Beijing Genomics Institute Research Articles

Government and Commercial Interests in Genomics: Improving Data Security and Regulation

The relationship between new technologies and security is well established in the fields of defence, law enforcement, communications and public health. This has been highlighted by recent public debate about the security implications of data held by companies operating in social media and information technology (such as TikTok and Huawei). While genomic technology had been less high profile in the context of security, this changed following the COVID-19 pandemic, which focused attention on the significant implications of this form of data. This article discusses commercial genomic technology, related government interests and the growing implications for data security and regulation, such as through the example of the Beijing Genomics Institute, a large company providing genomic testing services to consumers worldwide. We suggest that commercial genomic data has growing implications for countries such as the United States and Australia and argue for greater attention to be directed to this form of technology and associated data security and regulation, including security assessment to address the risks associated with international transfer via corporate entities.

A Combined Manual Annotation and Deep-Learning Natural Language Processing Study on Accurate Entity Extraction in Hereditary Disease Related Biomedical Literature

We report a combined manual annotation and deep-learning natural language processing study to make accurate entity extraction in hereditary disease related biomedical literature. A total of 400 full articles were manually annotated based on published guidelines by experienced genetic interpreters at Beijing Genomics Institute (BGI). The performance of our manual annotations was assessed by comparing our re-annotated results with those publicly available. The overall Jaccard index was calculated to be 0.866 for the four entity types—gene, variant, disease and species. Both a BERT-based large name entity recognition (NER) model and a DistilBERT-based simplified NER model were trained, validated and tested, respectively. Due to the limited manually annotated corpus, Such NER models were fine-tuned with two phases. The F1-scores of BERT-based NER for gene, variant, disease and species are 97.28%, 93.52%, 92.54% and 95.76%, respectively, while those of DistilBERT-based NER are 95.14%, 86.26%, 91.37% and 89.92%, respectively. Most importantly, the entity type of variant has been extracted by a large language model for the first time and a comparable F1-score with the state-of-the-art variant extraction model tmVar has been achieved.Graphical

Homologous recombination deficiency (HRD) status and response to platinum-based chemotherapy and PARP inhibitors in Chinese patients with ovarian cancer.

e17533 Background: The association between platinum-based chemotherapy and PARPis response and HRD status in Chinese epithelial ovarian cancer patients has not been fully elucidated. Methods: We assessed homologous recombination deficiency (HRD) score using genomic scar analysis (GSA) algorithm of Beijing Genomics Institute (BGI) assay. The definitive HRD status were determined by combining HRD score tested with the BGI assay and homologous recombination repair (HRR) gene mutation status. We then tested the association of HRD with response to platinum-based chemotherapy and PARP inhibitors in Chinese patients with ovarian cancer. Results: In total, 209 patients with definitive HRD status were included: 66.0% (138 of 209) for HRD and 34.0% (71 of 209) for non-HRD. Patients with HRD tumors were more likely to have a larger tumor (73.9% vs 59.2%, P = 0.029), and less likely to receive neoadjuvant chemotherapy (48.6% vs 67.6%, P = 0.009). No differences were found between patients with HRD and non-HRD tumors in age at diagnosis, histology, stage, postoperative residual disease status. In the entire cohort, patients with HRD tumors were more likely to be platinum sensitive with a platinum-free interval (PFI) of > 6 months than those with non-HRD (79.6% vs 65.7%, P=0.030). Patients with HRD had a significantly better PFS and OS than patients with non-HRD in the entire study population (PFS: unadjusted HR = 0.54, 95% CI: 0.38–0.77, P = 0.001; and OS: unadjusted HR = 0.44, 95% CI: 0.26–0.75, P = 0.002). Multivariate analysis showed that patients with HRD was an independent predictor of increased PFS and OS (PFS: HR = 0.56, 95% CI: 0.39-0.82, P = 0.002; OS: HR = 0.50, 95% CI: 0.29-0.86, P = 0.012). In patients who received PARPis as first-line maintenance (n=55), the median duration of PARPis was 23.3 months (1.2-40.0 months) and 11.0 months (1.4-39.1 months) in HRD and non-HRD subgroup, respectively. Patients with HRD had a significantly better PFS than non-HRD patients (median PFS: NR vs 22.5 months, unadjusted HR = 0.39, 95% CI: 0.16-0.97, P = 0.035). Multivariate analysis showed that patients with HRD was an independent predictor of increased PFS (HR = 0.22, 95% CI: 0.07-0.68, P = 0.008). Conclusions: Patients with HRD tumors are more likely to respond to platinum-based chemotherapy and PARPis when compared with those who are non-HRD. HRD tumors associate with a better survival in Chinese ovarian cancer patient.

