Blackcurrant Reversion Virus Research Articles

Effect of Viral Infection on the Ultrastructural Organization of Black Currant Leaf Tissue Cells

Effect of Viral Infection on the Ultrastructural Organization of Black Currant Leaf Tissue Cells

Analysis of R Genes Related to Blackcurrant Reversion Virus Resistance in the Comparative Transcriptome of Ribes nigrum cv. Aldoniai.

Blackcurrant reversion virus (BRV) is the most destructive mite-transmitted pathogen in blackcurrants. The understanding of the resistance to BRV is limited, hindering and delaying the selection process. To identify the resistance (R) gene for BRV resistance, a gene expression analysis based on de novo blackcurrant cv. Aldoniai comparative transcriptome analysis (mock- and BRV-inoculated samples at 2 and 4 days post-inoculation (dpi)) was performed. In this study, 111 annotated clusters associated with pathogenesis according to conservative R gene domains were identified. In virus-infected samples, only Cluster-12591.33361 showed significant expression at 4 dpi. The expression profiles of this cluster were significantly associated with the presence of BRV particles in plant tissues, making it a putative R gene in the dominant resistance strategy in the BRV-Ribes nigrum interaction. The newly identified gene R.nigrum_R belongs to the CC-NBS-LRR class and has 63.9% identity with RPM1 in Populus spp. This study provides new insights on dominant putative R genes related to resistance to BRV in R. nigrum, which could aid targeted research and genetic improvement in breeding programs of blackcurrants.

De Novo Transcriptome Analysis of R. nigrum cv. Aldoniai in Response to Blackcurrant Reversion Virus Infection.

The most damaging pathogen in blackcurrant plantations is mite-transmitted blackcurrant reversion virus (BRV). Some Ribes species have an encoded genetic resistance to BRV. We performed RNA sequencing analysis of BRV-resistant blackcurrant cv. Aldoniai to evaluate the molecular mechanisms related to the BRV infection response. The RNA of virus-inoculated and mock-inoculated microshoots was sequenced, and the transcriptional changes at 2- and 4-days post inoculation (dpi) were analyzed. The accumulation and expression of BRV RNA1 were detected in infected plants. In total, 159,701 transcripts were obtained and 30.7% were unigenes, annotated in 7 databases. More than 25,000 differentially expressed genes (DEGs) according to FPKM were upregulated or downregulated. We observed 221 and 850 DEGs at 2 and 4 dpi, respectively, in BRV-infected microshoots related to the stress response. The proportion of upregulated DEGs at 4 dpi was about 3.5 times higher than at 2 dpi. Pathways of the virus defense response were activated, and key candidate genes were identified. The phenylpropanoid and the cutin, suberine, and wax biosynthesis pathways were activated in infected plants. Our comparative de novo analysis of the R. nigrum transcriptome provides clues not only for understanding the molecular BRV resistance mechanisms but also for breeding BRV-tolerant genotypes.

An Effective Method of Ribes spp. Inoculation with Blackcurrant Reversion Virus under In Vitro Conditions.

Blackcurrant reversion virus (BRV) is the most destructive currant-infecting and mite-transmitted pathogen from the genus Nepovirus. In this work, BRV transmission in the system Ribes ex vitro–Ribes in vitro was applied for the first time. Triple infection of BRV identified in blackcurrant cv. Gojai was used for phylogenetic analysis and inoculation assay. Transmission of BRV was successful due to its stability in the inoculum for up to 8 days at 4 °C; all BRV isolates were infectious. Our suggested inoculation method through roots was applied in six Ribes spp. genotypes with 100.0% reliability, and the expression levels of defence-related gene PR1 to biotic stress was observed. The prevalence of the virus in microshoots after 2–14 days post-inoculation (dpi) was established by PCR. In resistant genotypes, the BRV was identified up to 8 dpi; meanwhile, infection remained constant in susceptible genotypes. We established that BRV transmission under controlled conditions depends on the inoculum quality, post-inoculation cultivation temperature, and host-plant susceptibility to pathogen. This in vitro inoculation method opens possibilities to reveal the resistance mechanisms or response pathways to BRV and can be used for the selection of resistant Ribes spp. in breeding programs.

