Bovine Aortic Smooth Muscle Cells Research Articles

Biosynthesis of Gold Nanoparticles by Vascular Cells in vitro.

Biosynthesis of gold nanoparticles (AuNPs) for antimicrobial and chemotherapeutic applications is a well-established process in microbial hosts such as bacterial, fungi, and plants. However, reports on AuNPs biosynthesis in mammalian cells are scarce. In this study, bovine aortic endothelial cells (BAECs) and bovine aortic smooth muscle cells (BASMCs) were examined for their ability to synthesize AuNPs in vitro. Cell culture conditions such as buffer selection, serum concentration, and HAuCl4 concentration were optimized before the biosynthesized AuNPs were characterized through visible spectrometry, transmission electron microscopy, X-ray diffraction, and Fourier transform infrared (FTIR) spectroscopy. BAECs and BASMC produced small, spherical AuNPs that are semi-crystalline with a similar diameter (23 ± 2 nm and 23 ± 4 nm). Hydrogen peroxide pretreatment increased AuNPs synthesis, suggesting that antioxidant enzymes may reduce Au3+ ions as seen in microbial cells. However, buthionine sulfoximine inhibition of glutathione synthesis, a key regulator of oxidative stress, failed to affect AuNPs generation. Taken together, these results show that under the right synthesis conditions, non-tumor cell lines can produce detectable concentrations of AuNPs in vitro.

Efficient isolation and identification of primary endothelial cells from bovine aorta by collagenase P

Introduction: Endothelial cells are widely used among researchers for investigation of cardiovascular diseases, particularly atherosclerosis. Since aortic endothelial cells are able to be cultured in high passages, these cells are suitable for physiological and pathological studies of blood vessels. Objectives: The aim of this study was employing a digestion method to isolate the endothelial cells from bovine aorta by utilizing collagenase P and, establishing and characterizing isolated primary endothelial cells (IPECs) cultures. Materials and Methods: IPECs were isolated from fresh bovine aorta via enzymatic digestion method using collagenase P. Cell morphology and its functions were assessed by measuring the gene expression of endothelial nitric-oxide synthase (eNOS) and endothelin-1. In order to validate them as IPECs, they were compared with bovine aortic endothelial cells (BAECs) and vascular smooth muscle cells (VSMCs). Effects of synthetic endothelin-1 (100 nm) were assessed on the phosphorylation of Smad2 transcription factor via western blotting in IPECs for periods of one to four hours. Results: In this study, the morphology of IPECs from bovine aorta was identical to that of the BAECs. The gene expressions of endothelin-1 and eNOS were higher than those of BAECs and VSMCs. In addition, synthetic endothelin-1 resulted in the time-dependent boost of phosphorylation of carboxy-terminal Smad2 in the IPECs for periods of two and four hours. Conclusion: The results of this study confirm the efficacy of the enzymatic digestion method in isolating a large number of endothelial cells with morphological and functional characteristics.

Muscle tissue engineering in fibrous gelatin: implications for meat analogs

Bioprocessing applications that derive meat products from animal cell cultures require food-safe culture substrates that support volumetric expansion and maturation of adherent muscle cells. Here we demonstrate scalable production of microfibrous gelatin that supports cultured adherent muscle cells derived from cow and rabbit. As gelatin is a natural component of meat, resulting from collagen denaturation during processing and cooking, our extruded gelatin microfibers recapitulated structural and biochemical features of natural muscle tissues. Using immersion rotary jet spinning, a dry-jet wet-spinning process, we produced gelatin fibers at high rates (~ 100 g/h, dry weight) and, depending on process conditions, we tuned fiber diameters between ~ 1.3 ± 0.1 μm (mean ± SEM) and 8.7 ± 1.4 μm (mean ± SEM), which are comparable to natural collagen fibers. To inhibit fiber degradation during cell culture, we crosslinked them either chemically or by co-spinning gelatin with a microbial crosslinking enzyme. To produce meat analogs, we cultured bovine aortic smooth muscle cells and rabbit skeletal muscle myoblasts in gelatin fiber scaffolds, then used immunohistochemical staining to verify that both cell types attached to gelatin fibers and proliferated in scaffold volumes. Short-length gelatin fibers promoted cell aggregation, whereas long fibers promoted aligned muscle tissue formation. Histology, scanning electron microscopy, and mechanical testing demonstrated that cultured muscle lacked the mature contractile architecture observed in natural muscle but recapitulated some of the structural and mechanical features measured in meat products.

