Botanical Garden Research Articles

Population dynamics of the main necrophagous Diptera in the sub-Sudanese zone of Côte d’Ivoire

The objective of this work was to identify the population variation of the main necrophagous Diptera in the sub-Sudanese zone of Côte d'Ivoire. Three traps, inspired by Upton's and using pig liver and viscera as bait were placed on the site of the Botanical Garden of Peleforo Gon Coulibaly University and Lataha located 10 km from the Botanical Garden. Weekly captures were taken from October 4, 2018 to October 3, 2019. In total, 194,853 individuals from the Calliphoridae, Sarcophagidae and Muscidae were collected. Calliphoridae represented 48%, Sarcophagidae 24% and Muscidae 28% in the Botanical Garden site and in Lataha, Calliphoridae presented 52%, Sarcophagidae 27% and Muscidae 21%. Chrysomya albiceps, Sarcophaga carnaria and Musca domestica were the majority species. The numbers of these three species were higher at relative humidity levels reaching 70 to 85%. A correlation between relative humidity and the numbers of these three species was observed. Apart from relative humidity, these results show that other climatic parameters have a weak influence on the activity of Chrysomya albiceps, Sarcophaga carnaria and Musca domestica. During this study, temperature and rainfall had little influence on the variation in the numbers of these three main species of necrophagous insects. However, the numbers of the three species were correlated with relative humidity levels.

Effect of seasons on the decomposition by necrophagous insects of pig (Sus scrofa domesticus L.) carcasses exposed to the open air in the Sudano-guinean and Sub-sudanese zones of Côte d'Ivoire

Determining the post-mortem interval (PMI) of a corpse discovered 72 hours after death is becoming complex and imprecise in forensic medicine. It is necessary to use other investigative methods to determine the date of death. The aim of this research was to determine the impact of the seasons on the decomposition of pig corpses exposed to the open air by necrophagous insects. The research was carried out in the North (at the Botanical Garden of the Peleforo Gon Coulibaly University in Korhogo) and in the Centre (in the Bouaké region). Insects were collected directly from decomposing carcasses using a mowing net and flexible forceps for larvae and Coleoptera. Pitfall-traps were also used for collection. Diptera and Coleoptera were collected during the dry and rainy seasons in the Sudano-guinean and Sub-Sudanese zones. Chrysomya albiceps, belonging to the Calliphoridae, was the majority species. Because of its plethora of species in the two study areas, C. albiceps could be one of the main species for determining the minimum MPI in Côte d'Ivoire. Five stages of decomposition were observed in the two study zones, although a sixth stage (dry putrefaction) was observed in the Sub-sudanese zone during the harmattan period. Stratiomyidae and Piophilidae contributed to the total decomposition of carcasses during the rainy season. The Histeridae family was the richest in species. Dermestes maculatus was the richest in individuals. Carcasses in the rainy and dry seasons were respectively decomposed by an average of 97.18% in the rainy season and 84.32% in the dry season in the two study areas.

Multiple genotypes of a quarantine plant pathogen detected in New Zealand indigenous plants located in a botanical garden overseas

AbstractXylella fastidiosa is a xylem‐limited bacterial plant pathogen transmitted by insect vectors. It infects a wide range of plant species and causes devastating diseases. Botanical gardens are global repositories of plant diversity exposed to local biotic and abiotic stresses. We used molecular diagnostic tools for the detection of X. fastidiosa in a collection of New Zealand indigenous plants grown in a X. fastidiosa‐infected Californian area to determine if any species were infected with this bacterial pathogen and to help inform biosecurity responses. To this end, 130 New Zealand indigenous plant species comprising 72 genera, growing in the University of California Botanical Garden at Berkeley, California, were screened for X. fastidiosa. Multiple PCR‐based methods were used to detect the pathogen at the subspecies and sequence‐type levels directly from plant material; nine plant species tested positive by at least two PCR‐based methods. All nine infections were identified as X. fastidiosa subsp. multiplex sequence types 6 or 7 by the amplification of seven housekeeping genes. Three strains were cultured in vitro and their whole genome sequences were obtained; these strains belonged to three distinct clades within subspecies multiplex, indicating that the infections were not transmitted among these New Zealand indigenous plant species. The information gathered in this study will help to assess the risk of X. fastidiosa to New Zealand indigenous flora and the potential spillover to crops of agricultural importance. The work also shows the applied value of botanical garden collections as sentinels for international plant pathogen biosecurity risk assessment.

