Bovine Nuclear Transfer Embryos Research Articles

Effects of Trichostatin A on the Timing of the First Cleavage and In Vitro Developmental Potential of Bovine Somatic Cell Nuclear Transfer Embryos.

This study examined the relationship between the timing of the first cleavage and in vitro development of bovine somatic cell nuclear transfer (SCNT) embryos treated with trichostatin A (TSA). SCNT embryos were visually assessed at 22, 26, and 48 hours after activation. Each embryo with two or more distinct blastomeres was transferred into a microwell and cultured until day 7. Irrespective of TSA treatment, approximately half of the cleaved embryos were observed at 22 hours, and a significantly higher blastocyst formation rate was shown in the SCNT embryos cleaved at 22 hours than those cleaved at ≥26 hours. The blastocyst formation rate of TSA-treated embryos cleaved at 22 hours (80%) was slightly higher than that of the control embryos (70%). In addition, interferon-τ (IFN-τ) expression was significantly lower in control SCNT embryos and late-cleaving (>26 hours) TSA-treated embryos than in in vitro fertilized (IVF) embryos. However, a significant difference was not observed between TSA-treated SCNT embryos cleaved at 22 and 26 hours, and IVF embryos. These results suggest that TSA treatment has no influence on the timing of the first cleavage of SCNT embryos; however, it slightly improves the blastocyst formation rate and the expression level of IFN-τ in early-cleaving embryos.

1 Effect of cytokine-supplemented maturation medium on bovine somatic cell nuclear transfer embryo development

Invitro maturation is an important process in the invitro production of embryos. It has been shown recently that 3 cytokines: fibroblast growth factor 2 (FGF2), leukemia inhibitory factor (LIF), and insulin-like growth factor 1 (IGF1), increase the efficiency of IVM, blastocyst production, and invivo development following somatic cell nuclear transfer (SCNT) in pigs (Yuan et al. 2017 PNAS 114, E5796-E5804). This study was designed to assess the effect of these cytokines on IVM in bovine oocytes, their consecutive development to blastocyst, and pregnancy rate when used in SCNT. Cumulus–oocyte complexes (COCs) were retrieved from abattoir-derived ovaries, matured for 21h in either standard maturation medium [TCM-199 (Gibco/Life Technologies), 10% fetal bovine serum, 0.5µgmL−1 FSH, 5µgmL−1 LH, 100UmL−1 penicillin/streptomycin] or maturation medium supplemented with 20ngmL−1 human LIF, 20ngmL−1 IGF1, and 40ngmL−1 FGF2. After IVM, the first polar body and metaphase plate were removed from MII oocytes. Fibroblast cells were injected in the perivitelline space and fused with enucleated oocytes in 0.28M sorbitol fusion medium (0.1mM calcium, 0.5mM magnesium, 0.5mM HEPES, 1gmL−1 bovine serum albumin) by a single pulse of 1.75 kV/cm for 22ms. Reconstructed embryos were activated by exposure to 5μM ionomycin for 5min, followed by 4h of incubation in 2mM 6-(dimethylamino)purine and 10μgmL−1 cycloheximide. Cleavage and blastocyst rates were assessed at Day 2 and Day 7, respectively. Blastocysts were transferred to oestrus synchronized recipients and initial pregnancy rates assessed at Day 40 after embryo transfer. Statistical analysis was performed using one-way ANOVA or chi-squared test. Data are presented as mean±s.e.m. The MII rate was significantly higher in maturation medium supplemented with cytokines compared with control medium (80.2±2.33%, n=885 vs. 66.8±1.82%, n=822; P<0.05, 7 replicates, one-way ANOVA). No statistical difference was found in the cleavage rate of SCNT embryos between treatment and control groups (94.2±1.34%, n=259 vs. 90.9±1.22%, n=208; P>0.05, 8 replicates, one-way ANOVA), respectively. However, a significant increase in blastocyst rate was observed in the treatment group compared with the control group (40.6±5.1%, n=446 vs. 24.3±2.9%, n=300; P<0.05, 8 replicates, one-way ANOVA). SCNT embryos derived from the treatment group also resulted in a significant increase in initial pregnancy rates (50.3±20.9%, n=48 vs. 29.0±20.6%, n=31; P<0.05, 4 replicates, chi-squared). Full-term pregnancy rates are pending. In conclusion, addition of FGF2, LIF, and IGF1 to maturation medium improves bovine IVM and SCNT blastocyst development and initial pregnancy rates. The effect on full-term pregnancy success is yet to be determined. This research was supported by UAES project (1343) and RFBR (18-29-07089).

