Cardiac Beta-myosin Heavy Chain Gene Research Articles

A new common mutation in the cardiac beta-myosin heavy chain gene in Finnish patients with hypertrophic cardiomyopathy

Background. In the nationwide FinHCM Study including 306 Finnish patients with hypertrophic cardiomyopathy (HCM), we have previously identified two founder mutations in the alpha-tropomyosin (TPM1-D175N) and myosin-binding protein C (MYBPC3-Q1061X) genes, accounting for 18% of all cases.Objective. To screen additional mutations, previously identified in eastern Finnish cohorts with HCM, in the FinHCM Study population.Patients and methods. Ten mutations in the beta-myosin heavy chain gene (MYH7), TPM1, and MYBPC3 were screened.Results. MYH7-R1053Q was found in 17 of 306 patients (5.6%). No carriers of MYH7-R719W or N696S were found. A novel TPM1-D175G mutation was found in a single patient. MYBPC3 mutations were found in 14 patients: IVS5-2A-C in two, IVS14-13G-A in two, K811del in six, and A851insT in four patients. Altogether, a HCM-causing mutation was identified in 32 patients, accounting for 10.5% of all cases. In addition, two MYBPC3 variants R326Q and V896M with uncertain pathogenicity were found in eight and in 10 patients, respectively.Conclusion. Combining the present findings with our previous results, a causative mutation was identified in 28% of the FinHCM cohort. MYH7-R1053Q was the third most common mutation, and should be screened in all new cases of HCM in Finland.

Serial Observations and Mutational Analysis of an Adoptee with Family History of Hypertrophic Cardiomyopathy

Hypertrophic cardiomyopathy (HCM) is an inherited cardiac disease with an autosomal dominant mode of transmission. Comprehensive genetic screening of several genes frequently found mutated in HCM is recommended for first-degree relatives of HCM patients. Genetic testing provides the means to identify those at risk of developing HCM and to institute measures to prevent sudden cardiac death (SCD). Here, we present an adoptee whose natural mother and maternal relatives were known be afflicted with HCM and SCD. The proband was followed closely from age 6 to 17 years, revealing a natural history of the progression of clinical findings associated with HCM. Genetic testing of the proband and her natural mother, who is affected by HCM, revealed that they were heterozygous for both the R719Q and T1513S variants in the cardiac beta-myosin heavy chain (MYH7) gene. The proband's ominous family history indicates that the combination of the R719Q and T1513S variants in cis may be a “malignant” variant that imparts a poor prognosis in terms of the disease progression and SCD risk.

Abnormal blood pressure response to exercise occurs more frequently in hypertrophic cardiomyopathy patients with the R92W troponin T mutation than in those with myosin mutations

Abnormal blood pressure response to exercise is reported to occur in up to a third of hypertrophic cardiomyopathy (HCM) cases and is associated with an increased risk of death, particularly in the young, but it is not known whether the HCM-causing mutation influences blood pressure response to exercise. The purpose of this article is to ascertain whether the blood pressure response to exercise differs among carriers of the R92W mutation in the cardiac troponin T gene (TNNT2), which has been associated with an increased risk of sudden cardiac death in young males; carriers of mutations in the cardiac β-myosin heavy chain gene (MYH7); and their noncarrier relatives. Thirty R92WTNNT2 carriers, 51 MYH7 mutation carriers, and 68 of their noncarrier relatives were subjected to bicycle ergonometric exercise testing to assess blood pressure response to, as well as heart rate recovery after, exercise. Additional echocardiographic and demographic details were documented for all participants. R92WTNNT2 carriers demonstrated significantly more abnormal blood pressure responses to exercise (P = .021; odds ratio 3.03; confidence interval 1.13–8.12) and smaller increases in systolic blood pressure than MYH7 mutation carriers or related noncarrier control individuals. Although abnormal blood pressure response occurred at similar frequencies in males in all groups (23%–26%), the percentage of R92WTNNT2 females with abnormal blood pressure response was 64%, compared with 25% for MYH7 and 22% for noncarriers. Therefore, these results show that blood pressure response to exercise is influenced by genotype and gender in patients with HCM.

