BLAST Tool Research Articles

Clinical and laboratory comparison of severe (Group B and C) Dengue cases with molecular characterization from 2019 epidemics in Dhaka, Bangladesh.

Acute arboviral infections like dengue have a significant negative socioeconomic and health impact on many tropical and subtropical areas of the world. About 3.9 billion Individuals are at risk of contracting the dengue virus and Asia bears the brunt of that load. Bangladesh, like other south-east Asian countries faced a massive outbreak of dengue in 2019. This cross sectional study was done in three tertiary care centers in Dhaka, Bangladesh during this worst outbreak of dengue. The study was conducted from 1st July to 31st December, 2019 with an aim to describe the clinical and laboratory variations among severe dengue cases and to conduct a serotype survey. This might help to understand the future changes in the clinical or serological profile of this virus. The study enrolled 1978 participants who were grouped into group B (Patients with warning signs or risk factors who should be admitted for close observation as they approach critical phase) and C (Patients having severe plasma leakage leading to dengue shock and/or fluid accumulation with respiratory distress, severe organ impairment and severe metabolic abnormalities) according to national guidelines. Furthermore, 81 samples were serotyped using Qiagen One step RT-PCR kit (Cat. No: 210212). In addition sequencing (ABI sequencing platform) of partial C-prM gene of five DENV-3 isolates were done and analyzed (BLAST tool of NCBI) for phylogenetics (MEGA6 software package). Among the 1978 enrolled participants group B and C patients were 1580 (80%) and 398 (20%) respectively. The median (IQR) age of the patients were 26(11 to 41). Maximum proportion of the enrolled were male (72.3%) (p = 0.0002). Most common co- morbidities were hypertension (90; 4.5%) and DM (70; 3.5%). Group C patients more commonly presented with vomiting (p 0.133), diarrhea (p<0.0001) and abdominal pain (p 0.0203). The common mode of bleeding was melaena (12%). Thirteen (0.7%) patients succumbed to death, 12 of them belonged to group B who mostly presented with GI manifestations (99.9%) and melaena (12%). Only 5.6% of the cases were secondarily infected. In group C cases low hemoglobin and hematocrit was observed with high AST (p 0.004, 0.006 and 0.0016 respectively). Fluid requirement was also more in the same group (p<0.0001). Group B patients had a higher platelet requirement (p = 0.0070). Twelve patients (0.7%) required ICU. The management profile of these cases are showcased here which highlights minimal use of antibiotics and no application of steroids, which abides by the current national protocol. Furthermore, 81 samples from enrolled participants were serotyped and majority (79%) yielded DENV-3, followed by DENV 2 & 3 co-infection (13.6%) and DENV-2 alone (7.4%). Following phylogenetic analysis DENV-3 and DENV2 were deemed to be of genotype I and cosmopolitan variety respectively. This study presents the first instance of heterogeneous co-infection with several serotypes since 2000 in Bangladesh. It also gives an overview of serotype prevalence, management evaluation and clinical results that promises to navigate future control planning.

Screening and computational characterization of novel antimicrobial cathelicidins from amphibian transcriptomic data

As cold-blooded organisms living in damp and dark environments, amphibians have evolved robust defense mechanisms to protect themselves from predators and infections. Among the wide repertoire of bioactive compounds they produce are antimicrobial peptides (AMPs), which are required as part of innate immunity. One important class of AMPs is cathelicidins, known for their broad-spectrum activity against pathogens and their immunoregulatory roles. However, despite their promising biomedical potential and the increasing availability of omics data, few cathelicidins have been studied in amphibians, mostly through conventional experimental techniques. Here, we present 210 novel cathelicidin sequences from amphibian transcriptomes, identified through a comprehensive computational pipeline, which employed HMMER and BLAST tools to screen cathelicidin domains. These sequences reveal a typical tripartite domain architecture that was confirmed by SignalP and InterProScan analysis. Phylogenetic inference with IQ-TREE classified the sequences into six categories based on evolutionary relationships. Compared to cathelicidins from other vertebrates, amphibian mature peptides exhibit longer average lengths (around 50 amino acids), fewer aromatic and hydrophobic residues, and reduced thermal stability. Furthermore, these amphibian cathelicidins were characterized for their physicochemical and biological properties, revealing significant antimicrobial potential with lower hemolytic capability, especially in anurans, which suggests a balance between their antimicrobial and hemolytic activities predicted through AMPlify, ampir, AmpGram, and HemoPI. Secondary structure estimations, including three-dimensional modeling using AlphaFold2, indicate that amphibian cathelicidins predominantly feature α-helices and coils. Some representative models also display a high α-helix composition with amphipathic topology, facilitating interactions with simulated bacterial membranes as assessed by the PPM approach. Thus, these findings highlight the functional role of cathelicidins in amphibian immunity and their promising biomedical applicability, emphasizing the importance of applying computational methods to expand the scope and reveal the diverse landscape of cathelicidins across vertebrates.

