Bp Indel Research Articles

A 24-bp Indel (Insertion-Deletion) Polymorphism in Promoter Prolactin Gene

Prolactin in chicken (cPRL) is a polypeptide hormone that plays a crucial role in incubation and brooding behavior. This hormone is coded by a gene that located at chromosome 2. The objective of this study was to investigate 24-bp indel polymorphism in promoter prolactin gene of Papua local chickens. A number of 60 DNA samples came from 60 Papua local chickens (25 males and 35 females) were used in this study. PCR (Polymerase Chain Reaction) method with a pair of specific primer was applied and a specific DNA fragment with 130 and/or 154 bp contained 24-bp indel was successfully amplified. Results of electrophoresis run on 1.5 % agarose gel showed three genotypes: II, ID and DD with the frequency of 6,7%, 48.3% and 45% respectively. The frequency of I allele was 0.31 and D allele was 0.69. Results indicated that the I allele frequency was medium in Papua local chickens population. Results therefore suggest that incubation behavior in hen population of Papua local chickens is easy to eliminate by increasing the I allele frequency in the population.

A 24-bp Indel (Insertion-Deletion) Polymorphism in Promoter Prolactin Gene

Prolactin in chicken (cPRL) is a polypeptide hormone that plays a crucial role in incubation and brooding behavior. This hormone is coded by a gene that located at chromosome 2. The objective of this study was to investigate 24-bp indel polymorphism in promoter prolactin gene of Papua local chickens. A number of 60 DNA samples came from 60 Papua local chickens (25 males and 35 females) were used in this study. PCR (Polymerase Chain Reaction) method with a pair of specific primer was applied and a specific DNA fragment with 130 and/or 154 bp contained 24-bp indel was successfully amplified. Results of electrophoresis run on 1.5 % agarose gel showed three genotypes: II, ID and DD with the frequency of 6,7%, 48.3% and 45% respectively. The frequency of I allele was 0.31 and D allele was 0.69. Results indicated that the I allele frequency was medium in Papua local chickens population. Results therefore suggest that incubation behavior in hen population of Papua local chickens is easy to eliminate by increasing the I allele frequency in the population.

Polymorphism of Prolactin gene in relation to egg productionperformance in Kadaknath hens

Present study was carried out to study egg production performance and polymorphism of Prolactin gene at 24 bp indel locus at promoter region (PRL24). Egg production performances were recorded as age at first egg (AFE), Body Weight at First Egg (WFE), Mean Egg Weight (MEW) and Total No. of Eggs at 90 days of laying (TEN). DNA was isolated from blood of 20 Kadaknath birds collected from wing vein. PRL24 locus for indel polymorphism was amplified by PCR and the product was resolved on 6% native PAGE for genotyping. The AFE (d), WFE (Kg), MEW (g) and TEN of Kadaknath hens in the present study were found to be 188.00±0.71, 1.26±0.03, 42.83±0.21 and 37.75±0.59 respectively. The Prolactin gene locus PRL24 showed two alleles I and D and three genotypes: II, ID and DD. The frequencies of I and D alleles at this locus were 0.55 & 0.45 respectively. The birds of D allele had a significantly (P<0.05) better TEN than birds of I allele.

Association of HLA-G 3' Untranslated Region Polymorphisms with Systemic Lupus Erythematosus in a Japanese Population: A Case-Control Association Study.