87 Analyzing metabolomic profile of bovine IVF and somatic cell nuclear transfer embryos through Raman spectroscopy

While knowledge of early embryo development and viability has continually increased, there is still a need for noninvasive methods to identify embryos with the highest chances of development to term when transferred. The most widely used technique, morphological assessment, is highly subjective and limited by personnel experience. Spent media from invitro culture could be used as a valuable noninvasive marker for embryo quality assessment. Raman spectroscopy has proven to be a powerful tool for identifying the molecular characteristics of spent culture media by measuring vibration of chemical bonds, allowing for metabolomic profiling of varying stages and quality of embryos. It is well documented that embryos produced through somatic cell nuclear transfer (SCNT) result in lower pregnancy rates and higher incidences of pregnancy loss when compared with embryos produced through IVF (Heyman et al. 2002 Biol. Reprod. 66, 1-13). This study was designed to examine differences in spent media between bovine embryos produced by IVF and SCNT. The SCNT embryos with a metabolomic profile more similar to IVF embryos may have a higher developmental competence. Bovine cumulus-oocyte complexes (COCs) were retrieved from abattoir-derived ovaries and matured for 21h in maturation medium. After IVM, COCs were either used for IVF or SCNT and cultured in 50μL droplets of synthetic oviductal fluid medium + fetal bovine serum in groups of 45 from Day 0-5. On Day 5, embryos that had reached morula stage were placed in individual droplets of 13μL of synthetic oviductal fluid + bovine serum albumin until Day 7. All embryos were cultured at 38.5°C and 5% CO2. On Day 7 embryos were assessed for developmental stage and quality and 10μL of medium from individual culture drops was collected for Raman spectroscopy. Samples were loaded on an MgF2 optical window, dried, and analysed using a 785nm near-infrared laser in the spectral range of 600 to 1800cm−1. Raw Raman data were first pre-processed by baseline correction (asymmetric least-squares smoothing) and normalization. Principal component analysis and partial least squares were then applied to reduce data dimensions. The score of the most significant principal components from principal component analysis and the optimum number of scores from partial least squares were used for linear discriminant analysis. Spent media samples from 4 SCNT embryos, 3 IVF embryos, and 3 empty media samples were analysed, with 50 spectra obtained from each sample. Preliminary data showed grouping of medium containing embryos developed to blastocyst from medium containing embryos arrested at morula or empty medium. We also saw grouping of medium containing SCNT embryos from medium containing IVF embryos within both the morula and blastocyst stage from empty medium. This shows evidence of metabolomic differences between embryos of different developmental potential and embryos produced by IVF and SCNT. Further investigation of the Raman profile of these groups can display specific differences in chemical components and help to identify candidate genes causing differing metabolism of these groups.

19 Improvement of the developmental competence of bovine somatic cell nuclear transfer embryos using latrunculin A during activation