Comparative analysis of the structure of regulatory genes of Vibrio cholerae serotype О1 biotype El Tor strains

Introduction. The expression of the ctxAB and tcpA-F genes encoding the main pathogenicity factors of the Vibrio cholerae is controlled by regulatory genes. The structure of these genes has not been fully studied in the pathogen strains isolated during different periods of the current pandemic. The aim of the study was a comparative analysis of the structure of regulatory genes of V. cholerae O1 biovar El Tor strains isolated on the territory of the Russian Federation and neighboring countries during the seventh cholera pandemic. Materials and methods. The nucleotide sequences of the complete genomes of 29 toxigenic strains isolated from 1970 to 2023 were analyzed. The analysis was carried out using BioEdit v7.2.6.1 software and Blast tool. Results. The analysis of ten regulatory genes (toxT, aphA, aphB, hns, hapR, vieA, luxO, luxT, carS, carR) was carried out. Almost all strains were found to have a thymine insertion in the hapR gene at position 219. The exception was V. cholerae strain M3208 (Tambov, 2023), which had an insertion of five nucleotides in this gene. Mutations of the luxO gene with an unknown effect were detected in 44.8% of the studied strains. In 46.7% and 33.3% of the studied genetic variants carrying the ctxB1 allele, non-synonymous substitutions were detected in the hns (G319A) and vieA (C235T) genes, respectively. All genetic variants with the ctxB7 allele have mutations in both the hns and vieA genes. Three genetic variants with the ctxB7 allele, imported to the Russian Federation in recent years, contain an altered structure of the carR gene (G265A). Conclusion. The structure of genes (toxT, aphA, aphB, carS, luxT, hapR) of V. cholerae O1 El Tor strains remains unchanged for the majority of the studied isolates. At the same time, variability in the hns (G319A), vieA (C235T) and carR (G256A) genes was detected. Mutations in these genes can be used as genetic markers of modern V. cholerae O1 El Tor genetic variants.

DNA BARCODING ANALYSIS OF THE ASTERACEAE SPECIES FROM KAZAKHSTAN

Asteraceae is the largest family of flowering plants in the world, containing more than 1.900 genera and more than 32.000 individual species. Many members of the Asteraceae family are important for medicinal, ornamental, and economic purposes. In Kazakhstan, the family is represented by 146 genera and 883 species. Many species of Asteraceae are currently being used for medicinal purposes in Kazakhstan. The species of this family including Artemisia dracunculus, Pentanema caspicum, Achillea nobilis, Leuzea altaica, Klasea cardunculus, and their derivatives are effective in the treatment of diseases, possess anti-fatigue, and anti-inflammatory properties. They also have immunomodulatory properties that can to reduce inflammation, speed up wound healing, and boost the immune system in response to bacterial or viral infection. Commercially important plants of the Asteraceae family include food crops, aside from consumption, the seeds, roots, etc. can be used to produce cooking oil and spices. Other commercially important species of the Asteraceae family are members of the Tanacetum genera, which have insecticidal properties. Given the many valuable members of the Asteraceae described above, a method to authenticate an Asteraceae species is essential to ensure drug and food safety. DNA barcoding is a method that uses a short piece of DNA sequence from a standard locus as a tool for species identification. In our study DNA was extracted from plant material using the CTAB method, followed by the selection of universal barcode primers (ITS, matK, rbcL) based on established literature. The result of PCR products were purified and subjected to Sanger sequencing. The assembled sequences were compared with existing DNA sequences using BLAST function of the National Center for Biotechnology (NCBI), with outgroup sequences (Acicarpha tribuloides, Alseuosmia macrophylla) and were analyzed in MEGA 11. Maximum Likelihood analysis was conducted using 24 different nucleotide substitution models including ITS (K2+G), matK (GTR+G), rbcL (K2+G). Basic indicators of genetic diversity were evaluated, including nucleotide divergence (Pi), the proportion of conservative (C), polymorphic, and segregating (S) regions. The ITS regions showed the highest divergence (Pi = 0.127), with conservative regions accounting for 68.7% and polymorphic regions varying within 29.6%. The rbcL regions showed higher conservatism (Pi = 0.02), with 94.6% conservative regions and only 5.4% variable regions. The matK regions exhibited intermediate values (Pi = 0.052), with 87.5% conservative and 12.5% variable regions. The G+C content of the aligned sequences ranged from 34.9% to 55.0%. The effectiveness of the BLAST tool in identifying identical sequences in the NCBI database was limited at the species level for the chloroplast DNA markers rbcL and matK. However, using the ITS DNA marker, the search within the NCBI database successfully identified only the species Achillea millefolium and Achillea nobilis with 100% accuracy. Intra-specific discrepancies were observed for other species such as Psephellus sibiricus (99.37%), Scorzonera parviflora (99.37%), Klasea cardunculus (99.79%). All investigated DNA barcodes were tested successfully identified species at the genus level with 100% accuracy.