HLA-G plays a role in fetal-maternal tolerance as well as immunoregulation, and has been suggested to be involved in autoimmune diseases and cancers. HLA-G encodes two potentially functional polymorphisms in the 3’ untranslated region, 14bp insertion/deletion (14bp indel, rs371194629) and a single nucleotide polymorphism rs1063320, previously reported to affect HLA-G expression level or splicing isoform and to be associated with susceptibility to systemic lupus erythematosus (SLE). However, the results of SLE association studies are inconsistent, probably due to the small sample size of each study and lack of consideration of linkage disequilibrium (LD) with HLA-class II haplotypes in each population. In this study, we performed association studies of these polymorphisms on 843 patients with SLE and 778 healthy controls in a Japanese population, in many of whom HLA-DRB1 alleles have been genotyped at the four-digit level. LD was detected between DRB1*13:02, protective against multiple autoimmune diseases in the Japanese, and the rs1063320 G (D’ = 0.86, r2 = 0.02) and with 14bp del (D’ = 0.62, r2 = 0.01), but not between SLE-susceptible DRB1*15:01 and HLA-G. Although significant association with overall SLE was not detected, 14bp ins allele was significantly associated with SLE with the age of onset <20 years, when compared with healthy controls (P = 0.0067, PFDR = 0.039, OR 1.44, additive model) or with SLE patients with the age of onset ≥20 (P = 0.033, PFDR = 0.0495, OR 2.09, additive model). This association remained significant after conditioning on DRB1*13:02 or DRB1*15:01. On the other hand, significant association was detected between rs1063320 C and anti-RNP antibody and anti-Sm antibody positive SLE, which was dependent on negative LD with DRB1*13:02. eQTL analysis showed reduced HLA-G mRNA level in 14bp ins/ins individuals. In conclusion, our observations showed that HLA-G 14bp ins allele represents a genetic contribution on early-onset SLE independent of DRB1.

A novel 17 bp indel in the &amp;lt;i&amp;gt;SMAD3&amp;lt;/i&amp;gt; gene alters transcription level, contributing to phenotypic traits in Chinese cattle

Abstract. SMAD3, the messenger of the transforming growth factor beta (TGF-β) signaling pathway, plays essential roles in myogenesis and osteogenesis and may relate to the regulation of body weight. In this study, a 17 bp indel (NC_007308: g.101893_101909insGAGGATGAGTGCTCCAG) in intron3 of the SMAD3 gene was detected in four Chinese cattle breeds (Qinchuan, Jiaxian, Nanyang and Caoyuan) by using DNA pool sequencing, and its effects on gene expression and growth traits were analyzed in Qinchuan and Caoyuan cattle. The results showed that the indel locus was significantly associated with SMAD3 transcriptional levels where II genotypes had a higher value than DD genotypes in Qinchuan (QC) cattle muscle tissue (P &lt; 0.05). In addition, the locus was strongly associated with chest girth, chest width, rump length, hucklebone width and body weight in 2-year-old QC cattle (P &lt; 0.05) and body weight (12 months), body height (18 months) and chest girth (18 months) in Caoyuan cattle (P &lt; 0.5). To the best of our knowledge, this is the first evidence of the association between SMAD3 indel and cattle phenotype, and it may contribute to understanding the function of the indel, which could be a promising marker for beef cattle breeding.

Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat

Abstract. Visfatin, an adipokine hormone produced primarily by visceral adipose tissue in mammals, has been identified as having a crucial role in growth and development of skeletal muscle and lipids. In this research, the effects of two indel loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel: AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5) of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was prominently greater than that in calves and adult cattle (P &lt; 0.05). The expression level of visfatin in subcutaneous fat was notably higher than that in longissimus muscle of calves and adult cattle (P &lt; 0.05). Secondly, there were three genotypes (ins/ins, del/del and ins/del) and two genotypes (ins/del and ins/ins) detected in the 35 bp locus and 6 bp locus, respectively. Visfatin showed a minimum expression level in longissimus muscle in the homozygous deletion genotype at the 35 bp indel locus. Especially in calves, expression of visfatin was significantly greater in the heterozygous genotype than that in the homozygous insertion genotpye (P &lt; 0.05). No statistical differences were found among visfatin expression level based on genotypes in the 6 bp indel locus (P &gt; 0.05). Compared to heterozygous genotype, the expression level of homozygous insertion genotype was lower in longissimus muscle but greater in subcutaneous fat. These results imply that the expression levels of bovine visfatin vary with age and its indels might be putative variants mediating the expression of the bovine visfatin gene. This study provides useful information for further functional studies of bovine visfatin.

Association of the HLA-G 3'UTR polymorphisms with colorectal cancer in Italy: a first insight.