Analyzing the 5′‐3′ Kissing‐Loop Interaction Sequence for Cap‐Independent Translation Initiation of Blackcurrant Reversion Virus

Translation regulation commonly involves the 5′‐m7GpppN cap which binds the initiation factor 4E bound to recruit the other initiation factors and the small ribosomal subunit. Yet some viruses, such as the Blackcurrant Reversion virus (BRV), have no 5′‐cap but are still able to translate using alternative mechanisms such as 3′ cap independent translation enhancers (3′ CITE). The 3′ CITEs in BRV’s bipartite genome are predicted to work like 4E by recruiting initiation factors and bringing them to the 5′ end for initiation of translation though a 5′‐3′ RNA kissing interaction, called the kissing‐loop interaction sequence (KIS). Our goal is to verify whether or not the KIS between the 5′ UTR and 3′ CITE exists to promote translation initiation. Using site‐directed mutagenesis and in vitro transcription, we created a series of KIS mutations (including compensatory mutations). Our preliminary in vitro luciferase translation experiments indicate the putative KIS between the 5′ UTR and 3′ CITE may not be important for translation initiation, however, we are currently working to verify these results and identify alternative KISs between the 5′ and 3′ ends. Although many CITEs use 5′‐3′ RNA kissing interactions to deliver translation machinery to the 5′ end of the genome, it is not required for CITE function. The BRV CITE may function through a protein bridge or some other unknown mechanism.

Significance of the Translation Initiation Machinery Recruiting Structures in the Blackcurrant Reversion Virus RNA 1

Unlike most eukaryotic translation which is initiated by the 5′‐m7GpppN cap (5′cap), the two genomic RNAs (RNA 1 and 2) from the Blackcurrant Reversion virus (BRV) do not have a 5′ cap but rather has special region in 3′ untranslated region (UTR) called a cap‐independent translation enhancer (CITE). CITE RNA structures bind translation initiation machinery and delivers that machinery to the 5′ UTR, typically via an RNA kissing‐loop interaction. Our research focuses on the specific RNA structures called translation initiation machinery recruiting structures (TIMRS) in the BRV RNA 1 3′ CITE and 5′ UTR, and their significance in facilitating translation by delivering translation machinery to the 5′ end of the RNA. Using site‐directed mutagenesis to alter the TIMRS and a luciferase reporter to measure protein production of the mutants, we are analyzing the relationship between structure and function. Thus far we have found altering the TIMRS in the 3′ CITE structure does show a difference in protein production compared to the wild type, which indicates the structures' significance and their contribution in translation efficiency. We believe the TIMRS is responsible for recruiting translation machinery or possibly the ability to “kiss” to 5′ UTR stem loop. This study can aid in understanding not only plant viruses but other animal or human RNA viruses that utilize 3′ or 5′ structures to regulate cap‐independent translation.

First Report of Blackcurrant-Associated Rhabdovirus in Blackcurrants in Latvia.

Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5' AGATGTGCTTCATCGATGGCTAGTTCTGCT 3') and BCaRV-N-R (5' TGCATTCCCACGGGTTAGGAATACATTGGTACT 3') resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.

Blackcurrant reversion virus (blackcurrant reversion disease)

Blackcurrant reversion virus (blackcurrant reversion disease)

Cecidophyopsis mites and blackcurrant reversion virus on Ribes hosts: Current scientific progress and knowledge gaps

AbstractThe production of Ribes (Rosaceae) in temperate regions in Europe, Asia and New Zealand is severely constrained by damages of Cecidophyopsis mites (Acari: Eriophyidae) and blackcurrant reversion virus (BRV) (Nepovirus, Secoviridae). The infestation of Ribes plants with Cecidophyopsis mites and BRV infection is a complex tripartite system. This paper reviews scientific progress and knowledge gaps on the Cecidophyopsis‐BRV‐Ribes complex emphasising Cecidophyopsis mites as a pest and natural vector of BRV, BRV as a pathogen, and Ribes as a host plant with horticultural significance. Cecidophyopsis species occurring on Ribes, their host range, geographic distribution and the role in BRV transmission is reviewed. Blackcurrant reversion disease symptoms and BRV hosts are analysed. Resistance of Ribes to Cecidophyopsis and BRV, and resistance breeding aspects are discussed. Discrepancies in research data, controversies and problems are highlighted, and further research is suggested to clarify some of the controversial aspects.