Bioinformatics deciphers the thebaine biosynthesis pathway in opium poppy: Hub genes, network analysis, and miRNA regulation

Thebaine, a vital precursor in the codeine and morphine pathway, shows promise in addiction treatment. We conducted a comprehensive study on the thebaine biosynthesis pathway in opium poppy, utilizing bioinformatics tools. The dataset comprising the thirteen genes associated with the thebaine biosynthesis pathway was compiled from an extensive review of published literature and validated using the NCBI BLAST tool. Utilizing STRING and Cytoscape, we analyzed gene interactions and visualized the molecular interaction network, respectively. To identify hub proteins, CytoHubba was administered. The Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) at STRING were used for the enrichment analysis of the hub genes. CytoCluster was used to analyze the network in clusters. Promoter regions of hub genes and potential miRNAs were explored using MEME and the psRNATarget database. Hub genes crucial to thebaine biosynthesis were identified, contributing to essential cellular functions like growth, development, stress response, and signal transduction. Metabolic processes emerged as pivotal for thebaine production, indicating a broader role for the thebaine pathway gene network beyond primary metabolite production. Cell component subnetwork genes demonstrated associations with anatomical units, indicating involvement in plant defense responses. Dominant molecular functions drove plant defense responses. KEGG pathway analysis highlighted the significance of metabolic pathways and biosynthesis of secondary metabolites. Cluster analysis emphasized the relevance of the biosynthesis of amino acids, confirming the link between primary and secondary metabolites. Promoter analysis suggested the potential involvement of signal transduction in thebaine production. Hub genes were targeted by 40 miRNAs, suggesting potential novel biomarkers or target genes within the thebaine biosynthesis pathway. Based on the role of miRNAs identified in connection with the hub genes of the thebaine production process, the secondary metabolite pathway of thebaine appears to be associated with several key plant pathways, e.g. growth, development and stress response. However, these findings, based on bioinformatics analysis, warrant further experimental validation and promise to advance our understanding of the biosynthesis of thebaine and its interactions with other genes and metabolic pathways that influence the production of metabolites.

Genetic polymorphisms of common sandflies in selected areas of Henan Province based on DNA barcoding

To characterize the species of common sandflies in Henan Province using DNA barcoding with cytochrome c oxidase subunit I (COI) gene as the molecular marker, and to analyze the genetic polymorphisms of sandflies, so as to provide insights into visceral leishmaniasis prevention and control in Henan Province. Sandfly specimens were sampled from 13 sandflies surveillance sites from 2021 to 2023 in Anyang City, Zhengzhou, Luoyang and Xuchang cities (Zhengzhou-Luoyang-Xuchang areas) where visceral leishmaniasis cases were reported and in Jiaozuo and Xinxiang cities (Jiaozuo-Xinxiang areas) without visceral leishmaniasis cases reported. Genomic DNA was extracted from a single sandfly, and COI gene was amplified. The amplification product was subjected to bidirectional sequencing. Following sequence assembly, the species of sandflies was characterized through sequence alignment using the BLAST tool. The intra-specific and inter-specific genetic distances of sandflies were estimated among different areas using the software Mega 11, and phylogenetic trees were created. The polymorphisms of nucleotide sequences in the sandflies COI gene were estimated using the software DnaSP. The fixation index (FST) of different geographical isolates of sandflies was calculated using the Arlequin software, and the gene flow value (Nm) was used to measure the gene flow in the sandflies populations. In addition, the population genetic structure of different geographical populations of Phlebotomus chinensis was analyzed using the STRUCTURE software. A total of 978 sandflies were collected from 13 sandflies surveillance sites in Zhengzhou-Luoyang-Xuchang areas, Jiaozuo-Xinxiang areas and Anyang City of Henan Province from 2021 to 2023, and 475 sandflies were randomly sampled for subsequent detections. A total of 304 Ph. chinensis, 162 Se. squamirostris and 9 Se. bailyi were identified based on molecular biological detection of the COI gene, and Se. bailyi was reported for the first time in Henan Province. The intraspecific genetic distances of sandflies were 0.000 to 0.040, and the inter-specific genetic distances ranged from 0.133 to 0.161. Phylogenetic analysis revealed that each of the three sandfly species was clustered into a clade. The genetic polymorphisms of Ph. chinensis populations varied among different areas, with the highest haplotype diversity (0.966 ± 0.007) and the greatest nucleotide diversity (0.011) in Zhengzhou-Luoyang-Xuchang areas, and the lowest haplotype diversity (0.720 ± 0.091) and nucleotide diversity (0.004) in Anyang City. The dominant haplotype of Ph. chinensis populations was Pch_Hap_2 in Anyang City and Jiaozuo-Xinxiang areas, with moderate genetic differentiation (0.05 < FST < 0.15) and frequent gene exchange (Nm value > 1) between Ph. chinensis populations sampled from Anyang City, and Jiaozuo-Xinxiang areas. Population genetic structure analysis showed that the dominant component of Ph. chinensis populations was K5 in Anyang City and Jiaozuo-Xinxiang areas. No obvious dominant haplotype was observed in Ph. chinensis populations sampled from Zhengzhou-Luoyang-Xuchang areas, which had very high genetic differentiation (FST > 0.25) and little gene exchange (Nm value < 1) with Ph. chinensis populations from Anyang City, and Jiaozuo-Xinxiang areas, with K3 as the dominant component. In addition, there was no significant difference in the genetic polymorphism level among Se. squamirostris populations from the three areas. There are Ph. chinensis, Se. squamirostris and Se. bailyi in Henan Province, and S. bailyi is recorded for the first time in Henan Province by molecular biological assays. There are different levels of genetic differentiation and gene exchange among P. chinensis populations in different areas of Henan Province.