This study aimed to explore functional and regulatory polymorphisms and haplotypes at the HLA-G 3'UTR region in colorectal cancer development. The presence of nonpolymorphic variants was also evaluated. Three-hundred and eight patients with colorectal cancer and 294 healthy controls were analysed at the germinal level. We found an association with increased risk of colorectal cancer for +2960 14-bp INDEL, +3196 C>G SNPs and UTR-2 haplotype, and a 'protective' role for +3003 T>C, +3010 C>G polymorphisms and UTR-4 haplotype. We detected in 3 distinct patients, a novel nucleotide change (+3037 C>A) and 2 already described rare variants, +3032 G/C (EUR MAF=0.1%) and +3092G/T (EUR MAF=0%). This is the first study showing associations between different polymorphisms in the HLA-G 3'UTR and colorectal cancer susceptibility.

HLA-G 3'UTR Polymorphisms Impact the Prognosis of Stage II-III CRC Patients in Fluoropyrimidine-Based Treatment.

An important hallmark of CRC is the evasion of immune surveillance. HLA-G is a negative regulator of host’s immune response. Overexpression of HLA-G protein in primary tumour CRC tissues has already been associated to worse prognosis; however a definition of the role of immunogenetic host background is still lacking. Germline polymorphisms in the 3’UTR region of HLA-G influence the magnitude of the protein by modulating HLA-G mRNA stability. Soluble HLA-G has been associated to 3’UTR +2960 Ins/Ins and +3035 C/T (lower levels) and +3187 G/G (high levels) genotypes. HLA-G 3’UTR SNPs have never been explored in CRC outcome. The purpose of this study was to investigate if common HLA-G 3’UTR polymorphisms have an impact on DFS and OS of 253 stage II-III CRC patients, after primary surgery and ADJ-CT based on FL. The 3’UTR was sequenced and SNPs were analyzed for their association with survival by Kaplan-Meier and multivariate Cox models; results underwent internal validation using a resampling method (bootstrap analysis). In a multivariate analysis, we estimated an association with improved DFS in Ins allele (Ins/Del +Ins/Ins) carriers (HR 0.60, 95% CI 0.38–0.93, P = 0.023) and in patients with +3035 C/T genotype (HR 0.51, 95% CI 0.26–0.99, P = 0.045). The +3187 G/G mutated carriers (G/G vs A/A+A/G) were associated to a worst prognosis in both DFS (HR 2.46, 95% CI 1.19–5.05, P = 0.015) and OS (HR 2.71, 95% CI 1.16–6.63, P = 0.022). Our study shows a prognostic and independent role of 3 HLA-G 3’UTR SNPs, +2960 14-bp INDEL, +3035 C>T, and +3187 A>G.

Abstract A1-09: Functional analysis of the chr13q22.1 pancreatic cancer risk locus suggests allele-specific effects on DIS3 expression with prognostic implications