Somatic cell nuclear transfer (SCNT) is an assisted reproductive technology with potential for its application in agriculture, biomedicine, and biotechnology. However, the SCNT efficiency is low. Failure in embryo production by SCNT could be associated mainly with chemical activation treatments or the donor cell type. In this context, we compare the use of latrunculin A (LatA), instead of cytochalasin B during the activation with roscovitine (Rosco), versus the treatment of donor cells with demecolcine (D-cells) followed by activation just with Rosco to compare cloning efficiency. The aim of this study was to evaluate the invitro developmental competence as well as the gene expression pattern of key genes (CDX2, OCT4, SOX2, and NANOG) in blastocysts obtained from the two treatments. To do this, cumulus-oocyte complexes were collected from cow ovaries obtained from slaughterhouses and were IVM for 21h. After cumulus-cell removal, enucleation was performed as described by Gambini et al. (2014 PLoS ONE 9, e110998; https://doi.org/10.1371/journal.pone.0110998). The G0/G1 cells or D-cells were fused to the oocytes. For activation, reconstructed zygotes were treated with 5μM ionomycin for 4min followed by 5-h incubation into different randomly activation groups: D-cells + 50μM Rosco (SCNT-Demec), G0/G1 cells + 50μM Rosco/10μM LatA (SCNT-LatA), and G0/G1 cells + 50μM Rosco/5μgmL−1 cytochalasin B (SCNT-Ctrol). Parthenogenetic controls were also included: Part-Demec, Part-LatA, and Part-Ctrol. Activated oocytes were cultured in synthetic oviductal fluid with amino acids medium until blastocyst stage. Rates of cleavage, morulae, and blastocysts were evaluated at Days 2, 5, and 7 of invitro culture, respectively. Relative abundance of mRNA coding for the four genes was compared between SCNT-Demec, SCNT-LatA, SCNT-Ctrol, and IVF groups by RTqPCR. Data was analysed by Fisher's exact test for invitro culture (P<0.05) or by one-way analysis of variance followed by Tukey post-hoc test (P=0.05). Cleavage rates from SCNT-Demec (n=247, 88%) and SCNT-LatA (n=112, 88%) were significantly higher than those from SCNT-Ctrol (n=123, 76%; Table 1). However, higher blastocyst rates were observed for the SCNT-LatA (n=112, 29%) group than for SCNT-Demec (n=247, 10%) and SCNT-Ctrol (n=123, 14%) (P<0.05). No differences were found for the relative abundance of mRNAs coding for SOX2 and CDX2 between all groups. The NANOG expression was significantly decreased in SCNT-Ctrol and SCNT-LatA compared with IVF embryos (P<0.05). The SCNT-Demec group did not differ from IVF embryos, and OCT4 expression analysis showed no difference among groups. In conclusion, LatA activation improved significantly blastocyst rates, whereas it did not affect gene expression when compared with IVF embryos. Our results suggest that this group could improve full-term developmental efficiency of SCNT embryos. Table 1.Cleavage, morulae, and blastocyst rates among the groups Group1 Treatment n Cleavage (%) Morulae (%) Blastocyst (%) SCNT-Demec Rosco 247 218 (88,26)b 41 (16,60)a 24 (9,72)a SCNT-Ctrol CB/Rosco 123 93 (75,61)a 25 (20,33)a 17 (13,82)a SCNT-LatA LatA 10μM/Rosco 112 99 (88,39)b 42 (37,50)b 33 (29,46)bc Part-Demec Rosco 141 133 (94,33)b 35 (24,82)a 20 (14,18)a Part-Ctrol CB/Rosco 84 76 (90,48)b 22 (26,19)ab 19 (22,62)ab Part-LatA LatA 10μM/Rosco 73 67 (91,78)b 30 (41,10)b 28 (38,36)c a-cStatistical differences between treatments (Fisher's test P<0.05). 1Treatments: donor cells with demecolcine (D-cells) + 50μM roscovitine (Rosco) (SCNT-Demec), G0/G1 cells + 50μM Rosco/10μM latrunculin A (LatA) (SCNT-LatA), and G0/G1 cells + 50μM Rosco/5μgmL−1 cytochalasin B (CB) (SCNT-Ctrol). Parthenogenetic controls were also included: Part-Demec, Part-LatA, and Part-Ctrol.

35 Interspecies Somatic Cell Nuclear Transfer Embryos that Form Nucleoli do not Always Activate Mitochondrial Functional Differentiation at the Time of Embryonic Genome Activation

Embryonic genome activation (EGA) is a complex process that needs a good orchestration of all biochemical processes at the time of maternal-to-embryonic transition. Mitochondria are strictly dependent on the nucleus for their correct activity as ~1500 mitochondrial genes have nuclear localisation. The finding of transcriptional activation and accumulation of mRNAs related to mitochondrial biogenesis (Mtango et al. 2008 Reprod. Fertil. Dev. 20, 846-859) around the time of EGA confirmed the role of nucleus in this process. Studying mitochondria behaviour in interspecies somatic cell nuclear transfer (iSCNT) embryos (Lagutina et al. 2010 Reproduction 140, 273-285), we have found that at the time of EGA, mitochondria activation could be demonstrated by JC-1 accumulation. We suggested that comparison of the mean green fluorescence intensity (FI) that corresponds to the fluorescence of the monomeric form of the dye and correlates to relative mitochondrial mass (Mancini et al. 1997) in iSCNT and control nuclear transfer (NT) could serve as a test to assess EGA in iSCNT embryos. The aim of this study was to estimate nuclear-cytoplasmic interaction in iSCNT embryos that formed nucleoli at the time of EGA (Lagutina et al. 2011 Reproduction 141, 453-465) such as embryos derived from bovine oocytes and bovine (control), buffalo or ovine donor nuclei, and from porcine oocytes and porcine (control), horse, or rabbit nuclei. Embryos 72 h after activation were stained with 2 μM JC-1 in SOF-HEPES with 10% FCS at 37°C for 1 h. Images were collected using a fluorescein isothiocyanate (FITC) filter and analysed with Adobe Photoshop Elements 2 (Adobe Systems, San Jose, CA, USA). The data are presented as mean FI of the embryo. To demonstrate the effect of EGA inhibition on mitochondria, bovine and porcine NT embryos were cultured in medium supplemented with 25 μg/mL α-amanitin (AA) from 48 to 72 h after activation. The analyses of mean FI of the embryos showed that ovine and buffalo nuclei were able to support mitochondrial mass accumulation in iSCNT embryos with bovine oocytes equal to control bovine NT embryos (35 ± 11.2; 41.9 ± 14.8; 36.2 ± 7.6, respectively) that was significantly higher than in bovine embryos treated with AA (15.4 ± 4.9; P < 0.05). In the iSCNT embryos composed of porcine oocytes and equine or rabbit nuclei, mean FI values (20 ± 13.4; 18.3 ± 5.5, respectively) were comparable with those in porcine NT embryos treated with AA (16.2 ± 6.2), and were significantly lower than in porcine control (91 ± 47.7; P < 0.05) NT embryos, demonstrating the inability of equine and rabbit nuclei to properly govern the porcine mitochondria mass growth at the time of EGA. In conclusion, nucleolus formation and activation of nuclear encoded mitochondrial genes at the time of EGA cannot serve, per se, as a marker of correct embryonic genome activation in iSCNT embryos, because, in our conditions, no iSCNT embryos developed to blastocyst (Lagutina et al. 2010 Reproduction 140, 273-285). This knowledge about behaviour of different embryo compartments at the time of EGA could extend our understanding of the whole process. This work was funded by Translink (EU FP7 no. 603049) and Xenoislet projects (EU FP7 no. 601827).

