illnesses and has antifungal, antibacterial, analgesic, hepatoprotective, and anti-inflammatory properties, among others. A variety of activities have been reported to be present in it, including anthelmintic, antibacterial and wound healing activities. Therefore, the purpose of this article is to present a thorough analysis of the phytochemical constituents, pharmacological characteristics, and pharmacognostic qualities of Cassia fistula.

Analisis Morfologi Tanaman Pisang Kepok (Musa paradisiaca Var. Balbisiana colla) di Desa Tanjung Selamat Kabupaten Labuhanbatu Selatan

Tanjung Selamat Village is one of the villages in South Labuhanbatu Regency, North Sumatra Province. Tanjung Selamat Village has several types of bananas, one of which is the Kepok Banana. This study aims to determine and analyze the morphology of the Kepok Banana plant (Musa Paradisiaca Var. Balbisiana colla) in Tanjung Selamat Village, South Labuhanbatu Regency, North Sumatra Province. This type of research is descriptive qualitative by making observations with survey techniques observing the morphology of Kepok Banana plants. The technique used in collecting data by way of observation or observations and interviews. The Kepok Banana plant (Musa Paradisiaca Var. Balbisiana colla) found in the village has several characteristics and characters in the morphology of the Kepok Banana plant, starting from the stem, size, color, and roots, leaves, flowers, stems, fruit, and others. In this case the Kepok Banana plant (Musa Paradisiaca Var. Balbisiana colla) in Tanjung Selamat Village from the results of the study showed that the morphology of the Kepok Banana plant had a green color, stem diameter 24 cm wide, 227 cm high, brown roots there are white fibrous roots, leaves are dark and light green, and the edges of the leaves are flat, the tips of the leaves are rounded. The flower stalk is 7-8 cm, the color is yellowish red the flowers are white inside, the length of the fruit is 13 cm and the diameter is 3 cm.

Evaluation of Trichoderma harzianum, Bacillus subtilis and Aspergillus species efficacy in controlling Pythium ultimum associated with apple seedlings decline in nurseries and their growth promotion effect

BackgroundApple decline diseases, responsible for seedlings root and collar rot in nurseries, are an important disease. Different fungal and bacterial antagonists were evaluated to control Pythium ultimum associated with this serious disease using in vitro and in vivo greenhouse assays.ResultsThe in vitro test of ten Aspergillus spp. and ten Trichoderma harzianum isolates showed their efficacy to reduce the radial growth of P. ultimum. The isolates, A. niger A10, A. candidus A5, T. harzianum Tr9 and Tr10, were the most effective with a high inhibition percent that exceeded 50%. The in vivo test of the four most effective antagonists and a strain of Bacillus subtilis (B) showed that the combination of the two Aspergillus isolates (A5 and A10) gave the best result with a decrease in root browning index by 55.55%. Results showed also the efficacy of all tested antagonists and their combinations on the sanitary state index of the inoculated plants except the combination between T. harzianum (Tr10) and B. subtilis (B). The two treatments, T. harzianum (Tr10) and B. subtilis (B), significantly improved the height of inoculated plants by 173.19 and 191.3%, respectively. Regarding the efficacy of antagonists on apple seedlings root weight, A. niger (A10) was the only treatment that significantly increased this parameter by 363.17%.ConclusionsA. niger A10, A. candidus A5, T. harzianum Tr9 and Tr10 exhibited the highest value of in vitro inhibition to growth of P. ultimum. The combination of A. niger A10 and A. candidus A5 was the most effective in vivo treatment in reducing the disease severity index. However, T. harzianum (Tr10), B. subtilis (B) and A. niger (A10) revealed to be able to stimulate the apple seedlings growth.

Melatonin-induced myeloblastosis viral oncogene homologs alleviate fresh-cut lotus root browning during storage by attenuating flavonoid biosynthesis and reactive oxygen species.