Abstract A genome-wide association study (GWAS) of pancreatic cancer conducted within the NCI Cohort Consortium (PanScan I and II) identified pancreatic cancer susceptibility loci on chromosomes 1q32.1/NR5A2, 5p15.33/CLPTM1L/TERT, 9q34.2/ABO, and 13q22.1. The most significant single-nucleotide polymorphism (SNP) identified on 13q22.1, rs9543325, lies in a ~600 kb gene desert; the nearest genes are KLF5, KLF12, PIBF1, DIS3, and BORA (265–586 kb away). Imputation using the 1000 Genomes and DCEG reference datasets did not improve the GWAS signal, but produced a set of highly correlated SNPs for functional follow-up. We performed eQTL analysis to test for association between the genotypes of these functional candidate variants and expression of nearby genes. Among 64 normal derived pancreatic tissue samples, DIS3 expression showed the strongest association with a 30 bp indel variant in the risk locus (P = 4.8 × 10-4), indicating risk alleles associate with reduced DIS3 expression. Mutations in DIS3 have previously been identified in acute myeloid leukemia and multiple myeloma, and its expression has been correlated with metastatic potential in colorectal cancer, suggesting DIS3 is relevant to cancer biology. Chromosome conformation capture identified a physical interaction between the indel-containing locus and a region near the DIS3 promoter. Luciferase assay for regulatory function of this indel-containing locus revealed allele-specific silencer activity for the insertion allele. Supershift electromobility shift assay (EMSA) demonstrated binding of LEF1 specifically to the insertion allele of the indel, which contains two in silico predicted LEF1 binding elements. Finally, through immunohistochemical analysis, high DIS3 protein levels associated with better survival for pancreatic cancer patients (hazard ratio = 2.87, 95% CI = 1.49–5.53, P = 0.001). Our results suggest that at least one target gene for the pancreatic cancer risk variants on chr13q22.1 may be DIS3, and that the underlying biology may be mediated by the novel indel through a long-range repressive effect on DIS3 expression. Citation Format: Jason W. Hoskins, Abdisamad Ibrahim, Mickey Emmanuel, Sarah Manmiller, Jinping Jia, Hemang Parikh, Irene Collins, Kris Ylaya, Sean F. Altekruse, Stephen M. Hewitt, Gloria M. Petersen, Laufey T. Amundadottir. Functional analysis of the chr13q22.1 pancreatic cancer risk locus suggests allele-specific effects on DIS3 expression with prognostic implications. [abstract]. In: Proceedings of the AACR Special Conference on Translation of the Cancer Genome; Feb 7-9, 2015; San Francisco, CA. Philadelphia (PA): AACR; Cancer Res 2015;75(22 Suppl 1):Abstract nr A1-09.

Leveraging Distant Relatedness to Quantify Human Mutation and Gene-Conversion Rates

The rate at which human genomes mutate is a central biological parameter that has many implications for our ability to understand demographic and evolutionary phenomena. We present a method for inferring mutation and gene-conversion rates by using the number of sequence differences observed in identical-by-descent (IBD) segments together with a reconstructed model of recent population-size history. This approach is robust to, and can quantify, the presence of substantial genotyping error, as validated in coalescent simulations. We applied the method to 498 trio-phased sequenced Dutch individuals and inferred a point mutation rate of 1.66 × 10(-8) per base per generation and a rate of 1.26 × 10(-9) for <20 bp indels. By quantifying how estimates varied as a function of allele frequency, we inferred the probability that a site is involved in non-crossover gene conversion as 5.99 × 10(-6). We found that recombination does not have observable mutagenic effects after gene conversion is accounted for and that local gene-conversion rates reflect recombination rates. We detected a strong enrichment of recent deleterious variation among mismatching variants found within IBD regions and observed summary statistics of local sharing of IBD segments to closely match previously proposed metrics of background selection; however, we found no significant effects of selection on our mutation-rate estimates. We detected no evidence of strong variation of mutation rates in a number of genomic annotations obtained from several recent studies. Our analysis suggests that a mutation-rate estimate higher than that reported by recent pedigree-based studies should be adopted in the context of DNA-based demographic reconstruction.

Abstract 17242: Human Leukocyte Antigen-G Polymorphisms Association to Post Heart Transplant Cardiac Allograft Vasculopathy