Comparative expression profile of selected genes in Venturia inaequalis Cooke (Wint.) infecting apple fruits and leaves

Scab is a noxious fungal disease of apples (Malus domestica Borkh) in all apple producing regions caused by a host-specific phytopathogen Venturia inaequalis Cooke (Wint.). Its symptoms include black or brown lesions on leaves as well as on fruits, and causes fruit deformation. In this study, V. inaequalis was isolated from infected fruit samples and expression level of selected pathogenesis related genes in scab infected fruits and leaves was studied. The isolated fungus formed a brown coloured mat-like colony having septate mycelium and produced acute ovoid shaped conidia. Molecular characterization of the fungus was done by amplification and sequencing of internal transcribed spacer (ITS) and Cytochrome (CYP51A1) regions of the isolate. The Sanger sequencing of amplicons and sequence analysis using BLAST tool of the NCBI against GenBank database confirmed that the obtained sequence of ITS and CYP51A1 regions had 99.6 % and 98 % sequence identity with the reference V. inaequalis, respectively. The isolated strain of V. inaequalis was submitted in the fungal repository of Microbial Type Culture Collection (MTCC), India. The phylogenetic analysis of ITS region of the isolate revealed that the isolated strain of V. inaequalis was more closely related to Fusicladium eriobotryae compared to other Venturia species. The expression levels of pathogenesis related genes viz. CIN1, CE5 and VICE16 were higher in infected leaves as compared to infected fruits. Whereas expression of VICE12 and GH28 were higher in infected fruits compared to infected leaves. VICE4 gene showed equal level of expression during infection in both fruits and leaves, which was also maximum as compared to the control treatment. The transcript analysis of aforementioned genes of V. inaequalis gives the insights of the pathogen's expression profile during pathogenesis in fruits and leaves. This expression analysis can form a basis selecting pathogenesis related genes as targets for developing dsRNA expressing constructs with an aim to reduce RNAi mediated silencing of specific genes, in a futuristic biotechnological based solution to deal with apple scab disease.

OrangeExpDB: an integrative gene expression database for Citrus spp.

BackgroundCitrus is a major fruit crop, and RNA-sequencing (RNA-seq) data can be utilized to investigate its gene functions, heredity, evolution, development, and the detection of genes linked to essential traits or resistance to pathogens. However, it is challenging to use the public RNA-seq datasets for researchers without bioinformatics training, and expertise.ResultsOrangeExpDB is a web-based database that integrates transcriptome data of various Citrus spp., including C. limon (L.) Burm., C. maxima (Burm.) Merr., C. reticulata Blanco, C. sinensis (L.) Osbeck, and Poncirus trifoliata (L.) Raf., downloaded from the NCBI SRA database. It features a blast tool for browsing and searching, enabling quick download of expression matrices for different transcriptome samples. Expression of genes of interest can be easily generated by searching gene IDs or sequence similarity. Expression data in text format can be downloaded and presented as a heatmap, with additional sample information provided at the bottom of the webpage.ConclusionsResearchers can utilize OrangeExpDB to facilitate functional genomic analysis and identify key candidate genes, leveraging publicly available citrus RNA-seq datasets. OrangeExpDB can be accessed at http://www.orangeexpdb.com/.

Rhizopus oryzae causes the leaf rot disease of Epimedium sagittatum in Guizhou, China.