Assessment of diversity of plant species, composition, structure and regeneration status in Gondar Zuria District, Ethiopia

This study assesses the composition, arrangement, and state of regeneration in Gondar Zuria District. The two transect lines over the gradient were set up using a systematic random sample strategy in order to gather the number of species and their diameter for tree species in DBH (cm). The distance between the sample plots was 50 m, and the transect lines were 50 m apart. 12 circular plots were used in the total sample area of the botanical garden, and the sizes of the circular plots were 6.5 m for trees, 4.5 m for saplings, and 2.5 m for seedlings. Using the important value index and the diameter at breast height, the pattern of plant structure displays an inverted J shape. A review of the botanical garden’s plant species’ regeneration status revealed that, of the tree and shrub species, 6.25% had fair regeneration status and 25% had poor regeneration quality. While 56.25% of plant species that were only available as saplings or seedlings were regarded as “new” at the botanical garden, a total of 25% of plant species were not regenerating at all. At the study site, the species diversity as determined by the Shannon-Weiner (H’) index was 1.58. But this value shows the species diversity is included in the low biodiversity range unless they are well managed from disturbance. The species composition of the site shows a few species; only 16 plant species were found. A high number of individual species are found in the Leguminosae family.

Leaf architecture and functional traits for 122 species at the University of California Botanical Garden at Berkeley.

The dataset contains leaf venation architecture and functional traits for a phylogenetically diverse set of 122 plant species (including ferns, basal angiosperms, monocots, basal eudicots, asterids, and rosids) collected from the living collections of the University of California Botanical Garden at Berkeley (37.87° N, 122.23° W; CA, USA) from February to September 2021. The sampled species originated from all continents, except Antarctica, and are distributed in different growth forms (aquatic, herb, climbing, tree, shrub). The functional dataset comprises 31 traits (mechanical, hydraulic, anatomical, physiological, economical, and chemical) and describes six main leaf functional axes (hydraulic conductance, resistance and resilience to damages caused by drought and herbivory, mechanical support, and construction cost). It also describes how architecture features vary across venation networks. Our trait dataset is suitable for (1) functional and architectural characterization of plant species; (2) identification of venation architecture-function trade-offs; (3) investigation of evolutionary trends in leaf venation networks; and (4) mechanistic modeling of leaf function. Data are made available under the Open Data Commons Attribution License.

Photosystems functioning, the content of chemical elements, flavonoids and brassinosteroids in leaves of chimera Cornus controversa

he formation of chimera is a well-known phenomenon in variegated ornamental and wild plants, but the biochemical peculiarities of this phenomenon are not well studied. The purpose of this work was to conduct a comparative study of the photosynthetic apparatus functioning, the content of macro-, microelements, flavonoids and brassinosteroids in the variegated and green leaves of the periclinal chimera Cornus controversa plant grown in the collection of M. M. Gryshko National Botanical Garden of the NAS of Ukraine. Sampling was made during the period from June to October 2022. The content of photosynthetic pigments and brassinosteroids was measured spectrophotometrically, autofluorescence of leaf tissues was studied using an inverted microscope with a multi-channel fluorescence imaging system, Normalized difference vegetation index (NDVI) – using GreenSeeker devices and fluorimeter, the level of macro- and microelements – using plasma emission spectrometer. Phenolic secondary metabolites were separated by HPTLC. To assess the protective capacity of flavonoids, a bioassay on the germination of radish seeds Raphanus in the presence of AlCl3 was used. It was shown that green leaves of C. controversa chimera, compared to variegated ones, had a twice as high NDVI index, maintained photosynthetic function longer in autumn, and had higher content of macronutrients (Mg, Ca and S) but lower concentration of toxic metals (Al, Cu, Fe, Zn, Ti). Instead, variegated leaves accumulated more brassinosteroids and phenolic metabolites, which were found not only to reduce the toxic effect of aluminum but also to have a growth-stimulating effect on the roots of radish seedlings. Such specialization of green and variegated leaves may contribute to better plant chimeras adaptation to environmental pollution. Keywords: brassinosteroids, Cornus controversa, macroelements, microelements, NDVI index, periclinal chimera, phenolic metabolites, photosynthetic pigments, tissue autofluorescence