32 MicroRNA-29b Improves the Quality and Developmental Potential of Blastocysts Derived from Somatic Cell Nuclear Transfer in Cattle

MicroRNAs (miRNAs) are small non-coding RNAs with important roles in diverse cellular processes. miR-29b plays a crucial role during somatic cell reprogramming. However, studies of the function of miR-29b in embryogenesis are limited. The aim of the current study was to explore the effects of miR-29b on the developmental competence of bovine somatic cell nuclear transfer (SCNT) embryos as well as the underlying mechanisms of action. The expression level of miR-29b was lower in bovine SCNT embryos at the pronuclear, 8-cell, and blastocyst stages compared with IVF embryos (P < 0.05). To determine the function of miR-29b in the bovine SCNT embryo, we microinjected a miR-29b mimic and inhibitor into bovine SCNT zygotes. The results showed that miR-29b significantly decreased the expression of Dnmts (Dnmt3a/3b and Dnmt1) in bovine SCNT embryos (P < 0.05). We further investigated SCNT embryo developmental competence and found that miR-29b overexpression during bovine SCNT embryonic development does not improve developmental potency (P > 0.05) but down-regulation inhibits developmental potency (P < 0.05). Although miR-29b overexpression does not improve the developmental potency of bovine SCNT embryos, the quality of bovine SCNT embryos at the blastocyst stage improved significantly (P < 0.05). The expression of pluripotency factors (OCT4 and SOX2) and cellular proliferation rate were significantly higher in blastocysts from the miR-29b overexpression group than the control and down-regulation groups (P < 0.05). In addition, outgrowth potential in blastocysts after miR-29b overexpression was also significantly greater in the miR-29b overexpression group than in the control and down-regulation groups (P < 0.05). Taken together, these results demonstrated that miR-29b plays an important role in bovine SCNT embryo development.

Investigation of the Developmental Potential and Developmental Kinetics of Bovine Parthenogenetic and Somatic Cell Nuclear Transfer Embryos Using a Time-Lapse Monitoring System.

A time-lapse monitoring system has predictive value for selecting good-quality embryos with the highest implantation potential. Using this new tool, we investigated the developmental potential and developmental kinetics of bovine parthenogenetic (PA) and two types of somatic cell nuclear transfer (NT) embryos. Bovine non-transgenic ear cells (bECs) or transgenic cells (bTGCs) were used as donor cells. The cleavage and blastocyst development rates did not significantly differ among the PA, NT-bEC, and NT-bTGC groups, and first cleavage occurred an average of 19.3 hours (n = 70), 21.6 hours (n = 60), and 21.3 hours (n = 62) after activation, respectively (20.4 hours [n = 192] for all embryos). When embryos were classified into early cleaving (≤20 hours) and late cleaving (>20 hours) groups, the blastocyst formation rate was much higher in the early cleaving groups (PA, 46%; NT-bEC, 50%; NT-bTGC, 39%) than in the late cleaving groups (PA, 18%; NT-bEC, 23%; NT-bTGC, 28%), while the percentage of embryos whose development was blocked between the two- and eight-cell stages was increased in the late cleaving groups. The percentage of embryos classified as early cleaving with a normal morphology was twofold higher in the PA group (20.0%, n = 14) than in the NT-bTGC group (9.7%, n = 6). The timing of each developmental stage varied widely; the timing of first cleavage varied from 7.6 hours in the PA group to 34.5 hours in the NT-bEC group and the timing of expanded/hatching blastocyst appearance varied from 141.6 hours in the PA group to 196.3 hours in the NT-bTGC group, differences of 26.9 and 54.7 hours, respectively (PA>NT-bEC>NT-bTGC). These results demonstrate that time-lapse monitoring provides novel data regarding individual embryo developmental kinetics and helps to predict developmental potential for improved bovine NT embryo selection based on early cleavage (≤20 hours) and normal morphology.