Cardiac -myosin heavy chain defects in two families with non-compaction cardiomyopathy: linking non-compaction to hypertrophic, restrictive, and dilated cardiomyopathies

Cardiomyopathies are classified according to distinct morphological characteristics. They occur relatively frequent and are an important cause of mortality and morbidity. Isolated ventricular non-compaction or non-compaction cardiomyopathy (NCCM) is characterized by an excessively thickened endocardial layer with deep intertrabecular recesses, reminiscent of the myocardium during early embryogenesis. Aims Autosomal-dominant as well as X-linked inheritance for NCCM has been described and several loci have been associated with the disease. Nevertheless, a major genetic cause for familial NCCM remains to be identified. Methods and Results We describe, in two separate autosomal-dominant NCCM families, the identification of mutations in the sarcomeric cardiac beta-myosin heavy chain gene (MYH7), known to be associated with hypertrophic cardiomyopathy (HCM), restricted cardiomyopathy (RCM), and dilated cardiomyopathy (DCM). Conclusion These results confirm the genetic heterogeneity of NCCM and suggest that the molecular classification of cardiomyopathies includes an MYH7-associated spectrum of NCCM with HCM, RCM, and DCM.

Mutations in the Genes for Sarcomeric Proteins in Japanese Patients With Onset Sporadic Hypertrophic Cardiomyopathy After Age 40 Years

This study was conducted to assess the hypothesis that mutations in the genes for sarcomeric proteins are the molecular cause for older-onset sporadic hypertrophic cardiomyopathy (HC) in Japanese patients. Molecular genetic approaches have demonstrated that familial HC is caused by mutations in genes encoding sarcomeric proteins. Recent studies have shown that sarcomeric gene mutations can also be a molecular cause of older-onset and/or sporadic HC. However, genetic studies to date have examined only a limited number of older Caucasian patients with HC. Clinical evaluations were performed in patients with HC onset after 40 years of age, and the sequence encoding the beta-cardiac myosin heavy chain, cardiac troponin T, cardiac troponin I, cardiac myosin binding protein-C, myosin ventricular regulatory light chain, and myosin ventricular essential light chain genes was analyzed. When a putative mutation was identified, clinical evaluations and genetic studies were subsequently performed on all first-degree relatives. Forty-one patients with sporadic HC onset after 40 years of age (31 men, 10 women; mean age 63+/-10 years at the time of study) were studied. Four novel missense mutations in the cardiac myosin binding protein-C gene (arginine to tryptophan at codon 160, glutamic acid to lysine at codon 334, glycine to arginine at codon 507, and threonine to methionine at codon 1,046) and a previously reported missense mutation in the beta-cardiac myosin heavy chain gene (arginine to histidine at codon 663) were identified in 5 of the 41 patients. No family members carried these mutations or had clinical evidence of HC. In conclusion, mutations in the cardiac myosin binding protein-C are the most common cause of older-onset sporadic HC in Japan.

Prevalence of cardiac beta-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy

Prevalence of cardiac beta-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy

Prevalence of cardiac beta-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy

Hypertrophic cardiomyopathy (HCM) is a frequent, autosomal-dominant cardiac disease and manifests predominantly as left ventricular hypertrophy. Mutations in the cardiac beta-myosin heavy chain gene (MYH7) are responsible for the disease in about 30% of cases where mutations were identified. We clinically evaluated a large group of 147 consecutive HCM patients from three cardiology centers in Germany, Poland, and Kyrgyzstan according to the same protocol. The DNA of the patients was systematically analyzed in the whole coding region of the MYH7 gene using PCR, single-strand conformation polymorphism analysis, and automated sequencing. Eleven different missense mutations (including seven novel ones) in 11 unrelated patients were identified, showing a mutation frequency of 7.5% in the study population. We further examined the families of five patients (three of German, one of Polish, and one of Kyrgyz origin) with 32 individuals in total. We observed a clear, age-dependent penetrance with onset of disease symptoms in the fourth decade of life. Genotype-phenotype correlations were different for each mutation, whereas the majority was associated with an intermediate/malign phenotype. In conclusion, we report a systematic molecular screening of the complete MYH7 gene in a large group of consecutive HCM patients, leading to a genetic diagnosis in 38 individuals. Information about the genotype in an individual from one family could be very useful for the clinician, especially when dealing with healthy relatives in doubt of their risk about developing HCM. The increasing application of genetic screening and the increasing knowledge about genotype-phenotype correlations will hopefully lead to an improved clinical management of HCM patients.