PSIX-42 Inactivation of gene α-1,3-galactosyltransferase in bovine aortic smooth muscle cells using CRISPR-Cas9.

PSIX-42 Inactivation of gene α-1,3-galactosyltransferase in bovine aortic smooth muscle cells using CRISPR-Cas9.

Micropatterned cell sheets as structural building blocks for biomimetic vascular patches

To successfully develop a functional tissue-engineered vascular patch, recapitulating the hierarchical structure of vessel is critical to mimic mechanical properties. Here, we use a cell sheet engineering strategy with micropatterning technique to control structural organization of bovine aortic vascular smooth muscle cell (VSMC) sheets. Actin filament staining and image analysis showed clear cellular alignment of VSMC sheets cultured on patterned substrates. Viability of harvested VSMC sheets was confirmed by Live/Dead® cell viability assay after 24 and 48 h of transfer. VSMC sheets stacked to generate bilayer VSMC patches exhibited strong inter-layer bonding as shown by lap shear test. Uniaxial tensile testing of monolayer VSMC sheets and bilayer VSMC patches displayed nonlinear, anisotropic stress-stretch response similar to the biomechanical characteristic of a native arterial wall. Collagen content and structure were characterized to determine the effects of patterning and stacking on extracellular matrix of VSMC sheets. Using finite-element modeling to simulate uniaxial tensile testing of bilayer VSMC patches, we found the stress-stretch response of bilayer patterned VSMC patches under uniaxial tension to be predicted using an anisotropic hyperelastic constitutive model. Thus, our cell sheet harvesting system combined with biomechanical modeling is a promising approach to generate building blocks for tissue-engineered vascular patches with structure and mechanical behavior mimicking native tissue.

Inactivation of Gene α‐1,3‐Galactosyltransferase in Bovine Aortic Smooth Muscle Cells Using CRISPR‐Cas9

People who get bites from Amblyomma americanum usually develop a severe allergic reaction to red meat. The main reason caused this allergy is because of the presence of α‐1,3‐galactosyl epitopes on the membranes of most mammalian cells. Since human beings do not create galactose‐alpha‐1,3‐galactose (alpha‐gal), the patients' immune system is free to start attacking alpha‐gal when they eat red meat. The epitope transferase coded geneα‐1,3‐galactosyltransferase (GGTA1) was already identified, and it can be knocked out to solve the allergy of eating red meat. GGTA1 gene has successfully knocked out in pigs. However, there is no evidence to show the GGTA1 gene has been knocked out in beef. In this study, we utilized bovine aortic smooth muscle cells (BAOSMC) as the module for the research of GGTA1 gene knockout.The clustered regularly interspaced short palindromic repeats (CRISPR) systems are widely used in performing targeted genome editing in cultured cells. The use of CRISPR‐associated (Cas) systems as an RNA‐programmable DNA targeting and editing platform is followed by a synthetic single‐guide RNA (sgRNA), which can simply edit genome sequences like other tools such as transcription activator‐like effector nucleases (TALENs) and zinc‐finger nucleases (ZFNs).We used the gRNA design tool and selected 5′‐GGCCTGACGGTTTTCGCCGT‐3′ as the target gRNA sequence from the coding DNA sequence of Bos taurus alpha‐galactosyltransferase 1 (glycoprotein). The gRNA was constructed in the pSpCas9 BB‐2A‐GFP (PX458) vector provided by GenScript USA Inc. Vectors were amplified and transfected into BAOSMC by GenePORTER2 transfection reagent when the cells were 80% confluency. Green fluorescent can be viewed after 24 hours transfection (Fig. 1). The transfection efficiency can reach about 70% to 80%.Cells were collected in PBS at pH7.4 after 24 hours transfection. Total protein was extracted then the enzyme‐linked immunosorbent assay was used to examine the GGTA1 production. By normalized with the total protein concentration, the GGTA1 protein level in the transfected cells was 17.9 ± 7.25% lower (P< 0.05) than in the control cells, showing a significant inhibition of GGTA1 gene expression in the cells by CRISPR‐Cas9 gene edition method (Fig. 2).Our data show that the gRNA sequence that we chose was suitable for the GGTA1 gene knockout in BAOSMC. Moreover, the CRISPR‐Cas9 system was proved can be applied in the genome editing of bovine cells.Support or Funding InformationThis study is funded by Arkansas Beef Council.This abstract is from the Experimental Biology 2018 Meeting. There is no full text article associated with this abstract published in The FASEB Journal.