The performance of metagenomic next-generation sequencing in diagnosing pulmonary infectious diseases using authentic clinical specimens: The Illumina platform versus the Beijing Genomics Institute platform.

Introduction: Metagenomic next-generation sequencing (mNGS) has been increasingly used to detect infectious organisms and is rapidly moving from research to clinical laboratories. Presently, mNGS platforms mainly include those from Illumina and the Beijing Genomics Institute (BGI). Previous studies have reported that various sequencing platforms have similar sensitivity in detecting the reference panel that mimics clinical specimens. However, whether the Illumina and BGI platforms provide the same diagnostic performance using authentic clinical samples remains unclear. Methods: In this prospective study, we compared the performance of the Illumina and BGI platforms in detecting pulmonary pathogens. Forty-six patients with suspected pulmonary infection were enrolled in the final analysis. All patients received bronchoscopy, and the specimens collected were sent for mNGS on the two different sequencing platforms. Results: The diagnostic sensitivity of the Illumina and BGI platforms was notably higher than that of conventional examination (76.9% vs. 38.5%, p < 0.001; 82.1% vs. 38.5%, p < 0.001; respectively). The sensitivity and specificity for pulmonary infection diagnosis were not significantly different between the Illumina and BGI platforms. Furthermore, the pathogenic detection rate of the two platforms were not significantly different. Conclusion: The Illumina and BGI platforms exhibited similar diagnostic performance for pulmonary infectious diseases using clinical specimens, and both are superior to conventional examinations.

Benchmarking of ATAC Sequencing Data From BGI's Low-Cost DNBSEQ-G400 Instrument for Identification of Open and Occupied Chromatin Regions.

Background: Chromatin falls into one of two major subtypes: closed heterochromatin and euchromatin which is accessible, transcriptionally active, and occupied by transcription factors (TFs). The most widely used approach to interrogate differences in the chromatin state landscape is the Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq). While library generation is relatively inexpensive, sequencing depth requirements can make this assay cost-prohibitive for some laboratories. Findings: Here, we benchmark data from Beijing Genomics Institute’s (BGI) DNBSEQ-G400 low-cost sequencer against data from a standard Illumina instrument (HiSeqX10). For comparisons, the same bulk ATAC-seq libraries generated from pluripotent stem cells (PSCs) and fibroblasts were sequenced on both platforms. Both instruments generate sequencing reads with comparable mapping rates and genomic context. However, DNBSEQ-G400 data contained a significantly higher number of small, sub-nucleosomal reads (>30% increase) and a reduced number of bi-nucleosomal reads (>75% decrease), which resulted in narrower peak bases and improved peak calling, enabling the identification of 4% more differentially accessible regions between PSCs and fibroblasts. The ability to identify master TFs that underpin the PSC state relative to fibroblasts (via HOMER, HINT-ATAC, TOBIAS), namely, foot-printing capacity, were highly similar between data generated on both platforms. Integrative analysis with transcriptional data equally enabled direct recovery of three published 3-factor combinations that have been shown to induce pluripotency. Conclusion: Other than a small increase in peak calling sensitivity for DNBSEQ-G400 data (BGI), both platforms enable comparable levels of open chromatin identification for ATAC-seq library sequencing, yielding similar analytical outcomes, albeit at low-data generation costs in the case of the BGI instrument.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milošević et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

Analysis of the methods and quality assurance of metagenomic next-generation sequencing to detect the microbial cfDNA from blood samples in China