The history of the breeding of Clematis (Clematis L.) in the M. M. Gryshko National Botanical Garden, NAS of Ukraine

Purpose. Investigate the history of Clematis breeding in the M. M. Gryshko National Botanical Garden (NBG), NAS of Ukraine, determine the main directions of hybrid Clematis breeding work. Results. It was established that the result of more than 16 years of breeding Clematis in the NBG was the selection of the 61 perspective hybrid, 42 of which, the most perspective, were assigned names. Of these, large­flowered varieties are the most numerous according to the distribution of variety groups in the current Royal Horticultural Society of Great Britain classification. In particular, Late Large­flowered account for about 40% of the total and Early Large­flowered for about 29%. Small­flowered hybrids make up the smaller part, of which about 26% belong to the Viticella group and one hybrid (‘Sputnik’) to the Integrifolia. The known directions of distribution of hybrid Сlematis of the NBG breeding indicate the possibility of their successful cultivation both in continental and maritime areas with a high level of humidity in the temperate zone and in the dry Mediterranean climate of the subtropical climate zone, which reveals their significant adaptive potential. Conclusions. Obtaining varieties of hybrid Clematis of domestic breeding is important for the implementation of sustainable horticulture practices on the territory of Ukraine, since a significant part of the modern introduced assortment of Clematis raises doubts about their adaptability to the local climate, and requires additional research into their adaptive potential. A successful combination in vertical landscaping of NBG­bred Clematis belonging to different varietal groups can ensure continuous flowering from May to the end of the season. These unique characteristics of Clematis ensure the creation of not only environmentally sustainable, but also visually appealing spaces that will contribute to the overall health and beauty of the urban environment.

Creation of a collection fund and study of cultivars of daylilies in the M. M. Gryshko National Botanical Garden of the National Academy of Sciences of Ukraine

Purpose. Analysis and comparative study of daylily cultivars from the collection fund of the M. M. Gryshko National Botanical Garden of the National Academy of Sciences of Ukraine (NBG), selection of assortment for decorative horticulture and landscaping. Methods. Cultivars from the NBG daylily collection were studied. The cultivars were evaluated in terms of their aesthetic and economic attributes, and were classified according to their coloration and the timing of their flowering. The author of the cultivar, country of origin, year of creation and introduction into the NBG were also identified. The cultivars were also grouped according to these parameters. Results. The NBG daylily collection is the result of 40 years of introduction and 20 years of breeding work with this crop at the NBG. It includes 174 world cultivars, 26 cultivars of Ukrainian breeding and more than 1000 hybrid seedlings. Most of the cultivars (79) were introduced in 2000–2009. The main part of the current structure of the daylily collection consists of cultivars bred in the 1960–1970s. Most of these are hybrids from American breeders: David F. Hall (20 cultivars) and Allen Wild (46 cultivars). A total of 15 new cultivars were developed based on the original collection. These new cultivars feature double flowers, a valuable trait for hybrids in Ukraine. For effective use in ornamental horticulture and landscaping, the cultivars were grouped according to flower colour and flowering time. The yellow­flowered group is the most widely represented. A large number of cultivars with red flowers are inherent in hybrids bred between 1980 and 1999. Cultivars from modern breeding are mostly represented by the purple and pink colour group. Most of the cultivars in the collection are early and medium early. The smallest part is made up of medium­late and late hybrids. Conclusions. The modern daylily collection is representative. The cultivars introduced into the NBG illustrate the main stages of breeding work with the crop and the achievements of breeders from different countries of the world. The collection includes early and medium early, medium, medium late and late flowering cultivars. Varying in colour and flowering time, the collection can be effectively used to extend the flowering period of daylilies by three months (from the second decade of May to the second decade of August) in ornamental gardening in Ukraine and in various landscape compositions.