Cellular dynamics of bovine aortic smooth muscle cells measured using MEMS force sensors

Adhesive cells perceive the mechanical properties of the substrates to which they adhere, adjusting their cellular mechanical forces according to their biological characteristics. This mechanical interaction subsequently affects the growth, locomotion, and differentiation of the cell. However, little is known about the detailed mechanism that underlies this interaction between adherent cells and substrates because dynamically measuring mechanical phenomena is difficult. Here, we utilize microelectromechamical systems force sensors that can measure cellular traction forces with high temporal resolution (~2.5 µs) over long periods (~3 h). We found that the cellular dynamics reflected physical phenomena with time scales from milliseconds to hours, which contradicts the idea that cellular motion is slow. A single focal adhesion (FA) generates an average force of 7 nN, which disappears in ms via the action of trypsin-ethylenediaminetetraacetic acid. The force-changing rate obtained from our measurements suggests that the time required for an FA to decompose was nearly proportional to the force acting on the FA.

Vertically Aligned Carbon Nanofibers as a Cell Impedance Sensor

The paper reports a biological cell impedance sensing system based on vertically aligned carbon nanofibers (VACNF). VACNFs having an average length of 4.45 μm are deterministically grown on transparent quartz substrates and are examined using SEM. The real-time impedance of Bovine Aortic Smooth Muscle Cells (BAOSMC) cultured on the VACNF array is measured and a net change in impedance is observed which indicates cell adherence on the VACNF surface.

Rigid two-axis MEMS force plate for measuring cellular traction force

Cellular traction force is one of the important factors for understanding cell behaviors, such as spreading, migration and differentiation. Cells are known to change their behavior according to the mechanical stiffness of the environment. However, the measurement of cell traction forces on a rigid environment has remained difficult. This paper reports a micro-electromechanical systems (MEMS) force plate that provides a cellular traction force measurement on a rigid substrate. Both the high force sensitivity and high stiffness of the substrate were obtained using piezoresistive sensing elements. The proposed force plate consists of a 70 µm × 15 µm × 5 µm base as the substrate for cultivating a bovine aortic smooth muscle cell, and the supporting beams with piezoresistors on the sidewall and the surface were used to measure the forces in both the horizontal and vertical directions. The spring constant and force resolution of the fabricated force plate in the horizontal direction were 0.2 N m−1 and less than 0.05 µN, respectively. The cell traction force was measured, and the traction force increased by approximately 1 µN over 30 min. These results demonstrate that the proposed force plate is applicable as an effective traction force measurement.