Epimedium sagittatum is a collective term for herbaceous plants belonging to the family Berberidaceae. Their dried leaves and stems have significant therapeutic effects on tumor inhibition, hypertension control, and coronary heart disease (Ke et al. 2023; Zhao et al. 2019). In 2021 and 2022, plants with similar leaf rot symptoms ranging from 30% to 55% was observed on E. sagittatum in Congjiang County, Guizhou province. The initial symptoms of the disease manifest locally on the leaf, with yellowing on the surface edge of the affected tissue, browning in the middle part, and brown-white discoloration in the innermost part (Supplementary Figure S1B). As the disease progresses, the entire infected leaf gradually softens, while the veins remain intact (Supplementary Figure S1C). Ultimately, the leaf withers and dehisces. The nine samples with typical symptoms were collected from Congjiang County, Guizhou province (26.598°N, 106.707°E). Twenty-seven fungi were isolated, including ten isolates of Rhizopus and seventeen isolates of seven other genera. On isolate YYH-CJ-17 many sporangia were formed and turned to a brown-gray to black color on potato dextrose agar medium (PDA) after culturing 5 days under dark at 25 ℃ (Supplementary Figure S2A and S2B). The branches of mycelium were finger-shaped or root-shaped. The sporangium was spherical or nearly spherical, 60-250 µm in diameter, and sporangiospores were elliptical or spherical and 4-8 µm in diameter. The obtained 547 bp ITS fragment (accession OR225970) and 1231 bp EF-1α region (accession OR242258) from isolate YYH-CJ-17 were compared with NR database using the BLAST tool provided by NCBI, which revealed more than 99.5% identity (query cover more than 98%) with the sequences of ITS (accessions MF522822.1) and EF-1α (accession AB281541.1) of Rhizopus oryzae Went & H.C. Prinsen Geerlings (Gao et al. 2022; Zhang et al. 2022). The phylogenetic tree constructed with the ITS and EF-1α gene sequences demonstrates that strain YYH-CJ-17 clusters with R. oryzae in the same branch and the bootstrap value was greater than 99% (Supplementary Figure S3). Based on the morphological characteristics and ITS and EF-1a sequences, the isolate YYH-CJ-17 is identified as R. oryzae. Pathogenicity tests were performed on detached healthy leaves and living plants of E. sagittatum. Healthy leaves of E. sagittatum were subjected to inoculation with isolate YYH-CJ-17 with 5 × 105 CFU mL-1 concentration in sterile culture dishes. The progression of the disease was marked by the gradual softening of the infected leaves and the expansion of the lesions, which ultimately produced black-brown sporangium (Supplementary Figure S4A). Furthermore, the E. sagittatum living plants were sprayed with 5 × 105 CFU mL-1 conidial suspension of isolate YYH-CJ-17, with ddH2O as a negative control, and then were cultivated at 25℃ and 90% humidity for 21 days in the greenhouse. This assay found that the E. sagittatum leaves treated with isolate YYH-CJ-17 exhibited the same symptoms observed on plants in fields (Supplementary Figure S4B). The fungus re-isolated from the inoculated leaves were identified as R. oryzae by ITS sequencing and were blasted with NR database, which highest matched with the sequence of ITS (accessions MF522822.1) mentioned above, thus fulfilling Koch's postulates. R. oryzae has been identified as a causative agent of a diverse array of host diseases, including leaf mildew of tobacco, fruit rot of yellow oleander and pears, and soft rot of bananas (Farooq et al. 2017; Khokhar et al. 2019; Kwon et al. 2012; Pan et al. 2021). To the best of our knowledge, this is the first report of leaf rot on E. sagittatum caused by R. oryzae in China, which will provide clear prevention and management target for the leaf rot disease of E. sagittatum.

Redescription and new geographic distribution record of Dactylogyrus pharyngocephalus (Monogenea: Dactylogyridae) from tank goby Glossogobius giuris (Gobiidae, Teleostei) in Mizoram, northeast India.

Dactylogyrus pharyngocephalus is a dactylogyrid monogenean parasite originally described by Kulkarni, 1970 from tank goby Glossogobius giuris (Hamilton, 1822) in South India. The species has not been recorded since then. Fresh specimens of D. pharyngocephalus were collected from northeast India and examined morpho-molecularly. Temporary (glycerine mounted) and permanent (stained with Gomori's trichrome and DPX mounted) slides were made and photographed. Primer set C1 and D2 was employed to amplify a fragment of the 28S rRNA gene. The resulting nucleotide sequences, when examined by the BLAST tool, did not show 100% homology with any of the sequences deposited in GenBank. Based on new morpho-molecular data, the description of D. pharyngocephalus is revised, including the first description of its ventral bar.

The First Record of the Fungus Fusarium incarnatum (Desm.) Sacc., (1886) as a Potential Pathogen of Leaf Spot Disease on the Broad Bean Vicia faba L. in Iraq

Isolation of the fungus Fusarium incarnatum (Desm.) Sacc. was performed at the laboratories of the College of Agriculture at the University of Basrah from infected bean plants showing symptoms of fungal leaf. The fungus identity was revealed depending on phenotypic and microscopic examination, as well as a molecular technique have been applied using an ITS primer (Its1 and 4), the results of phylogenetic analysis with a similarity index of 98% according to NCBI –BLAST tool (LC769967). The pathogenicity was determined according to Koch’s postulates, and severe symptoms were examined on the leaves of the broad bean plants during testing. This record is a significant as it is the first report of F. incarnatum causing spot symptoms on broad bean plants in Iraq and worldwide.