Design of a Green Corridor and the Revitalization of the Huatanay River, City of Cuzco, Peru—2024

Population growth in the last 30 years has generated an energy shortage and excessive consumption of products, generating a large percentage of solid waste. Urban expansion has led to a significant impact on the biodiversity of both flora and fauna. In this context, the objective of this research is to develop a design for a green corridor that optimizes ecological energy efficiency and contributes to the revaluation of the Huatanay River in Cuzco. The methodology used in this study is articulated in four stages: literature analysis; analysis of the environment through supporting data such as Climate consultant, SIGRID, and GEO Peru; results where the proposed project is carried out; and finally, the conclusions and discussions where they are contrasted with a similar bibliography. The design of the green corridor efficiently takes advantage of the natural resources available in the area, which has 70% green areas and 30% public spaces, where 13 kWh/day of energy is generated, according to the calculations made in sector 2 of the botanical garden that will later be replicated in the other sectors, derived from biodigesters for the lighting of spaces of the botanical garden. The corridor, in turn, aims to recover the ecological function of the river through the restoration of its course, the reforestation of its banks, and the creation of recreational areas. In conclusion, the green corridor aims to revitalize the Huatanay River through different elements, among which the botanical garden stands out.

Optimization of the DNA isolation procedure for assessing the genetic diversity of essential oil roses (Rosa L.)

Background. High content of organic compounds that worsen nucleic acid purification in aromatic plants, as well as the use of such toxic substances as phenol and mercaptoethanol in many protocols for plant DNA isolation, make it advisable to take the above disadvantages into account when optimizing the DNA extraction technique for the work with essential oil rose plants. Material and methods. Rose accessions from the Crimean Federal University’s Botanical Garden, and those from the collection held by the Research Institute of Agriculture of Crimea were included in the study. DNA extraction was done according to a modified CTAB protocol. Effectiveness of the technique was assessed using spectrophotometry, horizontal electrophoresis, and ISSR-PCR. Results. DNA preparations extracted with the modified technique were well visualized on the electropherogram and demonstrated high spectrophotometric values. DNA content was twice as high in preparations isolated with an extraction buffer with PVP, compared to a PVP-free buffer. The concentration was also higher in DNA extracts from stems than that from leaves. Purity parameters expressed by the absorption ratios at wavelengths A260/280 and A260/230 were again higher for DNA extracts from stems isolated with an enriched buffer, the A260/230 ratio falling within the normal range only in DNA extracted from stems in the presence of PVP. Besides, DNA extracts were effectively purified from proteins without phenol or mercaptoethanol, due to double rinsing with a chloroform/isoamyl alcohol (24 : 1) mixture. Conclusion. Using rose stem tissues as the research material, adding 2% PVP to the extraction buffer, and twofold rinsing with a chloroform/isoamyl alcohol mixture made it possible to obtain DNA extracts with high concentrations and purity indices within normal ranges suitable for the ISSR analysis of essential oil rose genetic diversity.

Indigenous Knowledge and the Hann Expedition: Re-Examining Scientific Collections From Colonial Expeditions