Role of mitogen-activated protein kinase pathway in reactive oxygen species-mediated endothelin-1-induced β-myosin heavy chain gene expression and cardiomyocyte hypertrophy

Endothelin-1 (ET-1) has been found to increase cardiac beta-myosin heavy chain (beta-MyHC) gene expression and induce hypertrophy in cardiomyocytes. ET-1 has been demonstrated to increase intracellular reactive oxygen species (ROS) in cardiomyocytes. The exact molecular mechanism by which ROS regulate ET-1-induced beta-MyHC gene expression and hypertrophy in cardiomyocytes, however, has not yet been fully described. We aim to elucidate the molecular regulatory mechanism of ROS on ET-1-induced beta-MyHC gene expression and hypertrophic signaling in neonatal rat cardiomyocytes. Following stimulation with ET-1, cultured neonatal rat cardiomyocytes were examined for 3H-leucine incorporation and beta-MyHC promoter activities. The effects of antioxidant pretreatment on ET-1-induced cardiac hypertrophy and mitogen-activated protein kinase (MAPKs) phosphorylation were studied to elucidate the redox-sensitive pathway in cardiomyocyte hypertrophy and beta-MyHC gene expression. ET-1 increased 3H-leucine incorporation and beta-MyHC promoter activities, which were blocked by the specific ET(A) receptor antagonist BQ-485. Antioxidants significantly reduced ET-1-induced 3H-leucine incorporation, beta-MyHC gene promoter activities and MAPK (extracellular signal-regulated kinase, p38, and c-Jun NH2 -terminal kinase) phosphorylation. Both PD98059 and SB203580 inhibited ET-1-increased 3H-leucine incorporation and beta-MyHC promoter activities. Co-transfection of the dominant negative mutant of Ras, Raf, and MEK1 decreased the ET-1-induced beta-MyHC promoter activities, suggesting that the Ras-Raf-MAPK pathway is required for ET-1 action. Truncation analysis of the beta-MyHC gene promoter showed that the activator protein-2 (AP-2)/specificity protein-1 (SP-1) binding site(s) were(was) important cis-element(s) in ET-1-induced beta-MyHC gene expression. Moreover, ET-1-induced AP-2 and SP-1 binding activities were also inhibited by antioxidant. These data demonstrate the involvement of ROS in ET-1-induced hypertrophic responses and beta-MyHC expression. ROS mediate ET-1-induced activation of MAPK pathways, which culminates in hypertrophic responses and beta-MyHC expression.

The val 606met mutation in the cardiac beta-myosin heavy chain gene in patients with familial hypertrophic cardiomyopathy is associated with a high risk of sudden death at young age