Objective: To investigate the methods and quality assurance of metagenomic next-generation sequencing (mNGS) to detect the microbial cfDNA (mcfDNA) from blood samples in different laboratories across China. Methods: In October 2020, questionnaires about detecting mcfDNA in blood samples with mNGS were distributed to 80 laboratories across the country. The questionnaire included four parts: pre-analysis, during analysis, post-analysis, and carrying out of performance validation for mNGS. (1) Pre-analysis: the requirements for samples quality, such as collection, storage, the transportation conditions of samples; (2) During analysis: the extraction workflows of mcfDNA, the quality requirements of the library, the application of the sequencing platforms and the bioinformatics analysis pipelines; (3) Post-analysis: the standard of interpretation results for mNGS; (4) Carrying out of performance validation: the minimum detection limit for various pathogens. All laboratories are required to fill in the questionnaire according to the actual situation. The feedback data were summarized and analyzed. Results: The 80 laboratories included 20 medical centers and 60 independent medical laboratories. There were 80.0% (64/80) of laboratories indicated that both plasma and serum samples were used to detect mcfDNA in blood, and the rest of the laboratories (16/80, 20.0%) only used plasma samples. The sequencing platforms used by mNGS laboratories involved in the survey included illumina (49), Beijing Genomics Institute (16), Ion Torrent (13) and Nanopore sequencing (2). There were 87.5% (70/80) of laboratories used the integrated analysis tools built by the third-party laboratories, and other laboratories (12.5%, 10/80) independently built the analysis platform by open-source software. The interpretation criteria of mNGS results varied between laboratories, among which the normalized number of pathogen-specific sequences, relative abundance, genome coverage rate, and the detection of the microorganism in the negative control were the main factors considered by laboratories. Most laboratories (76.3%, 61/80) had carried out the performance validation for the mcfDNA mNGS workflows. The limit of detection of the laboratories-developed mNGS workflows for Gram-positive bacteria, Gram-negative bacteria, fungi, parasites, and other pathogens were mainly distributed at 10-100 copies/ml, DNA virus was mainly distributed at 500-1 000 copies/ml. Conclusions: The mNGS workflows of various laboratories are very different. In order to ensure timely and accurate testing results, every laboratory needs to actively optimize the mNGS testing procedures, improve quality assurance measures, and carry out performance validation before mNGS is widely used in clinical settings.

An optimization of four SARS-CoV-2 qRT-PCR assays in a Kenyan laboratory to support the national COVID-19 rapid response teams.

Background:The COVID-19 pandemic relies on real-time polymerase chain reaction (qRT-PCR) for the detection of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), to facilitate roll-out of patient care and infection control measures. There are several qRT-PCR assays with little evidence on their comparability. We report alterations to the developers' recommendations to sustain the testing capability in a resource-limited setting. Methods:We used a SARS-CoV-2 positive control RNA sample to generate several 10-fold dilution series that were used for optimization and comparison of the performance of the four qRT-PCR assays: i) Charité Berlin primer-probe set, ii) European Virus Archive - GLOBAL (EVAg) primer-probe set, iii) DAAN premixed commercial kit and iv) Beijing Genomics Institute (BGI) premixed commercial kit. We adjusted the manufacturer- and protocol-recommended reaction component volumes for these assays and assessed the impact on cycle threshold (Ct) values. Results:The Berlin and EVAg E gene and RdRp assays reported mean Ct values within range of each other across the different titrations and with less than 5% difference. The DAAN premixed kit produced comparable Ct values across the titrations, while the BGI kit improved in performance following a reduction of the reaction components. Conclusion:We achieved a 2.6-fold and 4-fold increase in the number of tests per kit for the commercial kits and the primer-probe sets, respectively. All the assays had optimal performance when the primers and probes were used at 0.375X, except for the Berlin N gene assay. The DAAN kit was a reliable assay for primary screening of SARS-CoV-2 whereas the BGI kit's performance was dependent on the volumes and concentrations of both the reaction buffer and enzyme mix. Our recommendation for SARS-CoV-2 diagnostic testing in resource-limited settings is to optimize the assays available to establish the lowest volume and suitable concentration of reagents required to produce valid results.

16S rRNA gene sequencing reveals an altered composition of gut microbiota in children with Mycoplasma pneumoniae pneumonia treated with azithromycin.

Mycoplasma pneumoniae is one of the most important pathogens causing community acquired pneumonia in children, and the pathogenic mechanism of M. pneumoniae infection is complex. Azithromycin is an effective agent for treating the acquired lower respiratory tract infection and urogenital tract infection with slight adverse reactions. This study aimed to compare the intestinal microflora before (PP1) and after azithromycin intervention (PP2) in children with pneumonia caused by M. pneumoniae, combined with body fluid biochemical analysis to determine the intestinal flora affecting the progress of the disease. Fifteen children diagnosed with M. pneumoniae pneumonia were recruited. The fecal samples and clinical biochemical data were collected. 16S rRNA gene amplicon sequencing and bioinformatics analysis were conducted by the Beijing Genomics Institute. The operational taxonomic unit abundance analysis showed significant differences between the two groups. The species richness analysis showed differences in class, family, genus, order, species, and phylum. The abundance of Haemophilus, Pasteurellales, and Pasteurellaceae was found to be significantly higher in the PP1 group. The Pearson correlation analysis showed that the microbes strongly correlated with the clinical features. 16S rRNA gene sequencing data revealed altered composition of gut microbiota in children with M. pneumoniae pneumonia treated with azithromycin. The altered expression of microbes correlated with clinical features, which might help diagnose and treat the disease.