Mitochondria-targeted DsRed2 protein expression during the early stage of bovine somatic cell nuclear transfer embryo development

Somatic cell nuclear transfer (SCNT) has been widely used as an efficient tool in biomedical research for the generation of transgenic animals from somatic cells with genetic modifications. Although remarkable advances in SCNT techniques have been reported in a variety of mammals, the cloning efficiency in domestic animals is still low due to the developmental defects of SCNT embryos. In particular, recent evidence has revealed that mitochondrial dysfunction is detected during the early development of SCNT embryos. However, there have been relatively few or no studies regarding the development of a system for evaluating mitochondrial behavior or dynamics. For the first time, in mitochondria of bovine SCNT embryos, we developed a method for the visualization of mitochondria and expression of fluorescence proteins. To express red fluorescence in mitochondria of cloned embryos, bovine ear skin fibroblasts, nuclear donor, were stably transfected with a vector carrying mitochondria-targeting DsRed2 gene tagged with V5 epitope (mito-DsRed2-V5 tag) using lentivirus-mediated gene transfer because of its ability to integrate in the cell genome and the potential for long-term transgene expression in the transduced cells and their dividing cells. From western blotting analysis of V5 tag protein using mitochondrial fraction and confocal microscopy of red fluorescence using SCNT embryos, we found that the mitochondrial expression of the mito-DsRed2 protein was detected until the blastocyst stage. In addition, according to image analysis, it may be suggested possible use of the system for visualization of mitochondrial localization and evaluation of mitochondrial behaviors or dynamics in early development of bovine SCNT embryos.

Comparisons of Development Potential in Bovine SCNT Embryos using Donor Cells treated with Different Demethylating Inhibitors

To improve the developmental potential of bovine somatic cell nuclear transfer (SCNT) embryos, this study compared the developmental rates to blastocyst stage in the SCNT embryos using donor fibroblasts treated with 5-azacytidine (5AC) and S-adenosylhomocysteine (SAH) at different concentrations. Their reprogramming efficiency level was investigated with level of telomerase activity. Donor fibroblasts isolated from adult ear skin of a cow were exposed to 5AC and SAH at different concentrations during 2 passages. After nuclear transfer into enucleated recipient oocytes, the cleavage and developmental rates were significantly (p<0.05) decreased in the SCNT embryos using 5AC-treated fibroblasts (5AC-SCNT embryos), compared with those of non-treated control (control-SCNT embryos) and SAH-treated fibroblasts (SAH-SCNT embryos). The developmental rates to blastocyst stage tended to be slightly increased in the SAH-SCNT embryos at each of the concentrations, and especially, the developmental rates in the SCNT embryos using 1.0 mM SAH-treated fibroblasts were significantly (p<0.05) higher than that of control SCNT embryos. The mean numbers of total and ICM cell in blastocysts were also significantly (p<0.05) decreased in the 5AC-SCNT embryos, compared with those of other SCNT blastocysts. Further, the level of telomerase activity was also significantly (p< 0.05) decreased in the 5AC-SCNT embryos than those of control and SAH-SCNT embryos. Whereas, a significantly (p<0.05) up-regulated telomerase activity was observed in SAH-SCNT embryos, compare with that of control-SCNT embryos. In conclusion, SCNT embryos using hypomethylated donor cells with SAH, not 5AC, may improve the developmental potential and reprogramming efficiency.

In vitro culture of stem-like cells derived from somatic cell nuclear transfer bovine embryos of the Korean beef cattle species, HanWoo.