Introduction: Human Leukocyte Antigen (HLA)-G is an immune inhibitor molecule that has been shown to inhibit smooth muscle cell proliferation in vitro and promote vasculature protection against cardiac allograft vasculopathy (CAV). Single polymorphism nucleotides (SNPs) throughout the gene influence the expression of HLA-G. The association between HLA-G SNPs in heart transplant recipients or donors and CAV remains unclear. Objective: To determine the association between HLA-G SNPs from recipient and donor and severe CAV post heart transplant. Methods: Retrospective cohort in which 251 adult heart transplant recipients and 196 matching donors were evaluated for various HLA-G SNPs. The recipients were screened for CAV according to institutional protocol. Coronary angiographies were graded according to the International Society for Heart and Lung Transplantation classification and severe CAV was defined as 2/3 categories. DNA was genotyped for SNPs 5’ URR 201, 3’ UTR 3196, 3187, 3142 and 14bp INDEL using the Sequenom MassARRAY Platform. The association of genotypes and diagnosis of severe CAV were evaluated in parametric hazard regression model. Results: General characteristics: recipient age 48±12 years, 69% males and donor age 35±14 years. Over a median follow-up of 6 years, 20 (8%) recipients were diagnosed with severe CAV. In multivariable analysis adjusting for donor age, donor cause of death and pre-transplant creatinine, the presence of donor SNP 201 (CC vs TT/TC) was associated with increased risk for severe CAV (HR 5.29; CI 1.70-16.20; p= 0.004), as well as donor SNP 3142 (GG vs CG/CC) was associated (HR 10.05; CI 1.40-71.65; p&lt; 0.02). Furthermore, matching between recipient and donor genotypes at SNP 201 was also associated with increased risk (HR 7.50; CI 2.50-22.39; p&lt; 0.001). Conclusions: Donor HLA-G SNPs 3142/201 and recipient/donor genotype matching for SNP 201 were independent risk factors for the diagnosis of severe CAV. This is the first investigation to identify an association between the HLA-G SNPs mentioned and CAV diagnosis. This association suggests that differences in HLA-G polymorphisms constitute a pathogenic pathway to be explored for potential enhancement of diagnostic, preventive and therapeutic strategies for CAV.

Abstract 17293: Human Leukocyte Antigen-G Polymorphisms Association to Post Heart Transplant Donor Specific Antibodies

Introduction: Human Leukocyte Antigen (HLA)-G is a natural immune regulator that inhibits T cells, NK cells and B cell activity. In the context of transplantation, less rejection and better graft outcomes are associated with higher serum levels of HLA-G. The association between HLA-G polymorphisms in the recipient and donor and post-transplant donor specific antibodies (DSA) has never been explored. DSA can lead to antibody-mediated rejection and are associated with worse outcomes. Objective: to determine the association between HLA-G single nucleotide polymorphisms (SNPs) in the recipient and donor and DSA. Methods: 251 adult heart recipients and 196 matching donors were evaluated for various HLA-G SNPs. Serum from patient and donor were tested for positive presence of HLA Class I antibodies. DNA was genotyped for 14bp INDEL, G*01:01, G*01:04 and G*0:05N. The analysis was performed first in univariable regression models and then in multivariable regression model using a backward selection approach of potential risk factors with a univariable associations with p-value &lt;0.10. The model automatically included time since transplantation as an obligatory covariate. Results: General characteristics: recipient age 48.2±12.1 years, 69% males and donor age 35.5±14.3 years. Of those, 19 (8%) had at least one positive DSA diagnosis. In a multivariable analysis adjusted for time since transplant, documented non-compliance and blood group A, the presence of donor G*01:04 allele was identified with a protective role for the development of DSA (0.079, CI 0.02-0.39, p= 0.002). Patient allele G*01:05N was associated with increased risk for DSA (12.95, CI 2.36-71.00, p= 0.003). Lastly, donor SNP 14bp (DEL vs INDEL/INS) was independently associated as a risk factor for DSA (5.75, CI 1.70-19.36, p= 0.005). Conclusions: Three SNPs from the donor and recipient were identified to influence the development of donor specific antibodies. This is the first study to investigate the association of HLA-G to the development of donor specific antibodies and to demonstrate both detrimental and beneficial roles for HLA-G polymorphisms.

Porcine SOX9 Gene Expression Is Influenced by an 18 bp Indel in the 5'-Untranslated Region.

