Bidirectional Terminator Research Articles

Head-on and co-directional RNA polymerase collisions orchestrate bidirectional transcription termination

Genomic DNA is a crowded track where motor proteins frequently collide. It remains underexplored whether these collisions carry physiological function. In this work, we develop a single-molecule assay to visualize the trafficking of individual E.coli RNA polymerases (RNAPs) on DNA. Based on transcriptomic data, we hypothesize that RNAP collisions drive bidirectional transcription termination of convergent gene pairs. Single-molecule results show that the head-on collision between two converging RNAPs is necessary to prevent transcriptional readthrough but insufficient to release the RNAPs from the DNA. Remarkably, co-directional collision of a trailing RNAP into the head-on collided complex dramatically increases the termination efficiency. Furthermore, stem-loop structures formed in the nascent RNA are required for collisions to occur at well-defined positions between convergent genes. These findings suggest that physical collisions between RNAPs furnish a mechanism for transcription termination and that programmed genomic conflicts can be exploited to co-regulate the expression of multiple genes.

Complete Genome Sequence of Enterococcus faecalis Siphophage Sigurd.

ABSTRACTEnterococcus faecalis is associated with antibiotic-resistant infections, and this study presents E. faecalis siphophage Sigurd. The 41,811-bp Sigurd genome is divided into two arms defined by long convergent predicted transcription units that are separated by a bidirectional rho-independent terminator. Sigurd has a small terminase that is closely related to Bacillus subtilis cos phage phi105.

Design and development of Truncated Angle Variant (TAV) controller for multi-source-fed BLDC motor drive

In electric vehicles (EVs), the major role of BLDC motor is controlling the speed of a vehicle and effective breaking. This can be achieved by reducing the torque and managing the current flow in the motor. In recent researches, current-controlling methods in BLDC give the better way in controlling the speed of a motor. This research work focuses on the design of the speed control system. In this, EV is run by the battery connected with the photovoltaic (PV) system. The proposed work optimally controls the switching devices to manage power for BLDC motor. This extracts the properties of PV system with feedback signals of the bidirectional converter and motor terminals to evaluate the energy transfer level to EV. This can also reduce the decaying effect of battery, which is connected parallel to the converter. Since the proposed controller truncates the error signal with varying angle of vector quadrant named as Truncated Angle Variant (TAV) controller, this can also monitor the accelerator frequency that refers to the required speed of the BLDC motor. The experimental result shows the performance of proposed TAV-based controlling technique and the comparison of parameters with state-of-the-art methods is also made.

Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria.

The ability to determine full-length nucleotide composition of individual RNA molecules is essential for understanding the architecture and function of a transcriptome. However, experimental approaches capable of capturing the sequences of both 5’ and 3’ termini of the same transcript remain scarce. Here we present SEnd-seq—a high-throughput and unbiased method that simultaneously maps transcription start and termination sites with single-nucleotide resolution. Using this method, we obtain a comprehensive view of the Escherichia coli transcriptome, which displays an unexpected level of complexity. SEnd-seq significantly expands the catalog of transcription start sites and termination sites, defines unique transcription units, and detects prevalent antisense RNA. Strikingly, our results unveil widespread overlapping bidirectional terminators located between opposing gene pairs. We further show that convergent transcription is a major contributor to highly efficient bidirectional termination both in vitro and in vivo. This finding highlights an underappreciated role of RNA polymerase conflicts in shaping transcript boundaries and suggests an evolutionary strategy for modulating transcriptional output by arranging gene orientation.

Transcription termination sequences support the expression of transgene product secreted with milk.

Expression of the reporter gene in transgenic animals depends on the surrounding chromatin environment. Recent genome-wide studies have shown that, in mammals, the entire genome is transcribed. Transcription through a transgene often has a negative effect on the expression of a reporter gene. Here, we compared the ability of well-studied chicken chromatin insulator HS4 and bidirectional transcription terminators from the human genome to support high-level expression of the firefly luciferase gene (Fluc) under control of the previously characterized goat β-casein gene promoter. The insertion of HS4 or either of the two transcription terminators upstream of the promoter resulted in tenfold enhancement of Fluc expression in the mammary glands of transgenic mice. These results suggest that transcriptional terminators, similar to the HS4 insulator, can be used to improve the reporter gene expression in transgenic animals.

Rapid generation of sequence-diverse terminator libraries and their parameterization using quantitative Term-Seq.