Mapping of sequences in the 5' region and 3' UTR of tomato ringspot virus RNA2 that facilitate cap-independent translation of reporter transcripts in vitro.

Tomato ringspot virus (ToRSV, genus Nepovirus, family Secoviridae, order Picornavirales) is a bipartite positive-strand RNA virus, with each RNA encoding one large polyprotein. ToRSV RNAs are linked to a 5'-viral genome-linked protein (VPg) and have a 3' polyA tail, suggesting a non-canonical cap-independent translation initiation mechanism. The 3' untranslated regions (UTRs) of RNA1 and RNA2 are unusually long (~1.5 kb) and share several large stretches of sequence identities. Several putative in-frame start codons are present in the 5' regions of the viral RNAs, which are also highly conserved between the two RNAs. Using reporter transcripts containing the 5' region and 3' UTR of the RNA2 of ToRSV Rasp1 isolate (ToRSV-Rasp1) and in vitro wheat germ extract translation assays, we provide evidence that translation initiates exclusively at the first AUG, in spite of a poor codon context. We also show that both the 5' region and 3' UTR of RNA2 are required for efficient cap-independent translation of these transcripts. We identify translation-enhancing elements in the 5' proximal coding region of the RNA2 polyprotein and in the RNA2 3' UTR. Cap-dependent translation of control reporter transcripts was inhibited when RNAs consisting of the RNA2 3' UTR were supplied in trans. Taken together, our results suggest the presence of a CITE in the ToRSV-Rasp1 RNA2 3' UTR that recruits one or several translation factors and facilitates efficient cap-independent translation together with the 5' region of the RNA. Non-overlapping deletion mutagenesis delineated the putative CITE to a 200 nts segment (nts 773-972) of the 1547 nt long 3' UTR. We conclude that the general mechanism of ToRSV RNA2 translation initiation is similar to that previously reported for the RNAs of blackcurrant reversion virus, another nepovirus. However, the position, sequence and predicted structures of the translation-enhancing elements differed between the two viruses.

Fundamental and practical bases for creating a blackcurrant field repository in Russia

Creating a virus-free repository of blackcurrant will allow an assessment of productivity, other qualitative characteristics and the use of pollen from healthy plants for breeding. The aim of the research was to reveal the most promising varieties and hybrids of blackcurrant, test plants for viruses and obtain nuclear stock plants for laying the repository. The studies were carried out in 2018-2020 using generally accepted methods of variety study, virus diagnosis and plants reproduction. Valuable blackcurrant varieties and hybrids of the All-Russian Horticultural Institute for Breeding, Agrotechnology and Nursery breeding were studied; the most productive clones were selected and tested by ELISA and PCR. The species composition of harmful viruses in the fruiting stands of blackcurrant under ex situ conditions is diverse. The total prevalence of Arabis mosaic virus (ArMV), Raspberry ringspot virus (RpRSV), Strawberry latent ringspot virus (SLRSV), Tomato black ring virus (TBRV) on blackcurrant plants was 31.5 %. The prevalence of SLRSV and RpRSV was about 15 %, TBRV – 14 %, ArMV – 7 %. Blackcurrant reversion virus (BRV) was absent. As a result of the monitoring carried out in 2018, blackcurrant plants of 8 varieties free from harmful viruses were identified and, after PCR, will be used to establish the repository and base mother nursery.