214 Glycated LDL (glyc-LDL) Promotes Osteogenic Differentiation of Vascular Smooth Muscle Cells

Introduction It is well established that glyc-LDL is elevated in the serum of diabetic patients compared to healthy subjects, and that vascular calcification is common in diabetes. Furthermore, recent studies suggest that advanced glycation end products may play a pathogenic role in vascular calcification. We hypothesise that glyc-LDL promotes the osteogenic differentiation of vascular smooth muscle cells in vitro . Methods LDL was isolated from human serum by sequential density gradient ultracentrifugation and incubated at 37°C with a range of glucose concentrations at different time points to determine the optimum glycation conditions. The glyc-LDL was measured using an in-house ELISA method. Bovine Aortic Smooth Muscle Cells (BAoSMCs) were incubated with native or glycated LDL in the presence of osteogenic media and mineral deposition was determined using alizarin red staining and alkaline phosphatase (ALP) activity, which is an early marker of osteogenesis. Results The optimum conditions for LDL glycation was determined as 80mM glucose for 7 days, so these conditions were used for the production of glycated LDL throughout the study. BAoSMCs incubated in osteogenic media exhibited mineralisation after 7 days as determined by alizarin red staining. This calcification was significantly enhanced by treatment with glyc-LDL, but not by native LDL. Furthermore, we found that ALP activity was significantly elevated as early as day 4 in glyc-LDL treated cells, compared to those incubated in native LDL. The glyc-LDL-induced mineralisation was not attenuated in the presence of osteoprotegrin (OPG) nor in the presence of two novel small RAGE antagonist peptides, which were designed to prevent RAGE binding with several of its most important ligands, including HMGB-1, S100P and S1004A. Conclusion We have shown that human-derived glyc-LDL accelerates vascular calcification in vitro . This process does not appear to be attenuated by the addition of OPG, suggesting AGE-induced accelerated calcification occurs through a pathway independent of the RANKL/OPG signalling activity. Further studies with a range of RAGE inhibitors should allow the identification of the molecular pathways implicated in glyc-LDL induced calcification to enable the development of therapeutic peptides effective in blocking of RAGE-ligand interaction, which is prevalent in many pathologies.

Heparan sulfate chains potentiate cadmium cytotoxicity in cultured vascular endothelial cells.

The monolayer of vascular endothelial cells, which is rich in heparan sulfate chains, is an important target of cadmium cytotoxicity. To investigate the effects of heparan sulfate chains on cadmium cytotoxicity, bovine aortic endothelial cells were cultured in the presence of cadmium, with or without exogenous heparan sulfate. The following results were obtained: (1) Heparan sulfate chains potentiated cadmium cytotoxicity. (2) Such a potentiation did not occur in bovine aortic smooth muscle cells. (3) Heparin chains as well as heparan sulfate chains potentiated cadmium cytotoxicity, while other glycosaminoglycan chains failed to exhibit such an activity. (4) The disaccharide units of heparan sulfate chains did not potentiate cadmium cytotoxicity in the endothelial cells. (5) Heparan sulfate chains did not potentiate mercury and arsenite cytotoxicity. (6) Fibroblast growth factor-2 (FGF-2) also potentiated cadmium cytotoxicity in the endothelial cells. (7) Heparan sulfate chains significantly increased intracellular cadmium accumulation by inducing the expression of metallothionein. Taken together, these results suggest that heparan sulfate chains activate FGF-2, which in turn elevates the expression and/or activity of metal transporter(s) that facilitate cadmium influx from the extracellular space into the cytoplasm.

Chlamydia pneumoniae infection of lungs and macrophages indirectly stimulates the phenotypic conversion of smooth muscle cells and mesenchymal stem cells: potential roles in vascular calcification and fibrosis.

Two hallmarks of advanced atherosclerosis are calcification and fibrosis. We hypothesized that Chlamydia pneumoniae infection may contribute to atherosclerosis by inducing the conversion of vascular smooth muscle cells to calcifying cells or by converting mesenchymal stem cells to osteochondrocytic or fibroblastic phenotypes. In this study, direct infection of bovine aortic smooth muscle cells (BSMCs) did not induce the expression of alkaline phosphatase or the deposition of extracellular calcium phosphate. However, conditioned media from C.pneumoniae-infected macrophages accelerated conversion of BSMCs to a calcifying phenotype. Treatment of the conditioned media with an anti-TNF-alpha blocking antibody abrogated this stimulatory effect. Treatment of perivascular Sca-1+, CD31-, CD45- cells from apoE-/- mouse aortas with the conditioned media from infected macrophages induced the Sca-1+ cells to produce collagen II, an additional marker of an osteochondrocytic phenotype. Treatment of mouse coronary perivascular Sca-1+, CD31-, CD45- cells with the supernatant from homogenates of C.pneumoniae-infected mouse lungs as compared to noninfected lungs induced expression of the Collagen 1α1 gene and deposition of collagen. Therefore, an increase in plasma cytokines or other factors in response to respiratory infection with C.pneumoniae or infection of macrophages within the blood vessel could contribute to both calcification and fibrosis of advanced atherosclerotic lesions.