Synthetic biology and the rational design and construction of biological devices require vast numbers of characterized biological parts, as well as reliable design tools to build increasingly complex, multigene architectures. Design principles for intrinsic terminators have been established; however, additional sequence-structure studies are needed to refine parameters for termination-based genetic devices. We report a rapid single-pot method to generate libraries of thousands of randomized bidirectional intrinsic terminators and a modified quantitative Term-Seq (qTerm-Seq) method to simultaneously identify terminator sequences and measure their termination efficiencies (TEs). Using qTerm-Seq, we characterize hundreds of additional strong terminators (TE > 90%) with some terminators reducing transcription read-through by up to 1000-fold in Escherichia coli. Our terminator library and qTerm-Seq pipeline constitute a flexible platform enabling identification of terminator parts that can achieve transcription termination not only over a desired range but also to investigate their sequence-structure features, including for specific genetic and application contexts beyond the common in vivo systems such as E. coli.

Genetic circuit characterization and debugging using RNA‐seq

Genetic circuits implement computational operations within a cell. Debugging them is difficult because their function is defined by multiple states (e.g., combinations of inputs) that vary in time. Here, we develop RNA‐seq methods that enable the simultaneous measurement of: (i) the states of internal gates, (ii) part performance (promoters, insulators, terminators), and (iii) impact on host gene expression. This is applied to a three‐input one‐output circuit consisting of three sensors, five NOR/NOT gates, and 46 genetic parts. Transcription profiles are obtained for all eight combinations of inputs, from which biophysical models can extract part activities and the response functions of sensors and gates. Various unexpected failure modes are identified, including cryptic antisense promoters, terminator failure, and a sensor malfunction due to media‐induced changes in host gene expression. This can guide the selection of new parts to fix these problems, which we demonstrate by using a bidirectional terminator to disrupt observed antisense transcription. This work introduces RNA‐seq as a powerful method for circuit characterization and debugging that overcomes the limitations of fluorescent reporters and scales to large systems composed of many parts.

Bidirectional terminators: an underestimated aspect of gene regulation.

Recent experimental and computational work revealed that transcriptional terminators in Saccharomyces cerevisiae can terminate transcription coming from both directions. This mechanism helps budding yeast cope with the pervasive nature of transcription by limiting aberrant transcription from invading neighboring genes.

Bidirectional terminators in Saccharomyces cerevisiae prevent cryptic transcription from invading neighboring genes

Transcription can be quite disruptive for chromatin so cells have evolved mechanisms to preserve chromatin integrity during transcription, thereby preventing the emergence of cryptic transcripts from spurious promoter sequences. How these transcripts are regulated and processed remains poorly characterized. Notably, very little is known about the termination of cryptic transcripts. Here, we used RNA-Seq to identify and characterize cryptic transcripts in Spt6 mutant cells (spt6-1004) in Saccharomyces cerevisiae. We found polyadenylated cryptic transcripts running both sense and antisense relative to genes in this mutant. Cryptic promoters were enriched for TATA boxes, suggesting that the underlying DNA sequence defines the location of cryptic promoters. While intragenic sense cryptic transcripts terminate at the terminator of the genes that host them, we found that antisense cryptic transcripts preferentially terminate near the 3΄-end of the upstream gene. This finding led us to demonstrate that most terminators in yeast are bidirectional, leading to termination and polyadenylation of transcripts coming from both directions. We propose that S. cerevisiae has evolved this mechanism in order to prevent/attenuate spurious transcription from invading neighbouring genes, a feature that is particularly critical for organisms with small compact genomes.

DNA uptake sequences in Neisseria gonorrhoeae as intrinsic transcriptional terminators and markers of horizontal gene transfer.

DNA uptake sequences are widespread throughout the Neisseria gonorrhoeae genome. These short, conserved sequences facilitate the exchange of endogenous DNA between members of the genus Neisseria. Often the DNA uptake sequences are present as inverted repeats that are able to form hairpin structures. It has been suggested previously that DNA uptake sequence inverted repeats present 3' of genes play a role in rho-independent termination and attenuation. However, there is conflicting experimental evidence to support this role. The aim of this study was to determine the role of DNA uptake sequences in transcriptional termination. Both bioinformatics predictions, conducted using TransTermHP, and experimental evidence, from RNA-seq data, were used to determine which inverted repeat DNA uptake sequences are transcriptional terminators and in which direction. Here we show that DNA uptake sequences in the inverted repeat configuration occur in N. gonorrhoeae both where the DNA uptake sequence precedes the inverted version of the sequence and also, albeit less frequently, in reverse order. Due to their symmetrical configuration, inverted repeat DNA uptake sequences can potentially act as bi-directional terminators, therefore affecting transcription on both DNA strands. This work also provides evidence that gaps in DNA uptake sequence density in the gonococcal genome coincide with areas of DNA that are foreign in origin, such as prophage. This study differentiates for the first time, to our knowledge, between DNA uptake sequences that form intrinsic transcriptional terminators and those that do not, providing characteristic features within the flanking inverted repeat that can be identified.