First Report of Black Currant Reversion Virus and Gooseberry Vein Banding Associated Virus in Currants in Bosnia and Herzegovina

Currants (Ribes spp.) are infected by at least 30 viruses (Koloniuk et al. 2018; Teifion Jones 2002), yet two are associated with the most important virus diseases of the crop: black currant reversion virus (BRV) for currant reversion and gooseberry vein banding associated virus (GVBaV) for the homonymous disease (Teifion Jones et al. 2001). BRV belongs to subgroup C of the genus Nepovirus of the family Comoviridae, whereas GVBaV is a member of genus Badnavirus, family Caulimoviridae (Petrzik et al. 2012). To this date, there is no information on the presence of either viruses in currant in Bosnia and Herzegovina (BiH). Surveys were carried out to assess the occurrence and diversity of the two viruses using high-throughput sequencing (HTS). Thirteen currant specimens (one red, one white, and 11 black) were collected in spring 2018 from commercial orchards in three localities (Travnik, Teslic, and Bugojno). Only three plants exhibited virus-like symptoms: the red currant (Ribes rubrum) from Travnik displayed leaf and flower malformation; the white currant and one black currant (R. nigrum) from Teslic showed yellow patterns and chlorosis on the upper canopy. RNA was extracted from seven samples (white, red, and black currants; both symptomatic and asymptomatic) using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, Germany) and further depleted of ribosomal RNA using the KAPA RNA Hyper+RiboErase HMR kit. Libraries were generated and sequenced on the Illumina NextSeq 500/550 platform in separate reactions. Sequence analysis using Virfind (Ho and Tzanetakis 2014) revealed the presence of BRV in the red currant plant with typical disease symptoms and an asymptomatic black currant (47 and 28 contigs respectively, from 105 to 1,584 bp) and GVBaV in an asymptomatic plant (17 contigs from 350 to 1,903 bp). Nucleic acids were extracted from all 13 samples using the Poudel et al. (2013) protocol that facilitated detection of both DNA and RNA viruses. Reverse transcription PCR (RT-PCR) and PCR analyses were performed with two pairs of virus-specific primers for BRV (F, 5′-GTAATACGCTGGTGTCTC-3′/R, 5′-GAAAGGACATTTCAGACTC-3′ and F, 5′-ATTTCGAGCTGTATGGTCG-3′/R, 5′-CTCGGAAGCAGTAGACCT-3′ [Lemmetty et al. 2001]) and for GVBaV (F, 5′-ACATCAAAGGGAAGGACAAC-3′/R, 5′-TCTAAAAGCATCCACTACCAC-3′ and F, 5′-TCAGACAGGCTCTCAACAATAC-3′/R, 5′-TTCTAAAAGCATCCACTACCAC-3′) (Jones et al. 2001). These assays identified an additional GVBaV-positive sample. All amplicons were sequenced, and BLAST analysis of the BRV sequences (GenBank accession nos. MK501976 to MK501978) and GVBaV (GenBank accession nos. MK519228 to MK519230) revealed 92 to 98% and 96 to 99% nucleotide identity to GenBank accessions AF321572 and JQ388488, respectively. The positive samples were further assessed for the presence of the viruses using northern-blot hybridization with a digoxigenin-labeled probe that targeted the nontranslated region of BRV RNA2 and conserved motifs in the ribonuclease H domain of GVBaV. The results were in line with HTS and PCR detection and with the symptoms expressed in the three symptomatic plants. In addition, the episomal form of GVBaV was confirmed by positive results in RT-PCR using DNase-treated total nucleic acids and rolling circle amplification. To our knowledge, this is the first time that BRV and GVBaV were detected in currants in BiH. Given the lack of a currant certification program in the country, this information will be used in the development of best management practices for control of the two viruses and their associated diseases in both field and nursery operations.

Application of marker-assisted selection for resistance to gall mite and Blackcurrant reversion virus in Ribes genus

Application of marker-assisted selection for resistance to gall mite and Blackcurrant reversion virus in Ribes genus

Small-RNA analysis of pre-basic mother plants and conserved accessions of plant genetic resources for the presence of viruses