An examination of the motivations, dynamics and activities of colonial exploring expeditions can provide valuable insights into the ways in which the colonial mindset shaped the development of natural history collections in colonised lands. The Indigenous Knowledge and the Hann Expedition: Re-examining scientific collections from colonial expeditions project is working to redress these omissions in the historical record by re-contextualising the botanical specimens collected on the 1872 Northern Expedition and re-connecting them with the Aboriginal Country from which they were collected (Dalley et al. 2024). The 1872 Northern Expedition, led by William Hann, sought to establish the mineral and agricultural potential of Cape York Peninsula in northern Queensland, Australia. Alongside Hann, the expedition party included Jerry (Aboriginal guide), Dr Thomas Tate (botanist), Norman Taylor (geologist) and three other European men: Warner, Stewart and Nation. It was this expedition, with its reports of gold on the Palmer River, that triggered Queensland’s biggest goldrush and led to an influx of more than 20,000 settlers, with disastrous consequences for the Aboriginal people who occupied the area (Taylor and Huxley 2020). Between June and November, the expedition party travelled from Mount Surprise north to the Stewart River, before returning south via the coast at Cooktown and Weary Bay (Taylor and Huxley 2020). Geological specimens were collected by Taylor, and botanical specimens were collected by Tate and Taylor (Dowe and Taylor 2019). The botanical specimens collected by Tate and Taylor, now held at Royal Botanic Gardens Kew (K) and the National Herbarium of Victoria (MEL), were enumerated by John Dowe and Peter Taylor (Dowe and Taylor 2019). It has since emerged that the Queensland Herbarium (BRI) holds an additional 18 botanical specimens collected by Tate during the expedition (Council of Heads of Australasian Herbaria 2024). These specimens—along with expedition diaries and maps—will provide a stimulus for regional engagement that explores the intersection between the Hann expedition, colonial science, and the ongoing impacts of colonial violence on Indigenous peoples. The project is being led by three direct descendants of members of the expedition party: Nicole Huxley (descendant of Jerry); Peter Taylor (descendant of Norman Taylor) and Cameo Dalley (descendant of Thomas Tate), making the project uniquely—and powerfully—positioned to examine the personal, scientific and sociopolitical legacies of the expedition (Dalley 2021). It was co-designed with Balkanu Cape York Development Corporation and the three herbaria that house the expedition’s botanical collections. Through engaging in truth-telling with Aboriginal knowledge-holders on Cape York Peninsula to openly share and discuss historical truths around colonial violence and disposession—while highlighting the strength and resilience of First Peoples (ANTaR 2024)—the project team hope to correct historical omissions that have stood for more than 150 years and provide a more complete picture of the way in which colonial plant collections were made. Initial engagement is being undertaken with Aboriginal communities in Cape York will be undertaken to generate shared history-making and elevate Indigenous knowledge and memory to develop countervailing historical narratives and recontextualise the botanical specimens collected on the expedition. All engagement with Aboriginal communities will be held on-Country, i.e., on lands to which the Aboriginal peoples being consulted are connected via law, cultural practice, spiritual belief, language and/or custom (AIATSIS 2024). At the time of writing, the three descendants are continuing a series of region-specific engagements that are generating interest in—and support for—Indigenous-led knowledge-sharing and the documentation of untold stories. Based on this initial show of support, the project partners will likely seek funding for a broader Indigenous-led program of on-Country truth- and storytelling around key events that followed the 1872 Hann Expedition. Alongside the on-Country truth-telling, the project will help herbaria develop protocols for recording Indigenous Cultural Knowledge (ICK) shared by Aboriginal knowledge-holders in ways that uphold cultural safety and principles of Indigenous Data Sovereignty and Data Governance. Through two-way knowledge sharing, we hope to enrich the specimens both culturally and scientifically by: acknowledging the histories of specimens and the Traditional Owners of the lands on which they were collected; accommodating ethnobotanical enrichment of specimens by recording ICK alongside Western scientific knowledge in collection management systems, if requested by Traditional Owners; and connecting specimens to Country via enhanced georeferencing utilising Aboriginal knowledge of plants and place, and Expedition resources. acknowledging the histories of specimens and the Traditional Owners of the lands on which they were collected; accommodating ethnobotanical enrichment of specimens by recording ICK alongside Western scientific knowledge in collection management systems, if requested by Traditional Owners; and connecting specimens to Country via enhanced georeferencing utilising Aboriginal knowledge of plants and place, and Expedition resources. This symbiotic blending of botanical science and Indigenous Cultural Knowledge will 'give voice to Country' through knowledge partnerships, helping to heal the past, and to better understand and conserve the complex biodiversity of Cape York.