Lotus roots (Nelumbo nucifera Gaertn.) are rich in nutrients and have ornamental and food value. However, browning has caused huge economic losses and security risks during the storage and harvesting of fresh-cut lotus. This study investigated the role of melatonin in inhibiting lotus browning, and illustrates its molecular mechanism. The application of melatonin effectively retarded the process of lotus browning, enhanced reactive oxygen species (ROS) scavenging enzyme activity, and inhibited the activity of polyphenol oxidase (PPO), and peroxidase (POD). Melatonin reduced flavonoid content, and decreased enzymatic activity in flavonoid biosynthesis. Transcriptome Sequencing (RNA-seq) was used to screen the genes regulated by exogenous melatonin when defending against fresh-cut lotus browning. Gene co-expression analysis (GCN) indicated that the transcription factors MYB5, MYB6, and MYB308, activated by melatonin, were negatively related to the expression of PPO and the genes related to flavonoid and phenylpropanoid biosynthesis. These myeloblastosis viral oncogene homologs (MYBs) were positively related to the expression of genes encoding the enzymes in glutathione metabolism. Melatonin retarded lotus browning by transcriptional suppression of key genes associated with flavonoid and phenylpropanoid biosynthesis through the stimulation of MYB5, MYB6, and MYB308. © 2023 Society of Chemical Industry.

Potential Use of Two Forest Species (Salix alba and Casuarina glauca) in the Rhizofiltration of Heavy-Metal-Contaminated Industrial Wastewater

The discharge of raw industrial wastewater (IWW) into ecosystems is a major environmental problem that adversely affects water quality, soil physicochemical properties, the food chain and, therefore, human health. Injection of treated IWW into irrigation and “fertigation” systems is an ecological, sustainable and economical approach for its appropriate disposal. Seedlings of two forest species (Salix alba, Casuarina glauca) were grown hydroponically and subjected to 25% diluted IWW and control (tap water) treatments for 35 days. Morphological and physiological traits were evaluated, including leaf symptoms, stem and root dry masses, leaf water potential, relative water content, chlorophyll content, photosystem II efficiency, hydrogen peroxide, thiobarbituric acid reactive substances, bioaccumulation and translocation factor estimates and removal efficiency for various heavy metals. Application of 25% IWW stress affected many aspects of plant morphology: chlorosis and necrosis in leaves, epinasty, leaf curling, early leaf senescence and root browning. In both species, the 25% IWW treatment reduced leaf, stem and root dry masses relative to controls. S. alba exhibited greater removal capacity for heavy metal ions and could be effective as a remediator of toxic-metal-polluted industrial effluent water.

Changes in concentrations and transcripts of plant hormones in wheat seedling roots in response to Fusarium crown rot

Fusarium crown rot (FCR) is a soilborne disease causing severe yield losses in many wheat-growing areas of the world. Diseased plants show browning and necrosis of roots and stems causing white heads at maturity. Little is known about the molecular processes employed by wheat roots to respond to the disease. We characterized morphological, transcriptional and hormonal changes in wheat seedling roots following challenge with Fusarium pseudograminearum (Fp), the main pathogen of FCR. The pathogen inhibited root development to various extents depending on plants’ resistance level. Many genes responsive to FCR infection in wheat roots were enriched in plant hormone pathways. The contents of compounds involved in biosynthesis and metabolism of jasmonic acid, salicylic acid, cytokinin and auxin were drastically changed in roots at five days post-inoculation. Presoaking seeds in methyl jasmonate for 24 h promoted FCR resistance, whereas presoaking with cytokinin 6-benzylaminopurine made plants more susceptible. Overexpression of TaOPR3, a gene involved in jasmonic acid biosynthesis, enhanced plant resistance as well as root and shoot growth during infection.

First Report of Tobacco Root Rot Caused by Fusarium falciforme in China.