Defective DNAs of beet curly top virus from long-term survivor sugar beet plants

Long-term surviving sugar beet plants were investigated after beet curly top virus infection to characterize defective (D) viral DNAs as potential symptom attenuators. Twenty or 14 months after inoculation, 20 D-DNAs were cloned and sequenced. In contrast to known D-DNAs, they exhibited a large range of sizes. Deletions were present in most open reading frames except ORF C4, which encodes a pathogenicity factor. Direct repeats and inverted sequences were observed. Interestingly, the bidirectional terminator of transcription was retained in all D-DNAs. A model is presented to explain the deletion sites and sizes with reference to the viral minichromosome structure, and symptom attenuation by D-DNAs is discussed in relation to RNA interference.

Production of Hybrid-IgG/IgA Plantibodies with Neutralizing Activity against Shiga Toxin 1

Shiga toxin 1 (Stx1) is a virulence factor of enterohemorrhagic Escherichia coli, such as the O157:H7 strain. In the intestines, secretory IgA (SIgA) is a major component of the immune defense against pathogens and toxins. To form SIgA, the production of dimeric IgA that retains biological activity is an important step. We previously established hybrid-IgG/IgA having variable regions of the IgG specific for the binding subunit of Stx1 (Stx1B) and the heavy chain constant region of IgA. If hybrid-IgG/IgA cDNAs can be expressed in plants, therapeutic or preventive effects may be expected in people eating those plants containing a “plantibody”. Here, we established transgenic Arabidopsis thaliana expressing dimeric hybrid-IgG/IgA. The heavy and light chain genes were placed under the control of a bidirectional promoter and terminator of the chlorophyll a/b-binding protein of Arabidopsis thaliana (expression cassette). This expression cassette and the J chain gene were subcloned into a single binary vector, which was then introduced into A. thaliana by means of the Agrobacterium method. Expression and assembly of the dimeric hybrid-IgG/IgA in plants were revealed by ELISA and immunoblotting. The hybrid-IgG/IgA bound to Stx1B and inhibited Stx1B binding to Gb3, as demonstrated by ELISA. When Stx1 holotoxin was pre-treated with the resulting plantibody, the cytotoxicity of Stx1 was inhibited. The toxin neutralization was also demonstrated by means of several assays including Stx1-induced phosphatidylserine translocation on the plasma membrane, caspase-3 activation and 180 base-pair DNA ladder formation due to inter-nucleosomal cleavage. These results indicate that edible plants containing hybrid-IgG/IgA against Stx1B have the potential to be used for immunotherapy against Stx1-caused food poisoning.

Analysis of the Tomato spotted wilt virus Ambisense S RNA-Encoded Hairpin Structure in Translation

BackgroundThe intergenic region (IR) of ambisense RNA segments from animal- and plant-infecting (-)RNA viruses functions as a bidirectional transcription terminator. The IR sequence of the Tomato spotted wilt virus (TSWV) ambisense S RNA contains stretches that are highly rich in A-residues and U-residues and is predicted to fold into a stable hairpin structure. The presence of this hairpin structure sequence in the 3′ untranslated region (UTR) of TSWV mRNAs implies a possible role in translation.Methodology/Principal FindingsTo analyse the role of the predicted hairpin structure in translation, various Renilla luciferase constructs containing modified 3′ and/or 5′ UTR sequences of the TSWV S RNA encoded nucleocapsid (N) gene were analyzed for expression. While good luciferase expression levels were obtained from constructs containing the 5′ UTR and the 3′ UTR, luciferase expression was lost when the hairpin structure sequence was removed from the 3′ UTR. Constructs that only lacked the 5′ UTR, still rendered good expression levels. When in addition the entire 3′ UTR was exchanged for that of the S RNA encoded non-structural (NSs) gene transcript, containing the complementary hairpin folding sequence, the loss of luciferase expression could only be recovered by providing the 5′ UTR sequence of the NSs transcript. Luciferase activity remained unaltered when the hairpin structure sequence was swapped for the analogous one from Tomato yellow ring virus, another distinct tospovirus. The addition of N and NSs proteins further increased luciferase expression levels from hairpin structure containing constructs.Conclusions/SignificanceThe results suggest a role for the predicted hairpin structure in translation in concert with the viral N and NSs proteins. The presence of stretches highly rich in A-residues does not rule out a concerted action with a poly(A)-tail-binding protein. A common transcription termination and translation strategy for plant- and animal-infecting ambisense RNA viruses is being discussed.