Hydraulic Conductivity of Endothelial Cell-Initiated Arterial Cocultures

This study describes cocultures of arterial smooth muscle cells (SMCs) and endothelial cells (ECs) and the influences of their heterotypic interactions on hydraulic conductivity (L p ), an important transport property. A unique feature of these cocultures is that ECs were first grown to confluence and then SMCs were inoculated. Bovine aortic smooth muscle cells and bovine aortic endothelial cells (BAECs) were cocultured on Transwell Permeable Supports, and then exposed to a pressure-driven transmural flow. L p across each culture was measured using a bubble tracking apparatus that determined water flux (J v ). Our results indicate that arterial L p is significantly modulated by EC-SMC proximity, and serum content in culture. The L p of cocultures was also compared to the predictions of a resistances-in-series model to distinguish the contributions of heterotypic interactions between SMCs and ECs. Conditions that lead to significantly reduced coculture L p , compared to BAEC monoculture controls, have been uncovered and the lowest L p in the literature for an in vitro system are reported. In addition, VE-cadherin immunostaining of intact BAEC monolayers in each culture configuration reveals that EC-SMC proximity on a porous membrane has a dramatic influence on EC morphology patterns. The cocultures with the lowest L p have ECs with significantly elongated morphology. Confocal imaging indicates that there are no direct EC-SMC contacts in coculture.

Development of vascular smooth muscle contractility by endothelium-derived transforming growth factor β proteins

It is well established that the release of vasodilators and vasoconstrictors from vascular endothelium regulates vascular smooth muscle contraction. In this report, we investigate the role of the endothelium in the development and maintenance of constitutive vascular contractility. For that purpose, contractile activity of cultured bovine aortic smooth muscle cells (BASMCs) embedded in collagen gels was monitored by changes in gel diameter. After culturing for 5days, ATP- and high KCl solution-induced contractions were significantly enhanced in the gels that were overlaid with bovine aortic endothelial cells (BAECs) or were cultured with conditioned medium of cultured BAECs. ATP-induced Ca(2+) transients, recorded in BASMCs cultured with conditioned medium of BAECs, were markedly augmented, but high KCl-induced Ca(2+) transients were not affected. BASMCs in control gels were spindle shaped, and those in endothelium-treated gels were more elongated and interconnected. The endothelial conditioned medium also strongly affected the intracellular distribution of actin fibers. Conditioned medium of BAECs contained TGFβ1 and TGFβ2. The TGFβ receptor antagonist SB431542 as well as simultaneous treatment with TGFβ1 and TGFβ2 neutralizing antibodies completely reversed the above effects of endothelial conditioned medium on BASMCs. BAECs medium induced phosphorylation of Smad2 and increased ATP-induced phosphorylation of myosin light chain in BASMCs. The present results indicate that the release of TGFβ1 and TGFβ2 from vascular endothelium affects the contractility of vascular smooth muscle cells by altering their morphology and agonist-induced Ca(2+) mobilization.

Leptin promotes osteoblast differentiation and mineralization of primary cultures of vascular smooth muscle cells by inhibiting glycogen synthase kinase (GSK)-3β

In this study, we begin to investigate the underlying mechanism of leptin-induced vascular calcification. We found that treatment of cultured bovine aortic smooth muscle cells (BASMCs) with leptin (0.5–4μg/ml) induced osteoblast differentiation in a dose-dependent manner. Furthermore, we found that leptin significantly increased the mRNA expression of osteopontin and bone sialoprotein, while down-regulating matrix gla protein (MGP) expression in BASMCs. Key factors implicated in osteoblast differentiation, including members of the Wnt signaling pathway, were examined. Exposure to leptin enhanced phosphorylation of GSK-3β on serine-9 thereby inhibiting activity and promoting the nuclear accumulation of β-catenin. Transfection of BASMCs with an adenovirus that expressed constitutively active GSK-3β (Ad-GSK-3β S9A) resulted in a >2-fold increase in GSK-3β activity and a significant decrease in leptin-induced alkaline phosphatase (ALP) activity. In addition, qRT-PCR analysis showed that GSK-3β activation resulted in a significant decrease in the expression of osteopontin and bone sialoprotein, but a marked increase in MGP mRNA expression. When taken together, our results suggest a mechanism by which leptin promotes osteoblast differentiation and vascular calcification in vivo.