We established and maintained somatic cell nuclear transfer embryo-derived stem-like cells (SCNT-eSLCs) from the traditional Korean beef cattle species, HanWoo (Bos taurus coreanae). Each SCNT blastocyst was placed individually on a feeder layer with culture medium containing three inhibitors of differentiation (3i). Primary colonies formed after 2-3 days of culture and the intact colonies were passaged every 5-6 days. The cells in each colony showed embryonic stem cell-like morphologies with a distinct boundary and were positive to alkaline phosphatase staining. Immunofluorescence and reverse transcription-polymerase chain reaction analyses also confirmed that these colonies expressed pluripotent markers. The colonies were maintained over 50 passages for more than 270 days. The cells showed normal karyotypes consisting of 60 chromosomes at Passage 50. Embryoid bodies were formed by suspension culture to analyse in vitro differentiation capability. Marker genes representing the differentiation into three germ layers were expressed. Typical embryonal carcinoma was generated after injecting cells under the testis capsule of nude mice, suggesting that the cultured cells may also have the potential of in vivo differentiation. In conclusion, we generated eSLCs from SCNT bovine embryos, using a 3i system that sustained stemness, normal karyotype and pluripotency, which was confirmed by in vitro and in vivo differentiation.

MicroRNA-34c expression in donor cells influences the early development of somatic cell nuclear transfer bovine embryos.

The essence of the reprogramming activity of somatic cell nuclear transfer (SCNT) embryos is to produce normal fertilized embryos. However, reprogramming of somatic cells is not as efficient as the reprogramming of sperm. In this report, we describe the effect of an inducible, specific miR-34 microRNA expression in donor cells that enables a similar level of sperm:transgene expression on the early development of SCNT embryos. Our results showed that donor cells with doxycycline (dox)-induced miR-34c expression for the preparation of SCNT embryos resulted in altered developmental rates, histone modification (H3K9ac and H3K4me3), and extent of apoptosis. The cleavage rate and blastocyst formation of the induced nuclear transfer (NT) group were significantly increased. The immunofluorescence signal of H3K9ac in embryos in the induced NT group significantly increased in two-cell- and eight-cell-stage embryos; that of H3K4me3 increased significantly in eight-cell-stage embryos. Although significant differences in staining signals of apoptosis were not detected between groups, lower apoptosis levels were observed in the induced NT group. In conclusion, miR-34c expression induced by dox treatment enhances the developmental potential of SCNT embryos, modifies the epigenetic status, and changes blastocyst quality.

Expression profile of genes as indicators of developmental competence and quality of in vitro fertilization and somatic cell nuclear transfer bovine embryos.

Reproductive biotechnologies such as in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT) enable improved reproductive efficiency of animals. However, the birth rate of in vitro-derived embryos still lags behind that of their in vivo counterparts. Thus, it is critical to develop an accurate evaluation and prediction system of embryo competence, both for commercial purposes and for scientific research. Previous works have demonstrated that in vitro culture systems induce alterations in the relative abundance (RA) of diverse transcripts and thus compromise embryo quality. The aim of this work was to analyze the RA of a set of genes involved in cellular stress (heat shock protein 70-kDa, HSP70), endoplasmic reticulum (ER) stress (immunoglobulin heavy chain binding protein, Bip; proteasome subunit β5, PSMB5) and apoptosis (BCL-2 associated X protein, Bax; cysteine aspartate protease-3, Caspase-3) in bovine blastocysts produced by IVF or SCNT and compare it with that of their in vivo counterparts. Poly (A) + mRNA was isolated from three pools of 10 blastocysts per treatment and analyzed by real-time RT-PCR. The RA of three of the stress indicators analyzed (Bax, PSMB5 and Bip) was significantly increased in SCNT embryos as compared with that of in vivo-derived blastocysts. No significant differences were found in the RA of HSP70 and Caspase-3 gene transcripts. This study could potentially complement morphological analyses in the development of an effective and accurate technique for the diagnosis of embryo quality, ultimately aiding to improve the efficiency of assisted reproductive techniques (ART).

Pregnancy of bovine somatic cell nuclear transfer embryos reconstructed by using donor cells: iPS cell vs AID transfected cell*

bryos reconstructed by using donor cells: iPS cell vs. AID transfected cell* Tae Suk Kim1, Sang Ki Baek2, Song Yi Moon2, Sang Jin Jin2, Yeoung-Gyu Ko3, Sung Woo Kim3, Hae-Geum Park3, Hwan-Hoo Seong3 and Joon Hee Lee2 1Institute of Agriculture & Life Science, College of Agriculture and Life Sciences, Gyeongsang National University, Jinju, 660-701, Republic of Korea, Jin ju, Republic of Korea 2Animal Development & Biotechnology Group, Department of Animal Bioscience, College of Agriculture & Life Sciences, Gyeongsang National University, Jin ju, Republic of Korea 3National Institute of Animal Science, Rural Development Administration, Namwon, Republic of Korea

Effects of 3-hydroxyflavone on the cellular and molecular characteristics of bovine embryos produced by somatic-cell nuclear transfer