F hypertrophic cardiomyopathy (FHC) is a phenotypically and genetically heterogenous myocardial disease with an autosomal dominant pattern of inheritance. FHC is a frequent cause of sudden death in young people. Knowledge of morbidity and mortality associated with different mutations in the different sarcomere genes associated with FHC may prove to be of importance for clinical decisions concerning treatment, thus, leading to improved patient management. Hence, based on genotype-phenotype analyses, mutations in the MYBPC3 encoding the cardiac myosin-binding protein C gene have generally been associated with a low morbidity and mortality early in life.1 Mutations in the TNNT2 gene encoding cardiac troponin T have been associated with a high incidence of sudden death at young age,2,3 whereas the prognosis associated with different mutations in the MYH7 gene encoding the cardiac b-myosin heavy chain (bMHC) have been more variable.2 FHC families often have their own “private” mutation, and the prognosis of FHC may vary between, as well as within, families with the same mutation, thereby compromising the value of the genotyping. The ValMet mutation is often presented as the prototype of a “benign” MYH7 gene mutation.4–7 We report the unfavorable prognosis in a family with FHC associated with the ValMet mutation in the MYH7 gene and provide cumulated data on the incidence of sudden death at young age based on the present and previously published studies. • • • From a consecutive cohort of 70 families with FHC, family JO of Danish origin was included in the present study at the The Heart Center, Rigshospitalet, University of Copenhagen. After informed consent was given (Local Science Ethics Committee, Copenhagen. Protocol No. KF V92213), patient and family histories were obtained, and physical examination, electrocardiography, and transthoracic echocardiography were performed. The clinical diagnosis of FHC in relatives was based on: (1) electrocardiographic criteria: pathologic Q-waves or signs of left ventricular hypertrophy,8,9 and/or (2) echocardiographic criteria: a maximal left ventricular wall thickness of $13 mm,8,9 in the absence of evidence of other specific heart muscle diseases.10 For family members with disease, clinical records, family histories, or both were obtained whenever available. The clinical diagnosis was made before molecular genetic analysis. Blood samples were collected from probands and family members. Genomic DNA was extracted using a QIAamp DNA purification kit (Qiagen, Hilden, Germany). Mutation analysis of the MYH7 gene was performed using single-strand conformation polymorphism-heteroduplex (SSCP-HD) formation analysis on exons 3–23.11 Specifically for exon 16 the primers were 16F, GTGATGCTCTCTCCTGCTTCCTCA, and 16R, CCGGGAGCCTCAGTCCCTACTT. DNA preparations from 100 randomly selected Guthriecards were used as controls (Local Science Ethics Committee, Copenhagen. Protocol No. 01 to 119/99). Nucleotide sequence determination was performed by cycle sequencing using a Dye Deoxy Terminator Cycle Sequencing kit (Perkin Elmer, Foster City, California) on an ABI373 DNA sequencer (Perkin Elmer). The presently reported family, JO, were also screened for mutations in 7 other cardiac sarcomere genes known to be associated with FHC. The pedigree of family JO is shown in Figure 1. The proband (V:1, 45 years of age) was diagnosed at the age of 15 years. His previously asymptomatic son (VI:1) died suddenly at the age of 14 years. Postmortem examination confirmed the diagnosis of severe hypertrophic cardiomyopathy. The family history revealed 2 additional sudden deaths at young age (I:1 before 30 years of age and IV:1 at the age of 16 years). No additional information concerning these deaths was available. The proband’s sister (V:3, 40 years of age) has FHC, but only with few symptoms, despite pronounced septal hypertrophy and atrial fibrillation. Neither the proband’s mother nor father was available for inclusion in the study. The proband’s 2 daughters (VI:2, 23 years of age and VI:3, 16 years of age) both developed FHC during adolescence. Reports of syncope, nonsustained ventricular tachycardia on Holter monitoring, or abnormal blood pressure response during exercise, and the present family history, led to From the Department of Medicine B, The Heart Centre, Rigshospitalet, University of Copenhagen; and Department of Clinical Biochemistry, Statens Serum Institut, Copenhagen, Denmark. The study was supported by grants from The Danish Heart Foundation; The “Kong Christian den Tiendes Fond”; The Novo Nordisk Foundation; Director Emil C. Hertz and Inger Hertz’s Foundation; Danish Medical Association Research Foundation; and H:S—Copenhagen Hospital Corporation, Copenhagen, Denmark. Dr. Christiansen’s address is: Department of Clinical Biochemistry, Statens Serum Institut, 5 Artillerivej, DK-2300 S., Copenhagen, Denmark. E-mail: mic@ssi.dk. Manuscript received October 8, 2000; revised manuscript received and accepted December 28, 2000.