Abstract 300: Leptin Promotes the Osteoblast Differentiation and Mineralization of Primary Cultures of Vascular Smooth Muscle Cells by Regulating GSK-3β

Obesity is an independent risk factor for cardiovascular disease (CVD) although the precise molecular mechanisms that link obesity to CVD are not understood. Recent studies suggest that factors secreted by adipose tissue may play an adverse role in cardiovascular health. We have previously demonstrated that the adipocytokine, leptin, promotes vascular calcification in apolipoprotein E - deficient mice and that this increase in calcification is associated with an increase in the expression of several osteoblast-specific markers within the vessel wall. In an effort to understand the mechanism by which leptin exerts these effects, we cultured primary bovine aortic smooth muscle cells (BASMCs) in the presence of 0 to 2 μg/ml leptin for up to 12 days. Osteogenic differentiation of BASMCs was determined by an increase in the expression of osteoblast-specific markers, and the induction of both alkaline phosphatase activity and mineralization. Consistent with previous studies, we found that treatment of BASMCs with leptin induced osteoblast differentiation in a dose-dependent manner. To investigate the underlying mechanism, we examined changes in the expression levels of key factors implicated in osteoblast differentiation, including members of the Wnt signaling pathway. We found that exposure to leptin induced the Erk 1/2-dependent inactivation of GSK-3β, through Ser9 phosphorylation, and a subsequent increase in the nuclear accumulation of β-catenin. Transfection of BASMCs with an adenovirus that expressed constitutively active GSK-3β (Ad-GSK-3β S9A) resulted in a > 2-fold increase in GSK-3β activity, a decrease in the expression of the osteoblast-specific marker, osteopontin, and a significant decrease in leptin-induced alkaline phosphatase activity. Together, our results provide a possible mechanism by which elevated leptin concentrations, associated with obesity, promote osteoblast differentiation, and vascular calcification in vivo.

Micropatterned cell sheets with defined cell and extracellular matrix orientation exhibit anisotropic mechanical properties

For an arterial replacement graft to be effective, it must possess the appropriate strength in order to withstand long-term hemodynamic stress without failure, yet be compliant enough that the mismatch between the stiffness of the graft and the native vessel wall is minimized. The native vessel wall is a structurally complex tissue characterized by circumferentially oriented collagen fibers/cells and lamellar elastin. Besides the biochemical composition, the functional properties of the wall, including stiffness, depend critically on the structural organization. Therefore, it will be crucial to develop methods of producing tissues with defined structures in order to more closely mimic the properties of a native vessel. To this end, we sought to generate cell sheets that have specific ECM/cell organization using micropatterned polydimethylsiloxane (PDMS) substrates to guide cell organization and tissue growth. The patterns consisted of large arrays of alternating grooves and ridges. Adult bovine aortic smooth muscle cells cultured on these substrates in the presence of ascorbic acid produced ECM-rich sheets several cell layers thick in which both the cells and ECM exhibited strong alignment in the direction of the micropattern. Moreover, mechanical testing revealed that the sheets exhibited mechanical anisotropy similar to that of native vessels with both the stiffness and strength being significantly larger in the direction of alignment, demonstrating that the microscale control of ECM organization results in functional changes in macroscale material behavior.

Mitochondrial reactive oxygen species promote p65 nuclear translocation mediating high-phosphate-induced vascular calcification in vitro and in vivo