This study aimed to investigate the effects of 3-hydroxyflavone, a natural antioxidant pigment enriched in vegetables, on the developmental cellular and molecular characteristics of bovine somatic-cell nuclear transfer (SCNT) embryos. There were no significant differences in the cleavage rate at 48 hr of culture or in the inner cell mass (ICM)-to-trophectoderm (TE) ratio between 3-hydroxyflavone addition and untreated (control) groups (P > 0.05). 3-hydroxyflavone (20 µM) did, however, increase the cleavage rate at 24 hr of culture and the blastocyst-formation rate on Days 6 and 7 (P < 0.05); decrease the levels of intracellular reactive oxygen species in two-, four-, and eight-cell stage embryos (P < 0.05); increase H3K9ac levels in two- and four-cell stages (P < 0.05); increase the total cell number; and decrease the apoptosis index in Day-7 blastocysts. Furthermore, the addition of 3-hydroxyflavone resulted in lower expression of the stress-related gene HSP70.1 and pro-apoptotic gene BAX, as well as higher expression of the anti-apoptotic gene BCL-xL and pluripotency-related genes OCT4 and SOX2 in Day-7 blastocysts produced by SCNT (P < 0.05). The addition of 3-hydroxyflavone during in vitro culture thus exerted beneficial effects on preimplantation development of bovine SCNT embryos both at the cellular and molecular levels.

Valproic acid enhances early development of bovine somatic cell nuclear transfer embryos by alleviating endoplasmic reticulum stress

Despite the positive roles of histone deacetylase inhibitors in somatic cell nuclear transfer (SCNT), few studies have evaluated valproic acid (VPA) and its associated developmental events. Thus, the present study was conducted to elucidate the effect of VPA on the early development of bovine SCNT embryos and the underlying mechanisms of action. The histone acetylation level of SCNT embryos was successfully restored by VPA, with optimal results obtained by treatment with 3mM VPA for 24h. Importantly, the increases in blastocyst formation rate and inner cell mass and trophectoderm cell numbers were not different between the VPA and trichostatin A treatment groups, whereas cell survival was notably improved by VPA, indicating the improvement of developmental competence of SCNT embryos by VPA. Interestingly, VPA markedly reduced the transcript levels of endoplasmic reticulum (ER) stress markers, including sXBP-1 and CHOP. In contrast, the levels of GRP78/BiP, an ER stress-alleviating transcript, were significantly increased by VPA. Furthermore, VPA greatly reduced cell apoptosis in SCNT blastocysts, which was further evidenced by the increased levels of the anti-apoptotic transcript Bcl-xL and decreased level of the pro-apoptotic transcript Bax. Collectively, these results suggest that VPA enhances the developmental competence of bovine SCNT embryos by alleviating ER stress and its associated developmental damage.

Effect of the Time Interval Between Fusion and Activation on Epigenetic Reprogramming and Development of Bovine Somatic Cell Nuclear Transfer Embryos

Previous studies have shown that the time interval between fusion and activation (FA interval) play an important role in nuclear remodeling and in vitro development of somatic cell nuclear transfer (SCNT) embryos. However, the effects of FA interval on the epigenetic reprogramming and in vivo developmental competence of SCNT embryos remain unknown. In the present study, the effects of different FA intervals (0 h, 2 h, and 4 h) on the epigenetic reprogramming and developmental competence of bovine SCNT embryos were assessed. The results demonstrated that H3 lysine 9 (H3K9ac) levels decreased rapidly after fusion in all three groups. H3K9ac was practically undetectable 2 h after fusion in the 2-h and 4-h FA interval groups. However, H3K9ac was still evidently detectable in the 0-h FA interval group. The H3K9ac levels increased 10 h after fusion in all three groups, but were higher in the 2-h and 4-h FA interval groups than that in the 0-h FA interval group. The methylation levels of the satellite I region in day-7 blastocysts derived from the 2-h or 4-h FA interval groups was similar to that of in vitro fertilization blastocysts and is significantly lower than that of the 0-h FA interval group. SCNT embryos derived from 2-h FA interval group showed higher developmental competence than those from the 0-h and 4-h FA interval groups in terms of cleavage rate, blastocyst formation rate, apoptosis index, and pregnancy and calving rates. Hence, the FA interval is an important factor influencing the epigenetic reprogramming and developmental competence of bovine SCNT embryos.