Pathogen-free stocks of vegetatively propagated plants are crucial in certified plant production. They require regular monitoring of the plant germplasm for pathogens, especially of the stocks maintained in the field. Here we tested pre-basic mother plants of Fragaria, Rubus and Ribes spp., and conserved accessions of the plant genetic resources of Rubus spp. maintained at research stations in Finland, for the presence of viruses using small interfering RNA (siRNA) -based diagnostics (VirusDetect). The advance of the method is that unrelated viruses can be detected simultaneously without resumptions of the viruses present. While no virus was detected in pre-basic mother plants of Fragaria and Ribes species, rubus yellow net virus (RYNV) was detected in pre-basic mother plants of Rubus. Raspberry bushy dwarf virus (RBDV), black raspberry necrosis virus (BRNV), raspberry vein chlorosis virus (RVCV) and RYNV were detected in the Rubus genetic resource collection. The L polymerase encoding sequence characterized from seven RVCV isolates showed considerable genetic variation. The data provide the first molecular biological evidence for the presence of RYNV in Finland. RYNV was not revealed in virus indexing by indicator plants, which suggests that it may be endogenously present in some raspberry cultivars. In addition, a putative new RYNV-like badnavirus was detected in Rubus spp. Blackcurrant reversion virus (BRV) and gooseberry vein banding associated virus (GVBaV) were detected in symptomatic Ribes plants grown in the field. Results were consistent with those obtained using PCR or reverse transcription PCR and suggest that the current virus indexing methods of pre-basic mother plants work as expected. Furthermore, many new viruses were identified in the collections of plant genetic resources not previously tested for viruses. In the future, siRNA-based diagnostics could be a useful supplement for the currently used virus detection methods in certified plant production and thus rationalize and simplify the current testing system.

First Report of Blackcurrant Reversion Virus in Ribes nigrum Germplasm in the United States

Reversion disease, thought to be caused by the eriophyid mite transmitted blackcurrant reversion virus (BRV), is the most economically important disease of black currants (Ribes nigrum L.) and can be found nearly everywhere blackcurrants are cultivated except North America and Australia (Jones and McGavin 2002; Lemmetty et al. 1997; Susi 2004). BRV causes morphological changes to leaves and flowers, reduced flower bud hairiness, decreased plant vigor, sterility, and increased flower pigmentation (Jones and McGavin 2002; Susi 2004). Its host range is limited to the genus Ribes, and the virus rarely infects species other than R. nigrum. National quarantines have been used to prevent the movement of BRV and its vector, Cecidophyopsis ribis Westwood, into the U.S. However, BRV may have been introduced prior to the development of a reliable detection method (Jones and McGavin 2002). The R. nigrum cultivar Burga (PI 653058, from France) has abnormal leaf morphology and was evaluated using next generation sequencing (NGS) during the summer of 2016. During a preliminary analysis, a significant portion of the BRV genome was detected, warranting further investigation. In November 2016, RNA was extracted from leaves of ‘Burga’ and 11 other NCGR black currant accessions, several of which also exhibited suspicious leaf symptoms. RNA was extracted from two symptomatic leaves of each accession and bulked. These samples were assayed in triplicate by quantitative reverse transcription PCR (qRT-PCR) in Oregon for BRV using the iTaq One-Step SYBR green RT-PCR Kit (Bio-Rad Laboratories Inc, Hercules, CA). The primer pairs BRV1-8F/BRV1-8R, BRV1-10F/BRV1-10R, and BR1-F/BR3-R previously developed from BRV RNA-1 were used in conjunction with the recommended annealing conditions (Dolan et al. 2011; Jones and McGavin 2002). Four cultivars tested positive for BRV at the USDA-ARS NCGR: Bogatyr (PI 556413, from Germany); Burga; Minaj Shmyrev (PI 617766, from England); and an R. nigrum selection (PI 617781, from France). Amplicons generated from BR1-F/BR3-R from Bogatyr and Burga were sequenced (GenBank: MH078528-9) and showed greater than 96% identity to published BRV sequences when using BLASTx (ABL84271.1, ABL84276.1, AAO52686.1, AAO52685.1, ABL84275.1, AAO60043.1, AAO52687.1, NP_733982.2, AAO52684.1, and NP_612586.1). In summer 2018, total RNAs were extracted and sequenced again as described by Zheng et al. (2018) on an Illumina NextSeq 500 system. A total of 19,002,868 reads were generated and a de novo assembly was conducted with CLC genomics workbench. A BLASTx search was conducted using the contigs. Four contigs ranging from 178 to 335 bp assembled from 1,066 reads were found to match with the BRV genome with greater than 88% identity. Three of these contigs mapped to BRV RNA1 (MK302449) and one mapped to RNA2 (MK302450). The contigs account for 7% of the BRV genome. The vector, C. ribis, is not known to be present in North America and it is unknown if any mites endemic to North America could serve as vectors. Three of the infected clones have been growing at the NCGR for more than 20 years. These clones had been tested by a graft-bioassay when they entered the country and were thought to be BRV-free. At the time, this graft-bioassay was the only tool available for BRV detection, but it is not sufficient to enforce a BRV quarantine due to low virus concentrations in planta. Germplasm from the NCGR Ribes collection has been distributed to nurseries and research programs across North America as part of the National Plant Germplasm System. To ensure there has not been any spread and that other black currant clones in the NCGR collection are free of BRV, all 200 black currant clones in the collection will be tested for BRV. Distribution records of the four infected black currant accessions were used to identify where these clones have been shipped and the recipients of these materials have been notified.