Sex determining region Y-box 9 (SOX9) is an important regulator of sex and skeletal development and is expressed in a variety of embryonal and adult tissues. Loss or gain of function resulting from mutations within the coding region or chromosomal aberrations of the SOX9 locus lead to a plethora of detrimental phenotypes in humans and animals. One of these phenotypes is the so-called male-to-female or female-to-male sex-reversal which has been observed in several mammals including pig, dog, cat, goat, horse, and deer. In 38,XX sex-reversal French Large White pigs, a genome-wide association study suggested SOX9 as the causal gene, although no functional mutations were identified in affected animals. However, besides others an 18bp indel had been detected in the 5′-untranslated region of the SOX9 gene by comparing affected animals and controls. We have identified the same indel (Δ18) between position +247bp and +266bp downstream the transcription start site of the porcine SOX9 gene in four other pig breeds; i.e., German Large White, Laiwu Black, Bamei, and Erhualian. These animals have been genotyped in an attempt to identify candidate genes for porcine inguinal and/or scrotal hernia. Because the 18bp segment in the wild type 5′-UTR harbours a highly conserved cAMP-response element (CRE) half-site, we analysed its role in SOX9 expression in vitro. Competition and immunodepletion electromobility shift assays demonstrate that the CRE half-site is specifically recognized by CREB. Both binding of CREB to the wild type as well as the absence of the CRE half-site in Δ18 reduced expression efficiency in HEK293T, PK–15, and ATDC5 cells significantly. Transfection experiments of wild type and Δ18 SOX9 promoter luciferase constructs show a significant reduction of RNA and protein levels depending on the presence or absence of the 18bp segment. Hence, the data presented here demonstrate that the 18bp indel in the porcine SOX9 5′-UTR is of functional importance and may therefore indeed be a causative variation in SOX9 associated traits.

E22 - HLA-G 3'UTR +2960 14-bp INDEL (Ins/Del) polymorphism is associated to improved DFS of stage II-III CRC patients

E22 - HLA-G 3'UTR +2960 14-bp INDEL (Ins/Del) polymorphism is associated to improved DFS of stage II-III CRC patients

Identification of a 13 bp indel polymorphism in the 3′-UTR of DGAT2 gene associated with backfat thickness and lean percentage in pigs

DGAT2 (acyl-CoA: diacylglycerol acyltransferase, EC2.3.1.20) is a member of acyl-CoA: monoacylglycerol acyltransferase (MGAT) family, which catalyzes one fatty acyl-CoA and diacylglycerol (DG) molecule to form triacylglycerols (TG) and is the final and rate-limiting step in the reaction of TG synthesis pathways. We previously showed that, during pig development, the fold change of DGAT2 mRNA in backfat tissue is much higher than that of DGAT1, implying that DGAT2 is more important in regulating porcine fat deposition. In this study, a 13bp indel polymorphism located at 905bp downstream from the stop codon (TGA) of porcine DGAT2 was found and two alleles of A (with 13bp insertion) and B (no insertion) were designated. Allele A is dominant in all pig populations investigated. The backfat thickness of individuals with genotype AA is significantly lower than those with genotype AB (p<0.01), and the lean percentage of individuals with genotype AA is significantly higher than those with genotype AB (p<0.05) in Junmu No. 1 white pig population. The secondary structure of 3′-UTR without the 13bp insertion is slightly less stable than with the 13bp insertion type. In vitro assay indicates that, after differentiation, the luciferase activity was significantly higher for pGL3-B compared to pGL3-A vector (p<0.001). Moreover, the DGAT2 mRNA expression in the backfat tissue of pigs with genotype BB was significantly higher than AB in commercial DLY pigs (p<0.05). These results suggest that the 13bp indel polymorphism in the 3′-UTR of porcine DGAT2 most likely affects fat deposition by altering its expression in pigs.

The prion protein gene polymorphisms associated with bovine spongiform encephalopathy susceptibility differ significantly between cattle and buffalo