Sense transcription through the S region is essential for immunoglobulin class switch recombination

Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands.

Taking phage integration to the next level as a genetic tool for mycobacteria

Genes must be stably integrated into bacterial chromosomes for complementation of gene deletion mutants in animal infection experiments or to express antigens in vaccine strains. However, with currently available vectors it is cumbersome to create multiple, stable, unmarked chromosomal integrations in mycobacteria. Here, we have constructed a novel integration vector for mycobacteria that enables expression of genes from a cassette protected from transcriptional interference by bi-directional transcriptional terminators proven to be highly efficient in in vitro transcription termination assays. Removal of the integrase gene by a site-specific recombinase, easily identifiable by loss of a backbone reporter gene, stabilizes the integration cassette and makes this vector ideally suitable for infection experiments. This integration vector can be easily adapted to different mycobacteriophage attachment sites ( attB) due to its modular design. Integration of a gfp expression cassette at the L5, Giles and Ms6 attB sites in the chromosomes of Mycobacterium smegmatis and Mycobacterium tuberculosis yielded identical gfp expression levels, indicating that none of these sites are compromised for gene expression. The copy number of pAL5000-based extrachromosomal plasmids is 23 in M. smegmatis as determined by quantitative real-time PCR and accounts for the previously observed drastic reduction of gene expression upon integration of plasmids into the chromosome of mycobacteria. Gfp expression and fluorescence of M. smegmatis and M. tuberculosis strains with multiple integrations of gfp increased concomitantly with the copy number demonstrating that these vectors can be used to generate stronger phenotypes and/or to analyze several genes simultaneously in vivo.

Hybrid Electric Vehicle Based on Bidirectional Z-Source Nine-Switch Inverter

Multiterminal converters are used in hybrid energy systems as a replacement for several conventional two-terminal converters to reduce volume and cost. This paper proposes a hybrid electric vehicle (HEV) based on a bidirectional z-source nine-switch inverter. A unidirectional z-source nine-switch inverter, which was proposed by the authors, has been improved to allow bidirectional power flow. The proposed converter has two ac and one dc bidirectional terminals that can be used in HEV. Performance of the proposed HEV has been verified by simulation and experimental results.

Structural organization of a complex family of palindromic repeats inEnterococci

Enterococcus faecalis/faecium repeats (EFARs) are miniature insertion sequences spread in the genome of Enterococcus faecalis and Enterococcus faecium. Unit-length repeats measure 165-170 bp and contain two modules (B and T) capable of folding independently into stem-loop sequences, connected by a short, unstructured module J. The E. faecalis elements feature only one type of B, J and T modules. In contrast, the E. faecium elements result from the assembly of different types of B, J and T modules, and may vary in length because they carry multiple B modules. Most EFARs are located close (0-20 bp) to ORF stop codons, and are thus cotranscribed with upstream flanking genes. In both E. faecalis and E. faecium cells, EFAR transcripts accumulate in a strand-dependent fashion. Data suggest that T modules function as bidirectional transcriptional terminators, which provide a 3'-end to gene transcripts spanning B modules, while blocking antisense transcripts coming in from the opposite direction.

Chance and necessity in chromosomal gene distributions

By analyzing the spacing of genes on chromosomes, we find that transcriptional and RNA-processing regulatory sequences outside coding regions leave footprints on the distribution of intergenic distances. Using analogies between genes on chromosomes and one-dimensional gases, we constructed a statistical null model. We used this to estimate typical upstream and downstream regulatory sequence sizes in various species. Deviations from this model reveal bi-directional transcriptional regulatory regions in Saccharomyces cerevisiae and bi-directional terminators in Escherichia coli.

Improvement of a nisin-inducible expression vector for use in lactic acid bacteria

The plasmid pMSP3535 is a popular vector for nisin-inducible expression of heterologous genes in lactic acid bacteria. However, the maximum protein expression level achievable with pMSP3535 is relatively low. In an effort to increase expression we modified pMSP3535 to create a high expression variant termed pMSP3535H2. Modifications included removal of a small NisA peptide fragment from the P nisA promoter and addition of a bidirectional transcription terminator. In addition the plasmid copy number was increased by replacing the pMSP3535 copy number control region with that of a high copy variant of the same replicon. As a result of these modifications, expression of two target proteins, the green fluorescent protein and the Escherichia coli antigen intimin, increased 5.0- and 7.5-fold, respectively. The increased range of inducible expression achieved with pMSP3535H2 will facilitate molecular studies in a range of lactic acid bacteria.

Whole genome sequencing of a novel temperate bacteriophage ofP. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.