Occurrence and genetic diversity of Blackcurrant reversion virus found on various cultivated and wild Ribes in Latvia

A large‐scale survey was carried out to assess the occurrence, natural host range and genetic diversity of Blackcurrant reversion virus (BRV) in cultivated and wild Ribes in Latvia using RT‐PCR and sequence analyses of 3′ NTR of BRV RNA2. The virus was detected in all surveyed habitats in most of the studied Ribes, except gooseberries, Ribes sanguineum, Ribes laxiflorum and crossbreeds between blackcurrants and gooseberries. The overall occurrence of BRV was 27%, although it varied significantly among the surveyed Ribes habitats, exceeding 40% in home gardens and germplasm collections. Among cultivated Ribes, blackcurrants were the most infected and BRV was detected in all commonly grown cultivars. The virus was detected for the first time in Ribes aureum, Ribes fragrans, Ribes nigrum var. pauciflorum and Ribes fasciculatum var. chinense. The sequence identities of the studied fragments of RNA2 3′ NTR varied from 92.8% to 99.7% among 26 BRV isolates from various cultivated, ornamental and wild hosts from Latvia and from 91.1% to 97.1% when they were compared with 27 corresponding sequences from GenBank. Phylogenetic analyses revealed that the major clustering of isolates was not related to host, origin or symptoms. Grouping of BRV isolates based on host or location was identified within the phylogenetic subclusters. Several well‐supported clades were formed within the subclusters, including a group of BRV isolates from redcurrants that had unique nucleotide substitutions. Five putative recombinants were identified for the first time among BRV isolates from Latvia, Finland, Scotland and the Czech Republic.

Molecular markers linked to resistance to the gall mite in blackcurrant

With 1 figure and 3 tables AbstractGall mite (Cecidophyopsis ribis Westw.) is one of the most damaging pests of blackcurrants (Ribes nigrum L.) and is a vector of blackcurrant reversion virus. Ce and P genes provide resistance of blackcurrant to gall mite. A linkage map around the resistance locus controlled by predicted P gene was constructed. Forty‐three amplified fragment length polymorphism (AFLP) and 19 microsatellite polymorphic markers obtained from analysis of the progeny obtained in cross with P gene donor ‘Dainiai’ were mapped. The obtained consensus map covers 691.196 cM, with an average marker spacing of 14.706 cM. AFLP fragment CTA‐ACC‐107 was closely linked to resistance to blackcurrant gall mite and was detected in the sixth linkage group. Screening of cultivars and hybrids with known resistance to gall mite confirmed that this dominant 107‐bp AFLP marker is linked to gall mite resistance in a comprehensive range of available Ribes germplasm with different genetic background and it may be used for early diagnosis of resistant to gall mite hybrids.