Prion protein, encoded by the prion protein gene (PRNP), plays a crucial role in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Several polymorphisms within the PRNP are known to be associated with influencing bovine spongiform encephalopathy (BSE) susceptibility in cattle, namely two insertion/deletion (indel) polymorphisms (a 23-bp indel in the putative promoter and a 12-bp indel in intron 1), the number of octapeptide repeats (octarepeats) present in coding sequence (CDS) and amino acid polymorphisms. The domestic buffaloes, Bubalus bubalis, are a ruminant involved in various aspects of agriculture. It is of interest to ask whether the PRNP polymorphisms differ between cattle and buffalo. In this study, we analyzed the previously reported polymorphisms associated with BSE susceptibility in Chinese buffalo breeds, and compared these polymorphisms in cattle with BSE, healthy cattle and buffalo by pooling data from the literature. Our analysis revealed three significant findings in buffalo: 1) extraordinarily low deletion allele frequencies of the 23- and 12-bp indel polymorphisms; 2) significantly low allelic frequencies of six octarepeats in CDS and 3) the presence of S4R, A16V, P54S, G108S, V123M, S154N and F257L substitutions in buffalo CDSs. Sequence alignments comparing the buffalo coding sequence to other species were analyzed using the McDonald–Kreitman test to reveal five groups (Bison bonasus, Bos indicus, Bos gaurus, Boselaphus tragocamelus, Syncerus caffer caffer) with significantly divergent non-synonymous substitutions from buffalo, suggesting potential divergence of buffalo PRNP and others. To the best of our knowledge this is the first study of PRNP polymorphisms associated with BSE susceptibility in Chinese buffalo. Our findings have provided evidence that buffaloes have a unique genetic background in the PRNP gene in comparison with cattle.

The CmACS-7 gene provides sequence variation for development of DNA markers associated with monoecious sex expression in melon (Cucumis melo L.)

Most melon (Cucumis melo L.) breeding lines in South Korea display andromonoecious sex expression, which necessitates laborious hand emasculation during F1 hybrid seed production. Thus, there is a need to develop monoecious sex types in elite germplasm to obviate self-pollination. Sex expression is associated with floral ethylene production, which, in monecious melon plants, is associated with the A locus. Our study was conducted to develop molecular markers for selection of monoecious plants based on sequence variation inherent in the CmACS-7 gene [encoding 1-aminocyclopropane-1-carboxylic acid synthase (ACS)] that is associated with ethylene production. Full-length CmACS-7 sequences were cloned from a monoecious (MO23) and an andromonoecious (AM24) line. The alignment of those CmACS-7 sequences revealed a single nucleotide polymorphism (SNP; C170T) in exon 1 and an 18 bp indel in the 3′-untranslated region (UTR) of between MO23 and AM24, which was then used to develop a cleaved amplified polymorphic sequence (CAPS) (EX1-C170T) and a sequence characterized amplified region (SCAR) marker (T1ex), respectively. The sex expression and the T1ex SCAR-based genotype of 442 F2 plants derived from a MO23 × AM24 cross was determined. Monoecy and andromonoecy segregated in a 3:1 ratio in F2 progeny, where the sex type of 429 plants (13 plants not classified) co-segregated with the SCAR marker, demonstrating that sex expression regulated by CmACS-7 is controlled by a single dominant gene and that it confers monoecy in line MO23. Allelic variation in 112 geographically diverse melon lines for CmACS-7 as accessed by CAPS EX1-C170T and SCAR T1ex markers indicated that the: 1) exon 1 of CmACS-7 is highly conserved and the SNP/sex expression association detected is highly predictable making it potentially useful for marker-based selection of monoecious plants, and; 2) 18 bp indel mutation in the 3′-UTR was present in various lengths depending on different monoecious melon germplasm.

Abstract B111: Functional analysis of the chr13q22.1 pancreatic cancer risk locus suggests allele-specific effects on DIS3 expression with prognostic implications