Measures for managing pests and diseases on some woody plants of the Zugdidi Botanical Garden

Measures for managing pests and diseases on some woody plants of the Zugdidi Botanical Garden

Enhancing Taxonomic Skills in West Africa and Supporting the Growth of GC Herbarium (Ghana)

Training the next generation of environmental scientists is critical to the future of life on Earth as acknowledged in 2021 by the Royal Botanic Gardens, Kew (RBG, Kew) in Our Manifesto for Change. RBG, Kew is also committed to strengthening capacity in the most biodiverse tropical countries by sharing expertise and collections, to enhance the global conservation effort. Developing training programmes to enhance taxonomic capacity in Africa and meeting the demand for early career in-country taxonomists was identified as the first step to accelerate the documentation and conservation of African plant diversity. Two years ago, RBG, Kew, in collaboration with the University of Ghana and the Ghana Herbarium (GC) and with support from the Schroder Charity Trust and Mallinckrodt Foundation, developed a tailored “Plant Taxonomy Skills for Ecology and Conservation” training course. This was planned to run in Africa, South America and Asia, alternating each year. The pilot was organised in Ghana, Africa in 2022. Participants for this 5-week course were selected from over 260 applicants. Delivered in a hybrid format, the course started with 3 weeks of online lectures, pre-recorded by 15 plant scientists and curators at RBG, Kew, as well as online interactive sessions. This was then followed by 2 weeks of in-person training in Ghana, including a 1-day field trip for practical collecting tips. The training covered herbarium curation techniques as well as concepts and skills needed for taxonomic revisions such as nomenclature, taxonomy, analysis of herbarium specimens, databasing, geo-referencing, preparation of morphological descriptions, diagnosis and identification keys as well as building distribution maps and red listing. The in-country teaching team included a curator-botanist, a plant taxonomist, a science education coordinator from RBG, Kew and two professors from University of Ghana. The course ended with a written assignment in the form of a taxonomic revision. A short survey was sent out to all course participants two years after the course to gather impacts of the training on their careers and uncover the most positive and negative aspects of the course. The course provided many positive outcomes: 15 plant taxonomists from eight African countries were trained, and jointly produced a taxonomic revision of 28 species of Ipomoea L. (Convolvulaceae) from Ghana (Williams et al. 2024). Additionally, The African Taxonomists Network was initiated by the course participants with a mission of ‘Fostering the next generation of taxonomists to bridge the generational gap and revitalize the relevance of taxonomy in Africa for the future.’ This network now has over 60 members, meets regularly online, and has a large presence on social media. Furthermore, the course also resulted in the awarding of the International Association for Plant Taxonomy (IAPT) Biodiversity Challenge grant to the GC Herbarium in 2022. This grant enabled acquiring essential plant collecting equipment and herbarium materials, either by sourcing them in Ghana or from abroad. The GC herbarium, founded in 1952, contains ~85,000 collections of plant and algae specimens from Ghana and across West Africa with high historical, teaching and research value. This collection is vital to enhancing in-country taxonomic capacity. Therefore, the improvement and upgrade supported by the grant, as well as its recognition, are essential. Another rewarding impact of the course is strengthening of links between RBG, Kew and African institutions of higher education. These links have quickly developed into a larger partnership and were the first step towards a long-term collaboration. The ultimate objective of this collaboration has been to create the necessary conditions, both in infrastructure and human capacity to deliver the Flora of Ghana. This will be achieved by implementing a project to support the maintenance and growth of the GC herbarium in addition to taxonomic capacity building and teaching. The participants benefited from the course by engaging with mentors, networking and exchanging ideas, forming links with individuals with similar research interests and obtaining additional training and career progression opportunities. In the feedback survey, all participants reported that this course made them consider a career or future studies in plant taxonomy and 80% of the participants reported securing a new job or a student position in plant taxonomy two years after the course. In addition, all participants listed several positive impacts of the course on their career such as confidence in producing a taxonomic revision, gaining herbarium management skills and opportunities for new collaborations. This course has been subsequently successfully run in South America (Bolivia) and Asia (Indonesia), with expectations of similarly positive outcomes, and is already planned to return to Africa (Kenya) in 2025.