Beta-myosin Heavy Chain Gene Mutations and Hypertrophic Cardiomyopathy in Austrian Children

Hypertrophic cardiomyopathy occurs in two variants, either as an autosomal dominant familial disorder or as a sporadic disease without familial involvement. Different genes coding sarcomeric proteins of the heart have been identified as causing hypertrophic cardiomyopathy. Missense mutations in the cardiac beta-myosin heavy chain gene are found in 30% of all cases of familial hypertrophic cardiomyopathy. We screened the beta-myosin heavy chain gene of children of nine Austrian families with hypertrophic cardiomyopathy (referred to as group A) and of seven children with sporadic hypertrophic cardiomyopathy (referred to as group B). We were able to find two previously described (V606M, R453C) and two unknown missense mutations (V406M, R663H) in group A. Additionally, in two children of group B we could indentify one already known missense mutation, R249Q as well as one previously unknown missense mutation, M877K. The genetically affected children of group A developed no or only mild clinical symptoms, whereas the children of group B with genetically confirmed sporadic hypertrophic cardiomyopathy showed manifest left ventricular hypertrophy and clinical symptoms including chest pain and dyspnoe. Clinical symptoms among the adults of group A, suffering from familial hypertrophic cardiomyopathy, varied significantly. We therefore believe V406M to be a more malignant missense mutation, probably linked with sudden death in the affected family, than R663H, which seems to be more benign causing late-onset hypertrophic cardiomyopathy and mild clinical symptoms in the affected family members.

A novel missense mutation (R712L) adjacent to the "active thiol" region of the cardiac beta-myosin heavy chain gene causing hypertrophic cardiomyopathy in an Indian family.

A novel missense mutation (R712L) adjacent to the "active thiol" region of the cardiac beta-myosin heavy chain gene causing hypertrophic cardiomyopathy in an Indian family.

In vivo regulation of beta-MHC gene in rodent heart: role of T3 and evidence for an upstream enhancer.

Cardiac beta-myosin heavy chain (beta-MHC) gene expression is mainly regulated through transcriptional processes. Although these results are based primarily on in vitro cell culture models, relatively little information is available concerning the interaction of key regulatory factors thought to modulate MHC expression in the intact rodent heart. Using a direct gene transfer approach, we studied the in vivo transcriptional activity of different-length beta-MHC promoter fragments in normal control and in altered thyroid states. The test beta-MHC promoter was fused to a firefly luciferase reporter gene, whereas the control alpha-MHC promoter was fused to the Renilla luciferase reporter gene and was used to account for variations in transfection efficiency. Absolute reporter gene activities showed that beta- and alpha-MHC genes were individually and reciprocally regulated by thyroid hormone. The beta-to-alpha ratios of reporter gene expression demonstrated an almost threefold larger beta-MHC gene expression in the longest than in the shorter promoter fragments in normal control animals, implying the existence of an upstream enhancer. A mutation in the putative thyroid response element of the -408-bp beta-MHC promoter construct caused transcriptional activity to drop to null. When studied in the -3, 500-bp beta-MHC promoter, construct activity was reduced ( approximately 100-fold) while thyroid hormone responsiveness was retained. These findings suggest that, even though the bulk of the thyroid hormone responsiveness of the gene is contained within the first 215 bp of the beta-MHC promoter sequence, the exact mechanism of triiodothyronine (T3) action remains to be elucidated.

Expression of proto-oncogenes and gene mutation of sarcomeric proteins in patients with hypertrophic cardiomyopathy.