Abstract A genome-wide association study (GWAS) of pancreatic cancer conducted within the NCI Cohort Consortium (PanScan I and II) identified pancreatic cancer susceptibility loci on chromosomes 1q32.1/NR5A2, 5p15.33/CLPTM1L/TERT, 9q34.2/ABO, and 13q22.1. The most significant single-nucleotide polymorphism (SNP) identified on 13q22.1, rs9543325, lies in a 600 kb gene desert; the nearest genes are KLF5, KLF12, PIBF1, DIS3, and BORA (265–586 kb). Imputation using the 1000 Genomes and DCEG reference datasets did not improve the GWAS signal, but produced a set of highly correlated SNPs for functional follow-up. We performed eQTL analysis to test for association between the genotypes of these functional candidate variants and expression of nearby genes. Among 100 normal derived pancreatic tissue samples, DIS3 expression showed the strongest association with a novel 30 bp indel variant in the risk locus (P = 4.0 × 104), indicating risk alleles associate with reduced DIS3 expression. Mutations in DIS3 have previously been identified in acute myeloid leukemia and multiple myeloma, and its expression has been correlated with metastatic potential in colorectal cancer, suggesting DIS3 is relevant to cancer biology. Chromosome conformation capture identified a physical interaction between the indel-containing locus and a region near the DIS3 promoter. Luciferase assay for regulatory function of this indel-containing locus revealed allele-specific silencer activity for the insertion allele. Supershift electromobility shift assay (EMSA) demonstrated binding of LEF1 specifically to the insertion allele of the indel, which contains two in silico predicted LEF1 binding elements. Finally, through immunohistochemical analysis, high DIS3 protein levels associated with better survival for pancreatic cancer patients (hazard ratio = 2.87, 95% CI = 1.49–5.53, P = 0.001). Our results suggest that at least one target gene for the pancreatic cancer risk variants on chr13q22.1 may be DIS3, and that the underlying biology may be mediated by the novel indel through a long-range repressive effect on DIS3 expression. Citation Format: Jason W. Hoskins, Abdisamad Ibrahim, Mickey Emmanuel, Hemang Parikh, Jinping Jia, Irene Collins, Kris Ylaya, Sean F. Altekruse, Stephen M. Hewitt, Gloria M. Petersen, Laufey T. Amundadottir. Functional analysis of the chr13q22.1 pancreatic cancer risk locus suggests allele-specific effects on DIS3 expression with prognostic implications. [abstract]. In: Proceedings of the AACR Special Conference on Pancreatic Cancer: Innovations in Research and Treatment; May 18-21, 2014; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2015;75(13 Suppl):Abstract nr B111.

Genetic association between the HLA-G 14-bp insertion/deletion polymorphism and the recurrent spontaneous abortions in Saudi Arabian women.

The non-classical class I human leukocyte antigen (HLA)-G molecule was found to be predominately expressed in the extravillous cytotrophoblasts at the fetal-maternal interface during pregnancy. This molecule is critically important for successful implantation during human pregnancy. The polymorphic insertion-deletion (indel) 14-base pair (bp) site localized at the 3' untranslated region was associated with HLA-G mRNA stability and isoform alternative splicing patterns, and thus may influence HLA-G function during pregnancy. We studied the association between the 14-bp indel polymorphism (rs16375) at the 3' untranslated region with recurrent spontaneous abortions in a Saudi population living in Riyadh. A group of 64 women with 2-11 successive abortions were included in this study. The control group included 62 women without reported abortions and at least 2 pregnancies, all visiting the King Khaled Hospital in Riyadh. The 14-bp indel was genotyped in the case and control groups. The frequency of the genotype +14/+14 was slightly higher in women with recurrent spontaneous abortions, but no significant differences were observed in the distribution of alleles and genotypes.

Maternal human leukocyte antigen-G (HLA-G) genetic variants associate with in utero mother-to-child transmission of HIV-1 in Black South Africans

A 14-bp insertion/deletion (indel) within the 3′ untranslated region (3′UTR) that affects HLA-G expression has been associated with HIV-1 mother-to-child transmission (MTCT). However, other 3′UTR single nucleotide polymorphisms (SNPs) that influence HLA-G mRNA stability have been described but not analysed in the context of MTCT, and little is known about the role of HLA-G alleles. We examined HLA-G alleles and 3′UTR SNPs, including the 14-bp indel, in 216 mother–infant pairs from Johannesburg, South Africa. Mother–infant pairs were classified as HIV-1 non-transmitting (NT, n=144) or HIV-1 transmitting (TR, n=72) with either intrapartum (IP, n=29) or in utero (IU, n=19) infected infants. We found HLA-G allele, G∗01:01:02 (in strong linkage disequilibrium with the 14-bp insertion) and +3187G SNP were significantly over-represented in IU-TR mothers compared to NT mothers (P=0.036, OR=2.26; P=0.011, OR=2.96, respectively). These findings suggest that maternal HLA-G alleles and/or SNPs that might alter expression of HLA-G potentially influence IU HIV-1 MTCT.