Isolation and Identification of Dextran-Producing Weissella cibaria from Pickled Sauerkraut

The presence of certain bacteria in food products are particularly desirable. Probiotic strains of lactic acid bacteria (LAB), which have a number of favorable characteristics, including antimicrobial properties that support the development of beneficial microflora, are among them. In addition, because of their biochemical activity, they have an impact on the dietary, nutritional, and organoleptic qualities of food products. Before being released into the market, each strain must undergo independent testing to ascertain its probiotic qualities and potency. The purpose of this study was to separate and identify the LAB strain (Weissella cibaria bacteria) at the molecular level from a sample of pickled Sauerkraut that might be employed in the dairy sector and maybe is regarded as a probiotic in the future. Directly from the can, the shredded picked sauerkraut was brined in 2.25% salt (NaCl) for 48 hours before being inoculated aseptically into deMan, Rogosa, and Sharpe agar (MRS) and incubated for two days at 37 °C. Gram’s reaction, catalase production, and sugar fermentation tests employing glucose, sucrose, maltose, lactose, and fructose were among the traditional assays performed on isolation. The sequence was acquired and checked against those in the GenBank database using the BLAST tool at the NCBI-GenBank database after the isolate was extracted using the AccuPrep Genomic DNA Extraction kit, amplified, and agarose gel electrophoresis. The isolated LAB strains were validated using SEM and a genetic PCR assay, and the matching rate of the two isolated strains was 99%. The obtained strains showed their ability to produce dextran by observing the viscous growth characteristic when they were grown in MRS medium supplemented with 15% sucrose. To identify the bacterium, many culture and biochemical tests were carried out. The overall study concluded that the strains of Weissella cibaria bacteria can be easily isolated from pickled Sauerkraut using the developed procedure with the possibility of using the dextran produced by the bacteria as a prebiotic in the food sector.

Using custom-built primers and nanopore sequencing to evaluate CO-utilizer bacterial and archaeal populations linked to bioH2 production

The microbial community composition of five distinct thermophilic hot springs was effectively described in this work, using broad-coverage nanopore sequencing (ONT MinION sequencer). By examining environmental samples from the same source, but from locations with different temperatures, bioinformatic analysis revealed dramatic changes in microbial diversity and archaeal abundance. More specifically, no archaeal presence was reported with universal bacterial primers, whereas a significant archaea presence and also a wider variety of bacterial species were reported. These results revealed the significance of primer preference for microbiomes in extreme environments. Bioinformatic analysis was performed by aligning the reads to 16S microbial databases for identification using three different alignment methods, Epi2Me (Fastq 16S workflow), Kraken, and an in-house BLAST tool, including comparison at the genus and species levels. As a result, this approach to data analysis had a significant impact on the genera identified, and thus, it is recommended that use of multiple analysis tools to support findings on taxonomic identification using the 16S region until more precise bioinformatics tools become available. This study presents the first compilation of the ONT-based inventory of the hydrogen producers in the designated hot springs in Türkiye.

First Report of Tomato spotted wilt virus infecting Helichrysum bracteatum in China.