Several mutations of cardiac beta-myosin heavy chain (beta-MHC) gene were reported in patients with hypertrophic cardiomyopathy (HCM). Involvement of proto-oncogenes has been shown in the mechanism of experimental cardiac hypertrophy. This study sought to examine the effects of c-H-ras and c-myc expression in the steady-state myocardium on hypertrophic changes and to evaluate the possible interaction between beta-MHC mutation and proto-oncogene expression in HCM. Endomyocardial biopsy was performed in 17 HCM patients (5 beta-MHC mutations and 1 troponin T mutation) and 7 control subjects (no mutation). Reverse transcription-polymerase chain reaction analysis revealed c-H-ras expression in all members of both groups. Cardiomyocyte size was correlated with the expression level of c-H-ras (P<0.001), and c-H-ras expression was upregulated in HCM patients (P<0.01). HCM patients with a beta-MHC mutation had the higher c-H-ras expression than did control subjects or patients without a mutation (P<0.01). c-myc mRNA was expressed in 7 of 17 HCM patients but not in control subjects. Myocyte size was greater in c-myc-positive HCM patients than in control subjects and c-myc-negative HCM patients (P<0.001 and P<0.05, respectively). The proto-oncogene expression did not affect clinical findings, myocardial fibrosis, or disarray. In conclusion, c-H-ras and c-myc expression in the steady-state myocardium may play a role in the hypertrophic mechanism in HCM. It is possible that ss-MHC gene mutation has some effect on the regulation of proto-oncogene expression in HCM.

Sudden cardiac death in familial hypertrophic cardiomyopathy: are “benign” mutations really benign?

Familial hypertrophic cardiomyopathy (FHC) is an autosomal dominant disorder characterised predominantly by left ventricular hypertrophy and sudden cardiac death. Mutations in the cardiac beta-myosin heavy chain gene have been identified in several families and designated as "benign" or "malignant". We describe a family (family L) with a "benign" mutation in which early sudden cardiac death has occurred. The family was studied by clinical, electrocardiographic and echocardiographic assessment. DNA analysis involved screening for the six most common cardiac beta-myosin heavy chain gene mutations using allele specific oligonucleotide probes and restriction enzyme analysis. The Val606Met missense mutation was found. This mutation has been described in four families as being "benign" since it was associated with low penetrance and a near normal life span. Sudden cardiac death was an infrequent finding. In contrast, family L has a more malignant clinical picture with one sudden death in three affected individuals. The proband died suddenly at age 14 years during exercise. Designating gene mutations in FHC as benign or malignant has major clinical implications. As these mutations have only been described in a limited number of families, caution needs to be taken when interpreting genotype-phenotype correlations in this disorder.

Functional analysis of the mutations in the human cardiac beta-myosin that are responsible for familial hypertrophic cardiomyopathy. Implication for the clinical outcome.

More than 30 missense mutations in the beta-cardiac myosin heavy chain gene have been shown to be responsible for familial hypertrophic cardiomyopathy. To clarify the effects of these point mutations on myosin motor function, we expressed wild-type and mutant human beta-cardiac myosin heavy chains in insect cells with human cardiac light chains. The wild-type myosin was well purified with similar enzymatic and motor activities to those of the naturally isolated V3 cardiac myosin. Arg249-->Gln and Arg453-->Cys mutations resulted in decreased actin translocating activity (61 and 23% of the wild-type, respectively) with decreased intrinsic ATPase activity. Arg403-->Gln mutation greatly decreased actin translocating activity (27% of wild type) with a 3.3-fold increased dissociation constant for actin, while intrinsic ATPase activity was unchanged. Val606-->Met mutation only mildly affected the actin translocating activity as well as ATPase activity of myosin. The degree of deterioration by each mutation was closely correlated with the prognosis of the affected kindreds, indicating that myosin dysfunction caused by the point mutations is responsible for the pathogenesis of the disease. Structure/function relationship of myosin is discussed.

Clinical manifestations of hypertrophiccardiomyopathy with mutations in the cardiac beta-myosin heavy chain gene or cardiac troponin T gene

Introduction of molecular genetics has improved our understanding of HCM substantially, but has simultaneously raised further important questions. Studies on HCM are revealing a more complex picture than might have been expected on clinical grounds. Further extensive studies are warranted to elucidate the pathogenesis and pathophysiology of HCM, and to establish therapeutic strategies to cure or prevent the development of the disease.