Mineral Composition of Fifteen Species of Asteraceae Family Growing in the Republic of Moldova Using Neutron Activation Analysis

Members of Asteraceae family have properties enabling their application for medical purposes. The major- and microelement content in 15 medicinal species of the Asteraceae family growing in the National Botanical Garden, Republic of Moldova was determined by instrumental neutron activation analysis. A total of 31 chemical elements, Na, Mg, Al, Cl, K, Ca, Sc, V, Cr, Mn, Fe, Co, Ni, Zn, As, Se, Br, Rb, Sr, Mo, Sb, Cs, Ba, La, Ce, Sm, Tb, Hf, Ta, Th and U, were identified in herbal samples. Potassium was found to be the most abundant major element; its content in plants ranged from 20,700 mg/kg in Artemisia lerchiana to 58,000 mg/kg in Matricaria recutita. The content of other major elements existed in the following ranges: Ca from 4700 to 14,200 mg/kg and Mg from 1710 to 3870 mg/kg. The maximum content of Mg, K and Ca in analyzed plants was higher compared to data presented in the literature. Among essential microelements the most abundant were Fe (83–910 mg/kg), Mn (23–150 mg/kg) and Zn (27–76 mg/kg). The daily intake of metal and the health risk index for selected elements (As, Ni, Sb, V, Mn, Cr, Co, U, Sr, Al, Fe, and Zn) were calculated. Health risk indexes were obtained for V and Co in Calendula officinalis, Tanacetum balsamita, Achillea clypeolata, Artemisia balchanorum, Artemisia lerchiana, Helichrysum arenarium, and Matricaria recutita. The principal component analysis showed three associations of elements, which can be defined as physiological, geological and anthropogenic sources of elements.

Assessment of Plant Biodiversity and the Floristic Composition in the Black Irtysh River Valley (Kazakhstan)

The Black Irtysh River, a major tributary of the Ob River, traverses diverse ecological zones, influencing the distribution and composition of its floodplain vegetation. This study focused on the Black Irtysh River valley, a key segment of the Irtysh basin, to assess the current state of its plant communities. To compile expedition routes and a preliminary floristic list, a critical revision of more than 1000 herbarium sheets was carried out in the herbarium collections of Kazakhstan (Altai Botanical Garden and Institute of Botany and Phytointroduction). During the field season, a study of plant biodiversity was carried out along the entire coastline of the Black Irtysh. As a result, 217 species of higher vascular plants were identified (55% of those previously found in herbarium archives) from 139 genera and 43 families. The habitats of two Red Book species were discovered: Tulipa patens and Tulipa uniflora. It was found that the flora of the Black Irtysh is similar to the flora of the entire Zaisan depression, and families Poaceae, Asteraceae, Amaranthaceae, Caryophyllaceae, Rosaceae, and Fabaceae are predominant. Geobotanical surveys revealed that the species composition of plant communities is poor and similar among survey points. Only the western part of the river delta is characterized by high rates of projective cover and reserves of forage plants. The main factors of anthropogenic influence are fires, livestock grazing, and deforestation.

Reproductive Biology in the Possible Last Healthy Population of Parodia rechensis (Cactaceae): Perspectives to Avoid Its Extinction.