Strawflower (Helichrysum bracteatum, Asteraceae) , an annual or biennial herb, is one of the most popular flowers in the world because of the colorful flowers and the long flowering period. However, the ornamental plants belonging to Asteraceae are susceptible to numerous viruses such as cucumber mosaic virus (CMV) (Cucumovirus, Bromoviridae) , potato virus Y (Potyvirus, Potyviridae), tomato mosaic virus (ToMV) (Tobamovirus, Virgaviridae), tobacco mosaic virus (TMV) (Tobamovirus, Virgaviridae), chrysanthemum virus B (CVB) (Carlavirus, Betaflexiviridae), tomato aspermy virus (TAV) (Cucumovirus, Bromoviridae), tomato spotted wilt virus (TSWV) (Orthotospovirus tomatomaculae, Tospoviridae), and impatiens necrotic spot virus (INSV) (Orthotospovirus impatiensnecromaculae, Orthotospovirus) resulting in severe yield loss (Verma et al. 2003; Raj et al. 2007; Kondo et al. 2011; Liu et al. 2014; Marys et al. 2014; Min et al. 2020; Gautam et al. 2021; Read et al. 2022; Supakitthanakorn et al. 2022). Among these viruses, the TSWV, a thrips-transmitted negative-stranded RNA virus, is well known to cause viral disease in several plant species while is less reported in Helichrysum, especially in China. In April 2021, viral attack symptoms were detected on the leaves of H. bracteatum during our routine checks in the greenhouse located at Shunyi District, Beijing, China, such as wilting, shrinking, chlorotic blotches, chlorotic ring spots. To investigate the virus infecting H. bracteatum, in total of 25 symptomatic and 5 asymptomatic leaves were sampled and tested by the effective double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antisera against CMV, PVY/PVX, ToMV, TMV, CVB, TAV, TSWV, INSV, separately (Agdia, USA). Only the TSWV showed positive in symptomatic samples, and asymptomatic samples were all negative, which implied TSWV infection. To further confirm the virus type of TSWV isolated from H. bracteatum samples, the genomic RNA of the virus was isolated using reverse transcription and polymerase chain reaction (RT-PCR), and then was cloned, sequenced and analyzed. Total RNA of five symptomatic leaves (ELISA-positive) were extracted using the FastPure Plant Total RNA Isolation Kit (Vazyme, China), and then were reverse transcribed by HiScript II Reverse Transcriptase (Vazyme, China). Each genome segments were amplified using Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China) with TSWV-specific primers newly designed and listed in Table S1. The PCR setup was as follow: 95°C for 30 s, followed by 35 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 1.5 min, with a final extension at 72°C for 10 min. All PCR products were cloned into the TA/Blunt-Zero vector (Vazyme, China) and sequenced (GENEWIZ, Inc.). We assembled and then analyzed the evolutionary relationship of three genomic fragments, that is, TSWV-BJFC-Hb S (2923 bp), M (4785 bp) and L (8971 bp) using the BLAST tools. The results showed high similarity with TSWV-henan isolated from pepper in China (99.6% to TSWV-S (MT799179.1), 99.8 % to TSWV-M (MT799178.1) and 99.8 % TSWV-L (MT799177.1)). These sequences have been submitted to the GenBank (OM982910, OM982911 and OM937131). Taking all of these evidences together, the viral disease observed in H. bracteatum was closely associated with TSWV. TSWV is currently widespread in China, infecting Nasturtium, Chrysanthemum and cowpea (Xiao et al. 2015; Hu et al. 2018; Yu et al. 2021). Epidemics of TSWV have also been reported in several other countries such as Korea, North Carolina, Turkey and India (Renukadevi et al. 2015; Koehler et al. 2016; Kwak et al. 2021; Erilmez, S. 2022). This is the first report of TSWV infection on H. bracteatum in China. Due to the fast spread and serious economic losses of TSWV, the rapid detection may be the essential way to prevent this viral disease among crops (Macharia et al. 2014).

Morphological and Molecular Identification of Adoretus hirsutus (Ohaus, 1914) (Coleoptera:Scarabaeidae:Rutelinae) from Erbil Governorate Kurdistan Region- Iraq

This study provides a detailed description of Adoretus hirsutus (Ohaus, 1914) (Coleoptera:Scarabaeidae: Rutelinae), as a first record in Iraq. Between March and July 2022, we collected specimens from various weed flowers in different locations within the Erbil Governorate, Kurdistan Region, Iraq. According to molecular analysis, Adoretus hirsutus was used as a source of samples for PCR amplification of the fragments (710 bp) of the mtCOI gene for phylogenetic analysis. To compare the nucleotide sequence with those of other insect species, a section of the mtCOI gene from the collected insect was aligned with the NCBI GenBank database using the BLAST tool. The BLAST results showed that the second record in the NCBI GenBank identity of insects. The COI sequence of Adoretus hirsutus was submitted to GenBank with accession numbers OQ4288117, OQ428818, and OQ428819. The morphological diagnostic characteristics of the species are; Labrum nearly cup shaped, lateral margins moderately concave with a row of small spines, median apical projection overhanging the mentum. Mandibles irregular shaped, apically with single oval shaped tooth. Terminal maxillary palpomere 1.5 times as long as the 2nd. Antenna brown, consisting of 10 antennomeres ending in a unilateral three lamellated club, equal in length. Outer margin of fore tibia with three acute teeth. Aedagaeus moderately curved, parameres elongated oval, apical part is very acute. Some important parts such as labrum, mandible, antenna, fore legs, elytra, pygidium and male genitalia have been photographed.

Mining and identification of a biosynthetic gene cluster producing xanthocillin analogues from Penicillium chrysogenum MT-40, an endophytic fungus of Huperzia serrata

Xanthocillin is a unique natural product with an isonitrile group and shows remarkable antibacterial activity. In this study, the genome of an endophytic fungus Penicillium chrysogenum MT-40 isolated from Huperzia serrata was sequenced, and the gene clusters with the potential to synthesize xanthocillin analogues were mined by local BLAST and various bioinformatics analysis tools. As a result, a biosynthetic gene cluster (named for) responsible for the biosynthesis of xanthocillin analogues was identified by further heterologous expression of the key genes in Aspergillus oryzae NSAR1. Specifically, the ForB catalyzes the synthesis of 2-formamido-3-(4-hydroxyphenyl) acrylic acid, and the ForG catalyzes the dimerization of 2-formamido-3-(4-hydroxyphenyl) acrylic acid to produce the xanthocillin analogue N, N'-(1, 4-bis (4-hydroxyphenyl) buta-1, 3-diene-2, 3-diyl) diformamide. The results reported here provide a reference for further discovery of xanthocillin analogues from fungi.