DNA testing in familial hypertrophic cardiomyopathy: clinical and laboratory implications.

Counselling and clinical assessment in familial hypertrophic cardiomyopathy (FHC) is difficult, particularly in the young, since echocardiographic and ECG changes may not be diagnostic and clinical severity can vary. From 1990, when the beta-cardiac myosin heavy chain gene was implicated in the aetiology of FHC, considerable information about the molecular genetics of this disorder has emerged. However, an important question facing health professionals is the practical significance of DNA testing in FHC. The present study describes a DNA-based approach to screening for five commonly reported mutations involving the beta-cardiac myosin heavy chain gene. Approximately 11% of randomly selected families had an abnormality detected.

Missense mutation of the β‐cardiac myosin heavy‐chain gene in hypertrophic cardiomyopathy

Hypertrophic cardiomyopathy occurs as an autosomal dominant familial disorder or as a sporadic disease without familial involvement. We describe a missense mutation of the beta-cardiac myosin heavy chain (MHC) gene, a G to T transversion (741 Gly-->Trp) identified by direct sequencing of exon 20 in four individuals affected with familial hypertrophic cardiomyopathy. Three individuals with sporadic hypertrophic cardiomyopathy, whose parents are clinically and genetically unaffected, had sequence variations of exon 34 of the alpha-cardiac MHC gene (a C to T transversion, 1658 Asp-->Asp, resulting in FokI site polymorphism), of intron 33 of the alpha-cardiac MHC gene (a G to A and an A to T transversion), and also of intron 14 of the beta-cardiac MHC gene (a C to T transversion in a patient with Noonan syndrome). Including our case, 30 missense mutations of the beta-cardiac MHC gene in 49 families have been reported thus far worldwide. Almost all are located in the region of the gene coding for the globular head of the molecule, and only one mutation was found in both Caucasian and Japanese families. Missense mutations of the beta-cardiac MHC gene in hypertrophic cardiomyopathy may therefore differ according to race.

Structural interpretation of the mutations in the beta-cardiac myosin that have been implicated in familial hypertrophic cardiomyopathy.

In 10-30% of hypertrophic cardiomyopathy kindreds, the disease is caused by > 29 missense mutations in the cardiac beta-myosin heavy chain (MYH7) gene. The amino acid sequence similarity between chicken skeletal muscle and human beta-cardiac myosin and the three-dimensional structure of the chicken skeletal muscle myosin head have provided the opportunity to examine the structural consequences of these naturally occurring mutations in human beta-cardiac myosin. This study demonstrates that the mutations are related to distinct structural and functional domains. Twenty-four are clustered around four specific locations in the myosin head that are (i) associated with the actin binding interface, (ii) around the nucleotide binding site, (iii) adjacent to the region that connects the two reactive cysteine residues, and (iv) in close proximity to the interface of the heavy chain with the essential light chain. The remaining five mutations are in the myosin rod. The locations of these mutations provide insight into the way they impair the functioning of this molecular motor and also into the mechanism of energy transduction.

Identification of gene defects by linkage analysis: use in inherited cardiomyopathies.

One of the central activities of current medical (including cardiological) research is identification of the causes of inherited diseases. The goals are the determination of genes and risk factors, introduction of new diagnostic standards and ultimately refinement of therapies. In cardiac disorders, molecular causes have been detected for certain types of hypertrophic cardiomyopathy (HCM), a disease characterized by increased ventricular wall thickness, a high risk of arrhythmias and an increased frequency of sudden cardiac death. The first known cause of HCM was a point mutation in the cardiac beta-myosin heavy chain gene on chromosome 14, detected using a genetic mapping procedure based on linkage of the clinical phenotype with genomic marker sequences. Additional missense mutations have been located in the globular head of beta-myosin, and other disease loci have been identified on chromosomes 1, 11, and 15; the disease genes in these loci have not yet been determined, however.