China is the largest producer of tobacco (Nicotiana tabacum L.) in the world with an estimated production of 2.4 million ton per year (Berbeć and Matyka 2020). In June 2021, a root disease was observed on tobacco in three surveyed counties (Xiangcheng, Linying and Jiaxian) in central Henan. Diseased plants exhibited leaf chlorosis and brown to purplish vascular discoloration of the taproot and lateral roots. Approximately 10 to 15% of the plants were symptomatic in the nine fields surveyed, representing 60 ha in total. Root segments (0.5 to 1 cm) from ten diseased plants were surface sterilized in 75% ethanol for 30 s followed by rinsing with sterile distilled water three times. Thirty air dried root pieces were placed on potato dextrose agar (PDA) and incubated at 25℃ in the dark for 2 days. Typical Fusarium spp. colonies were obtained from all root samples. Ten pure cultures were obtained by single-spore culturing (Yz01 to Yz10). Colonies on PDA showed abundant white to cream aerial mycelia with a yellowish-brown center on the reverse side after 7 days, and an average growth rate of 5 mm/day. From 7-day-old cultures grown on carnation leaf agar (CLA), macroconidia had three to four septa, were falciform, with blunt apical cells and slightly hooked basal cell, and measured 20 to 41×3-6.5 μm (n=50). Spherical conidia clusters were formed at the apex of the conidiophores. Abundant reniform and cylindrical microconidia were one to two-celled, with apexes rounded, measuring 7 to 15×2 to 5 μm (n=50). The roughly spherical chlamydospores were intercalary or terminal, single or in chains, and rough walled. Such characteristics were consistent with the Fuarium solani species complex (FSSC) (Leslie and Summerell 2006). The translation elongation factor 1-alpha (EF1-α) gene of the ten cultures was amplified with primers EF1/EF2 (O'Donnell et al. 1998), and sequenced. Maximum likelihood analysis was carried out using the EF1-α sequences of the ten cultures (Kumar et al. 2016). The RNA polymerase I largest subunit (RPB1) and second largest subunit (RPB2) genes of the cultures were amplified with primers F5/G2R and RPB2F/R respectively (O'Donnell et al. 1998, 2010), and sequenced. The EF1-α, RPB1 and RPB2 sequences (GenBank accession nos. ON186742.1-ON186751.1, ON241133.1-ON241148.1, ON324054.1-ON324057.1) were 99.4 to 100% identical to the corresponding DNA sequences of Fusarium falciforme based on FUSARIUM-ID BLASTn analysis. Morphological and molecular results confirmed this species as F. falcifome (Díaz-Nájera et al. 2021; Velarde-Félix et al. 2022). Pathogenicity tests were performed in tobacco seedlings grown on autoclaved soil. Healthy six-leaf stage tobacco seedlings (n=30; Zhongyan 100) were inoculated by placing 7-days old wheat seed (15 seeds per plant) infested with the representative culture Yz07 around the root. Thirty seedlings inoculated with sterile wheat seeds served as controls. All the plants were maintained in a growth chamber at 25±0.5℃ and 70% relative humidity. The assay was conducted three times. Typical symptoms of foliage chlorosis and root browning were observed 7 to 14 days after inoculation for all the 90 inoculated seedlings. Fifteen diseased seedlings were randomly selected for tissue isolation, and F. falciforme was reisolated from the 15 seedlings and showed the same morphology and EF1-α gene sequence as the original isolate. Control plants remained asymptomatic and no pathogen was recovered. The results showed that F. falciforme can cause root rot of tobacco. F. falciforme was reported to cause tobacco wilt and root rot in Northwestern Argentina (Berruezo et al. 2018); however, this is the first report of F. falciforme causing root rot of tobacco in China. This species was previously reported in China affecting Weigela florida (Shen et al. 2019) and Dioscorea polystachya (Zhang et al. 2020), showing that F. falciforme has a broad host range in this country. These results may inform control tobacco root rot through improve crop rotations. Funding: Funding was provided by the Science and Technology Project of Henan Provincial Tobacco Company (2020410000270012), Outstanding Youth Science and Technology Fund Project of Henan Academy of Agricultural Sciences (2022YQ09) and Science and Technology Innovation Team project of Henan Academy of Agricultural Sciences (2022TD26).

Regulation and mechanism of ethylene treatment on storage quality of fresh-cut lotus (Nelumbo nucifera Gaertn.) root slices

This study investigated the effects of 1 g L−1 ethylene immersion treatment for 1 min on the storage quality, antioxidant capacity and ethylene signal transduction pathway of fresh-cut lotus roots. Phenylalanine ammonia-lyase and polyphenol oxidase activities were increased in ethylene treatment slices, and total phenolic content was increased. The activities of peroxidase, catalase and superoxide dismutase were increased after ethylene treatment, as well as the expression of related genes (NnPOD, NnSOD, NnCAT) was upregulated. The rate of superoxide anion radical and hydroxyl radical production in ethylene treatment fresh-cut lotus roots was inhibited, the hydrogen peroxide content was reduced, and the degree of membrane lipid peroxidation was decreased, which delayed browning during the early storage. However, ethylene treatment inhibited microbial growth and improved 1,1-Diphenyl-2-picrylhydrazyl scavenging capacity only during the early storage, promoted respiration and accelerated the decline of hardness and soluble solids content throughout the storage period. At the molecular level, ethylene treatment overall upregulated the transcription of NnmetK, NnACO, NnETR, NnEIN3, and NnERF genes and promoted ethylene biosynthesis and signal transduction. This finding may be related to the senescence of fresh-cut lotus roots during late storage. These results suggest that ethylene treatment improved the antioxidant system, reduced the accumulation of reactive oxygen species, and effectively delayed the early browning of fresh-cut lotus roots, while promoting late senescence.

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.