Clinical evaluation of RB1 genetic testing reveals novel mutations in Vietnamese patients with retinoblastoma.

Clinical evaluation of the genetic testing strategy is essential for ensuring the correct determination of mutation carriers. The current study retrospectively analyzed genetic and clinicopathological data from 62 Vietnamese patients with retinoblastoma (RB) referred to the Vinmec Hi-Tech Center for RB transcriptional corepressor 1 (RB1) genetic testing between 2017 and 2019. The present study aimed to evaluate the sensitivity of the Next Generation Sequencing (NGS) method to identify novel RB1 mutations, and to consider using age at diagnosis as a risk factor. Genomic DNA was analyzed with custom panel based targeted NGS. NGS was performed on the Beijing Genomics Institute (BGI) sequencing platform, and pathogenic or likely pathogenic variants were confirmed by Sanger sequencing, quantitative PCR (qPCR) or Multiplex Ligation-dependent Probe Amplification assay (MLPA). Constitutional RB1 variants were identified in 100% (25/25) of the bilateral cases, while several common previously reported RB1 mutations were also recorded. In addition, in Vietnamese patients with RB, nine novel RB1 mutations were identified. Children aged between 0-36 months were more likely to be RB1 carriers compared with those aged >36 months. The current findings indicated that the NGS method implemented in the Vinmec Hi-Tech Center was highly accurate, and age at diagnosis may be used to assess the risk of hereditary RB. Furthermore, the newly identified RB1 mutations may provide additional data to improve the current understanding of the mechanisms underlying RB1 inactivation and the development of rapid assays for detecting RB1 mutations. Overall, the present study suggested that NGS may be applied for detecting germline RB1 mutations in routine clinical practice.

Aberrant microRNA expression in B lymphocytes from patients with primary warm autoimmune haemolytic anaemia

Objective To screen and analyze the micro-Ribonucleic Acid (miRNA) expression profile in B lymphocytes from patients with autoimmune haemolytic anaemia (AIHA) using high-throughput sequencing. Methods Twelve patients with warm autoimmune haemolytic anaemia (wAIHA) and twelve healthy controls (HCs) were enrolled. CD19+ B lymphocytes were isolated and purified using magnetic activated cell sorting (MACS). RNA was subsequently extracted from these cells and a small RNA library was created. The miRNA expression profile was analyzed using Beijing Genomics Institute Sequencing 500 (BGISEQ-500), and stem-loop real-time quantitative PCR (stem-loop qRT-PCR) was used to verify the sequencing results. Downstream target genes of the differentially expressed miRNAs were predicted using miRanda and TargetScan online software, and GO functional enrichment and pathway enrichment analyses were performed on these genes. Results Compared with HCs, 178 upregulated and 143 downregulated miRNAs were identified in wAIHA patients, and stem-loop qRT-PCR of four randomly selected differentially expressed miRNAs verified the sequencing results. Ninety-five significantly enriched GO terms and eighty-five significantly enriched pathways were identified. Genes targeted by differentially expressed miRNAs were found to be mainly involved in the regulation of signal transduction, metabolic processes, immune reactions, and neoplastic disease development. Conclusion The expression of miRNAs in B lymphocytes from patients with primary wAIHA was deregulated, and this phenomenon may be involved in the pathogenesis of wAIHA.

Sequencing BGI: the evolution of expertise and research organisation in the world’s leading gene sequencing facility

The increasing importance of computational techniques in post-genomic life science research calls for new forms and combinations of expertise that cut across established disciplinary boundaries between computing and biology. These are most marked in large scale gene sequencing facilities. Here new ways of organising knowledge production, drawing on industrial models, have been perceived as pursuing efficiency and control to the potential detriment of academic autonomy and scientific quality. We explore how these issues are played out in the case of BGI (Beijing Genomics Institute prior to 2008). BGI (in Pinyin, Hua Da Jiyin– Big China Genome) is today the world’s largest centre for gene sequencing research. Semi-detached from traditional academic institutions, BGI has developed distinctive models for organising research and for developing expertise, informed by practices in US Information Technology and Life Science Laboratories, that differ from existing models of interdisciplinary research in academic institutions.