Candidate effectors for leaf rust resistance gene Lr28 identified through transcriptome and in-silico analysis.

Puccinia spp. causing rust diseases in wheat and other cereals secrete several specialized effector proteins into host cells. Characterization of these proteins and their interaction with host's R proteins could greatly help to limit crop losses due to diseases. Prediction of effector proteins by combining the transcriptome analysis and multiple in-silico approaches is gaining importance in revealing the pathogenic mechanism. The present study involved identification of 13 Puccinia triticina (Pt) coding sequences (CDSs), through transcriptome analysis, that were differentially expressed during wheat-leaf rust interaction; and prediction of their effector like features using different in-silico tools. NCBI-BLAST and pathogen-host interaction BLAST (PHI-BLAST) tools were used to annotate and classify these sequences based on their most closely matched counterpart in both the databases. Homology between CDSs and the annotated sequences in the NCBI database ranged from 79 to 94% and with putative effectors of other plant pathogens in PHI-BLAST from 24.46 to 54.35%. Nine of the 13 CDSs had effector-like features according to EffectorP 3.0 (≥0.546 probability of these sequences to be effector). The qRT-PCR expression analysis revealed that the relative expression of all CDSs in compatible interaction (HD2329) was maximum at 11 days post inoculation (dpi) and that in incompatible interactions (HD2329 + Lr28) was maximum at 3 dpi in seven and 9 dpi in five CDSs. These results suggest that six CDSs (>0.8 effector probability as per EffectorP 3.0) could be considered as putative Pt effectors. The molecular docking and MD simulation analysis of these six CDSs suggested that candidate Lr28 protein binds more strongly to candidate effector c14094_g1_i1 to form more stable complex than the remaining five. Further functional characterization of these six candidate effectors should prove useful for a better understanding of wheat-leaf rust interaction. In turn, this should facilitate effector-based leaf rust resistance breeding in wheat.

Using of Integrons as Biomarker to Assess Dissemination and Diversity of Antimicrobial Resistance Genes in Farm Animal Manure

Antimicrobial agents are widely used for treatment of animal and human diseases. Heavy use of antimicrobial agents permits bacteria to develop resistance to these agents specifically when a dose of antibiotic is insufficient or course of treatment is incomplete. Antimicrobial resistance genes (ARGs) are usually associated with mobile genetic elements (MGEs) including Integron therefore; these genes can transmit among bacteria via horizontal transmission. The current study was conducted to assess the possible role of manure in dissemination of antimicrobial resistance. The presence, quantitate, and diversity of resistance genes associated with Integron class 1 have been assessed using conventional and quantitative polymerase chain reaction (PCR) combined with sequencing of gene cassette within Integron and analysis of sequenced data by blast tool. Thirty-eight samples were found a positive for Integron and concentration of Integron in positive sample ranged from from 106-1010 copies/g of manure. High frequencies were detected to genes that encoded to sulphonamide and ammonium compound resistance. These genes were detected in 25% and 23% respectively of the total manure samples. In general, the detected genes in manure functionally belong to five protein families including Efflux pump, DNA repair, heavy metal resistance, membrane protein, and antibiotic resistance. Manure might act as a hotspot from which ARGs emerge and transfer to the environment and then to the animal and human environments.

First report of Mal de Rio Cuarto Virus and a picorna-like virus naturally infecting rice (Oryza sativa) in Argentina.

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

IDENTIFICATION OF NOVEL TARGETS ENVIRONMENTAL STRESS TOLERANCE GENES IN PLANTS BY USING BIOINFORMATICS

The plant show retorts to the abiotic stresses which influence the biosynthesis of secondary metabolites in the plants. The current research identified novel genes in reference plants Prunus avium, Prunus persica, Mangifera indica, and Carica papaya, while as a model plant Arabidopsis thaliana was used. For this purpose, bioinformatics tools such as ORF, BLAST, and CDD tools were used. The Est of Prunus avium, Prunus persica, Mangifera indica, and Carica papaya were 30582, 26413, 38501, 20333 respectively. The genes HOS10, LOS4, MPK3, ELIP1, and DREB1A were analyzed through ORF, compared by BLAST, and CDD was used for searching of conserved domain database with nucleotide query coverage. The query coverage of all the genes in all four plants varies from 28% to 96% and the frame preferred are mostly +3 and +2, +1 is also present but in the very least form. The current research will help to comprehend the query coverage and define the identity of the selected genes in the cold and warm region's plants.