Hyperphosphatemia is the major risk factor associated with vascular calcification (VC) in end-stage renal disease. As oxidative stress is increased in uremia, we studied the role of mitochondrial reactive oxygen species (ROS) and nuclear factor-κB signaling in phosphate-induced VC. In an in vitro calcification model (β-glycerophosphate (BGP) induction) using bovine aortic smooth muscle cells, the production of intracellular and mitochondrial ROS, or superoxide anion, was stimulated by increased mitochondrial membrane potential. This effect was blocked by the superoxide dismutase (SOD) mimic MnTMPyP, a respiratory chain inhibitor rotenone, or a protonophore. Calcium deposition and the switch of smooth muscle cells from a contractile to an osteogenic phenotype were decreased when mitochondrial ROS generation was inhibited by the respiratory chain inhibitor, MnTMPyP, or the overexpression of SOD1 and SOD2 and uncoupling protein 2. The phosphorylation of IkKβ, IκBα degradation, and p65 nuclear translocation were increased by BGP but reversed when mitochondrial ROS production was blocked by protonophore or MnTMPyP. Knockdown of endogenous p65 or overexpression of IκBα reduced calcium deposition in the cultured cells. Furthermore, in a rat model of dietary adenine-induced chronic renal failure, MnTMPyP reduced aortic ROS levels, p65 activation, and calcium deposition. Thus, mitochondrial ROS-mediated p65 nuclear translocation is involved in phosphate-induced VC.

Oxidized low‐density lipoprotein promotes osteoblast differentiation in primary cultures of vascular smooth muscle cells by up‐regulating Osterix expression in an Msx2‐dependent manner

We have previously shown that oxidized low-density lipoproteins (oxLDLs) act synergistically with β-glycerophosphate to induce the osteogenic differentiation of primary bovine aortic smooth muscle cells (BASMCs). In the present study, we attempt to resolve the mechanism responsible for this effect by examining the expression of several osteoblast-specific transcription factors. Thus, by culturing BASMCs in the absence or presence of β-glycerophosphate and/or oxLDL, we demonstrate that β-glycerophosphate induces both Runx2 and Osterix (Osx) expression. In contrast, oxLDL has no effect on Runx2 expression but rather it enhances β-glycerophosphate-induced osteoblast differentiation by further up-regulating Osx expression. In an attempt to elucidate the mechanism responsible for this latter effect, we examined the ability of oxLDL to affect Msh homeobox 2 (Msx2) expression. Similar to its effect on Osx expression, oxLDL was found to synergistically enhance β-glycerophosphate-induced Msx2 expression in an extracellular signal-regulated kinase 1 and 2 (Erk 1 and 2)-dependent manner. Furthermore, oxLDL's ability to enhance both β-glycerophosphate-induced Osx expression and alkaline phosphatase activity was prevented when the BASMCs were first transfected with Msx2-specific siRNA. Taken together, these findings suggest a plausible mechanism by which oxLDL may promote osteoblast differentiation and vascular calcification in vivo.

Co-Electrospun Blends of PLGA, Gelatin, and Elastin as Potential Nonthrombogenic Scaffolds for Vascular Tissue Engineering

In search for novel biomimetic scaffolds for application in vascular tissue engineering, we evaluated a series of fibrous scaffolds prepared by coelectrospinning tertiary blends of poly(lactide-co-glycolide) (PLGA), gelatin, and elastin (PGE). By systematically varying the ratios of PLGA and gelatin, we could fine-tune fiber size and swelling upon hydration as well as the mechanical properties of the scaffolds. Of all PGE blends tested, PGE321 (PLGA, gelatin, elastin v/v/v ratios of 3:2:1) produced the smallest fiber size (317 ± 46 nm, 446 ± 69 nm once hydrated) and exhibited the highest Young's modulus (770 ± 131 kPa) and tensile strength (130 ± 7 kPa). All PGE scaffolds supported the attachment and metabolization of human endothelial cells (ECs) and bovine aortic smooth muscle cells (SMCs) with some variances in EC morphology and cytoskeletal spreading observed at 48 h postseeding, whereas no morphologic differences were observed at confluence (day 8). The rate of metabolization of ECs, but not of SMCs, was lower than that on tissue culture plastic and depended on the specific PGE composition. Importantly, PGE scaffolds were capable of guiding the organotypic distribution of ECs and SMCs on and within the scaffolds, respectively. Moreover, the EC monolayer generated on the PGE scaffold surface was nonthrombogenic and functional, as assessed by the basal and cytokine-inducible levels of mRNA expression and amidolytic activity of tissue factor, a key player in the extrinsic clotting cascade. Taken together, our data indicate the potential application of PGE scaffolds in vascular tissue engineering.