54 EXPRESSION PATTERN OF DNMT1 AND DNMT3a GENES DURING INTERGENERIC SOMATIC CELL NUCLEAR TRANSFER EMBRYO DEVELOPMENT

One of the most-discussed reasons for developmental incompetence of embryos constructed by the cloning procedure is inadequate reprogramming of the transferred nucleus to a state equivalent to that of an early embryonic nucleus. Previous studies have shown species-dependent expression patterns of DNA methyltransferase (DNMT) genes in mammalian oocytes and preimplantation embryos, and also a correlation between incomplete DNA methylation and the lack of NT success in mammals. In the present study, the expression pattern of DNMT1 and DNTM3a genes at the 2-cell and 4-cell stages of bovine versus porcine intergeneric nuclear transfer (iSCNT) embryos was observed by reverse-transcriptase (RT) PCR. All pools were done in triplicate and contained 10 iSCNT embryos. The species-specific primers for DNMT1 and DNMT3a genes were designed for determination of de novo synthesis of epigenetic enzymes. As positive controls, porcine and bovine parthenogenetic embryos were used. Gene transcription for bovine DNMT1 (bDNMT1) and DNMT3a (bDNMT3a) was not observed in 2- and 4-cell stage embryos generated by bovine fibroblast transfer into the porcine ooplasm; however, using primers for pig DNMT1 (pDNMT1) and DNMT3a (pDNMT3a), positive results were obtained. In the 2- and 4-cell-stage embryos constructed using porcine fibroblast and bovine ooplasm, only the bovine-specific primers showed positive signals. Based on the different timing of major genome activation during embryonic development in bovine and porcine embryos, the strong influence of ooplasm on introduced fibroblast was expected. Despite the mRNA presence of DNMT1 and DNMT3a enzymes of oocyte origin, de novo transcription of somatic DNMT1 and DNMT3a genes was not detected and iSCNT embryos did not develop beyond the 4-cell stage. These results strongly suggest species-specific and maternally driven regulation of epigenetic reprogramming during early embryogenesis. This work was supported by VEGA 1/0077/11.

Donor Cells at the G1 Phase Enhance Homogeneous Gene Expression Among Blastomeres in Bovine Somatic Cell Nuclear Transfer Embryos

The success rate of bovine somatic cell nuclear transfer (SCNT) embryos to full term has been reported to be higher with G1 cells than with G0 cells. To better understand the reason for this, we analyzed the kinetics of luminescence activity in bovine SCNT embryos from G0 and G1 cells carrying a luciferase gene under the control of the β-actin promoter during early embryonic development. At 60-h postfusion, when bovine embryonic gene activation (EGA) begins, the luminescence activity was higher in G1-SCNT embryos than G0-SCNT embryos. Moreover, half of the G1-SCNT embryos exhibited homogeneous luminescence among the blastomeres, whereas more than half of the G0-SCNT embryos exhibited mosaic luminescence. To characterize the differential luminescence pattern in SCNT embryos, the expressions of several endogenous genes and the level of DNA methylation were determined in all blastomeres of SCNT embryos with or without luminescence. The expressions of several development-related genes (H2AFZ, GJA1, and BAX) and level of DNA methylation of the SCNT embryos with luminescence were the same as those of normal embryos produced by in vitro fertilization. A higher success rate in G1-SCNT embryos is thought to contribute to homogeneous expression among all blastomeres at EGA.

59 HISTONE DEACETYLASE 1 KNOCK-DOWN IN BOVINE FIBROBLAST CELLS AND CLONED EMBRYOS

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P &lt; 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P &gt; 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P &lt; 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

Developmental rates of bovine nuclear transfer embryos derived from different fetal non transfected and transfected cells

Since the first successful somatic cell nuclear transfer (SCNT) experiments were carried out, a number of domestic and agriculture species have been cloned using donor cells derived from different sources and origin. However, differences in nuclear transfer (NT) efficiency both in vitro and in vivo have been generally observed. These differences may be accentuated when transgenic cell lines are used as nuclear donors in an attempt to generate transgenic cloned offspring. The present study examined the suitability of cell lines derived from 3 different fetal sources and the effects of genetic manipulation of donor fetal fibroblasts with a red fluorescent plasmid, on the in vitro developmental potential and quality of NT derived bovine embryos. We observed no differences in the cleavage rate of cloned embryos generated with any of the cell lines evaluated. However, the blastocyst rate was significantly affected when cell lines were derived from the 3 different fetal sources (21, 18 and 11%, respectively) or from 2 transgenic clonal cell lines that had originated from the same primary fetal cell (18 and 10%, respectively). Despite this difference, quality of embryos as measured by the total number of cells and by assessing some morphology aspects of their appearance was not different. Together these results indicate that fetal fibroblast cell lines derived from different fetal sources and transgenic clonal cell lines that had originated from the same fetus results in different in vitro developmental potential when used as donors for NT experiments. Further studies, including evaluation of pregnancy rates, development to term, and epigenetic modifications of these cell lines will be necessary to better understand the differences observed in NT efficiency.