Complete nucleotide sequence and genome organisation of grapevine Bulgarian latent virus

The complete genome sequence of grapevine Bulgarian latent virus (GBLV) has been determined. RNA-1 (7,452 nt in length) contains a single ORF of 6,285 nt, encoding a polyprotein with conserved motifs characteristic of the viral protease cofactor (Prot-cofact), the NTP-binding protein (NTP), the cysteine-like protease (Cyst-Prot) and the RNA-dependent RNA polymerase (RdRp) of members of the order Picornavirales and show high aa sequence identity with blackcurrant reversion virus (BRV, 64%). RNA-2 (5,821 nt) contains a single ORF of 4,500 nt, encoding a polyprotein in which the conserved motifs of the movement protein (MP) and coat protein (CP) have been identified. The GBLV CP aa sequence shows highest homology with that of blueberry leaf mottle virus (BLMoV, 68%). Both RNAs have a poly(A) tail and a NCR at the 3' and 5' termini, respectively. The results of this study confirm the classification of GBLV as a member of a distinct species in subgroup C of the genus Nepovirus.

Blackcurrant reversion virus: Validation of an improved diagnostic test, accelerating testing in breeding and certification of blackcurrants

A study was commenced in 2005 to provide a validated diagnostic test for the detection of Blackcurrant reversion virus (BRV) to be used as an alternative to the conventional test recommended for use in the UK certification scheme. A range of cultivars previously virus indexed and held as nuclear stock (Baldwin, Ben Lomond and Ben Tirran) were grafted with known BRV-positive scions and assessed over the following four years. Data was collected through visual observations and buds sampled and tested with a single round RT-PCR using two new primer sets. For the method to be accepted for use in Scotland the detection rate must be equal or better than that of the existing grafting method. Statistical analysis of our results for the detection of both the European (E) and Russian (R) forms of Reversion disease in the three cultivars provides a validation for this test. We suggest that this method provides a faster throughput test for BRV even when no symptoms are visible on the plants, and so is suitable for adoption into the guidelines followed by both UK and European authorities for detection of BRV in blackcurrant propagation material.

Insertion of large amino acid repeats and point mutations contribute to a high degree of sequence diversity in the X4 protein of tomato ringspot virus (genus Nepovirus)

Tomato ringspot virus (ToRSV) is a serious pathogen of small fruits and fruit trees in North America [14]. Several ToRSV isolates have been described that differ in natural host range and intensity of symptoms in herbaceous hosts [3, 17]. Tomato ringspot virus is a species of the genus Nepovirus [15], which has recently been reassigned to the proposed new family ‘‘Secoviridae’’ (subfamily ‘‘Comovirinae’’) within the order Picornavirales [16]. Nepoviruses have a bipartite positive-strand RNA genome. Each RNA encodes a polyprotein that is cleaved by the viral proteinase (Pro) at specific cleavage sites. RNA1 encodes replication proteins, while RNA2 codes for the coat protein (CP), movement protein (MP) and other protein(s) of less defined function. Using in vitro processing assays, three proteinase cleavage sites have been identified in the RNA2encoded polyprotein of ToRSV (a subgroup C nepovirus), allowing the definition of four protein domains (X3, X4, MP and CP) [4, 5]. In contrast, only three protein domains are present in the polyprotein of subgroup A and B nepoviruses (2a, MP and CP; see Fig. 1a). The ToRSV X3 protein shares conserved sequence motifs with the 2a protein of subgroup A and B nepoviruses [12]. The 2a protein of grapevine fanleaf virus has been shown to play a role in the replication of RNA2 [7]. The ToRSV X4 protein does not have significant sequence identity with proteins available in the database and does not have a functional equivalent in the genome of nepoviruses of subgroups A and B (Fig. 1a). The only other nepovirus of subgroup C for which the entire nucleotide sequence is available is blackcurrant reversion virus (BRV). The extent of sequence identity between ToRSV and BRV is very low in the deduced amino acid (a.a.) sequence of the X4 protein (8%) but higher in the deduced a.a. sequence of the CP (29%), VPg (viral protein linked to the genome), Pro and polymerase (Pol) (36%). In this study, we examined the extent of sequence diversity in the X4 protein among closely related ToRSV isolates. We show that there is a high degree of sequence diversity in the X4 protein, which is due in part to the insertion of multiple copies of two types of large amino acid repeats.