All 32 Brazilian species of Parodia Speg (Cactaceae) occurring in Rio Grande do Sul State are considered threatened, according to the IUCN criteria. Until 2021, Parodia rechensis (CR) was known by only two small populations. However, a new population with over 400 individuals was discovered in 2021, prompting the study of its reproductive biology as a way to promote its conservation. Anthesis, breeding system, and natural pollination were studied in the field. The breeding system was studied by applying controlled pollination treatments to plants excluded from pollinators (bagged). Germination features were studied at the Seed Bank of the Porto Alegre Botanical Garden under controlled temperatures (20, 25, and 30 °C). The anthesis is diurnal and lasts for up to four days. The flowers offer pollen as the sole resource to the pollinators. The study species is unable to set fruit and seed without the agency of pollinators and has self-incompatible (unable to set fruit and seeds when pollinated with pollen of the same individual) characteristics that can considerably restrict its reproduction. Native bees of Halictidae and Apidae (Hymenoptera) are the main pollinators, with a smaller contribution of Melyridae (Coleoptera) and Syrphidae (Diptera). Natural fruit set is moderate (≤64%, per individual), but the species presents vegetative growth, producing several branches from the mother plant. Seeds showed the optimum germination rate at 20 °C and an inhibition of 75% in germinability at 30 °C. Our findings suggest the need to manage the species' habitat to guarantee the permanency of the plants and healthy populations of pollinators as well. Our findings raise concerns about the germination and establishment of new individuals in the context of rising temperatures caused by climate change. Suggestions for the possible management of the extant populations are made.

Lotus growth and development in artificial water bodies in the conditions of the Stavropol Upland

Relevance. The creation of a botanical collection of the lotus family made it possible to study the biology and adaptive features of a rare relict species of Nelumbo nucifera and its variety in the conditions of the Stavropol Upland.Methods. The main phases of development (the beginning of growth, budding, flowering) were recorded. Statistical processing was carried out by the method of variance analysis according to G.N. Zaitsev.Results. In 2010, Nelumbo nucifera seeds were purchased from the Volga River Delta and planted in a 100-liter container, which was located in a closed ground. From 2010 to 2014, the plant vegetated every year from the second decade of January to November, in November, vegetation was artificially stopped. With such agricultural techniques, the plant had no flowering and fruiting phases. In June 2014, rhizomes were planted and lotus seeds were sown in a pond made of butyl rubber film. In 2017, the first flowering was observed. During the study period, the plants did not reach natural indicators, on average, the diameter of the leaves is less by 18.5 ± 1.6 cm, the flowers are 2 ± 0.1 cm, the height is 1.0–1.5 m. The duration of flowering is 57 ± 4 days, which corresponds to the natural conditions of lotus growth from mid-July to early September. During the years of research, 495 seeds were obtained. Under the influence of abiotic factors, the nut-bearing lotus lives up to 8 years in the botanical garden. Nelumbo nucifera Betsy grows intensively, flowering occurred in the third year after sowing, leaf diameter 57 ± 3 cm, height above the water surface 78 ± 7 cm, flowering duration 73 ± 7 days, which is longer than that of the nut-bearing lotus, full-fledged seeds are formed.

The University of Tokyo's Conservation Work in the Ogasawara Islands

SummaryThe flora of the Ogasawara Islands is briefly described, and the causes of its decline are discussed. The conservation of endangered plants of Ogasawara since the 1980s by the Koishikawa Botanical Garden, The University of Tokyo, is detailed, with notes on the pollination biology of endemic species.

Inventarizácia invázneho druhu pajaseňa žliazkatého (Ailanthus altissima) v urbánnom prostredí – prípadová štúdia

Tree of heaven [Ailanthus altissima (Mill.) Swingle] (family Simaroubaceae) is known as an invasive woody species in urban, rural, and natural ecosystems in many parts of the world. In Slovakia, it is accepted as an invasive species included in the list of invasive alien species of the EU concern (Regulation No. 2019/1262). In this study, the spread of the invasive neophyte A. altissima populations was monitored in the immediate vicinity (1 km) of the Slovak University of Agriculture in Nitra in southwestern Slovakia in 2022. We recorded habitat type, GPS coordinates in the centre of the local populations, area of population (m2), average tree height (m), and management measures. The species colonized an area of 1,997 m2. The plant spread mainly in the habitat of extensively cultivated fields such as front gardens of buildings (31%) and in abandoned and unused areas (the species occupied 28% of the total area). We recorded a lower occurrence in the botanical garden (18%), next to the anti-flood dam (16%), along roads (4%) and in the orchard (3%). Approximately 15% (28 shoots) of the total number of 183 shoots were female plants that formed a high number of seeds. There was a high correlation between the area occupied by A. altissima with its above-ground organs and the average plant height (m) (r = 0.88).

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.