An Increase of Phosphatidylcholines in Follicular Fluid Implies Attenuation of Embryo Quality

Background: Although oocyte quality is the dominant factor determining embryo development, while the metabolites related with oocyte are sensitive to reflect the alive oocyte, there is few study to take the metabolites in follicular fluid (FF), a microenvironment of oocyte living, for evaluation of embryo quality. Methods: The FFs were donated from the patients who received in vitro fertilization-embryo transfer or intracytoplasmic sperm injection. The embryo quality was preliminarily judged by the development status of embryo on day 3 under microscope. The extracted metabolomes in the FFs were quantitated with triple quadrupole mass spectrometer. Based on the metabolomic datasets, the statistical tools such as Wilcoxon rank-sum tests, principle component analysis and random forest were employed under unsupervised or supervised condition to seek a discrimination panel for good or poor embryo. Weighted gene co-expression network analysis was taken to find out the pathway linkages among the panel metabolites. Findings: An evaluation model consisting of 17 features was generated to distinguish the embryo quality and phosphatidylcholines were the key contributors for the evaluation. The model was extended to the patients under different age and hyperstimulations and the features were further enriched to facilitate the evaluation of embryo quality. The metabolites were clustered through pathway analysis, leading a hypothesis that accumulation of arachidonic acid induced by phosphatidylcholines might weaken embryo quality. Interpretation: As the metabolomics in FF reflects the metabolite exchanges between oocyte and its microenvironment, the corresponding changes in FF are likely to setup a new assessment to oocyte or embryo. Funding Statement: This work was supported by the National Key Research and Development Program of China (2017YFC0906703, 2016YFC1000200 and 2018YFC1003100), the National Natural Science Foundation of China (81873478), the Science and Technology Major Project of the Ministry of Science and Technology of Hunan Province, China (2017SK1030), and Hunan Provincial Grant for Innovative Province Construction (2019SK4012). Declaration of Interests: Authors declare no competing interests. Ethics Approval Statement: This study was approved by the Ethics Committee of the Reproductive and Genetic Hospital of CITIC-XIANGYA (reference LLSC-2018-036) and Beijing Genomics Institute (BGI) (reference BGI-IRG 20035).

Periplaneta americana Extracts Accelerate Liver Regeneration via a Complex Network of Pathways.

Successful recovery from hepatectomy is partially contingent upon the rate of residual liver regeneration. The traditional Chinese medicines known as Periplaneta americana extracts (PAEs) positively influence wound healing by promoting tissue repair. However, the effect of PAEs on liver regeneration is unknown. We used a mouse liver regeneration model after 70% partial hepatectomy (PH) and a hepatocyte culture to determine whether PAEs can promote liver regeneration as effectively as skin regeneration and establish their modes of action. L02 cells were divided into serum-starved control (NC) and three PAEs (serum starvation + 0.1 mg/ml, 0.5 mg/ml, or 1 mg/ml PAEs) groups. L02 cell proliferation was assessed at 24 h, 48 h, and 72 h by CCK-8 assay. Forty male C57 mice were randomly divided into control (NC), normal saline (NS), PAEs400 (400 mg/kg/d), and PAEs800 (800 mg/kg/d) groups (n = 10 per group). The NS and both PAEs groups were administered normal saline and PAEs, respectively, by gavage for 10 days. Two hours after the tenth gavage, the NS and both PAEs groups were subjected to 70% PH and the residual liver was harvested after 48 h. The hepatic regeneration rate was evaluated and hepatocyte proliferation was estimated by immunohistochemical (IHC) staining for Ki-67. Twelve DEG libraries (three samples per group) were prepared and sequencing was performed in an Illumina HiSeq 2000 (Mus_musculus) at the Beijing Genomics Institute. The genes expressed in the liver tissues and their expression profiles were analyzed by bioinformatics. KEGG was used to annotate, enrich, and analyze the pathways. PAEs promoted hepatocyte proliferation in vitro and in vivo and accelerated mouse liver regeneration after 70% PH. The screening criteria were fold change (FC) ≥ 2 and q-value < 0.001. We identified 1,092 known DEGs in PAEs400 and PAEs800. Of these, 153 were categorized in cellular processes. The KEGG analysis revealed that the aforementioned DEGs participated in several signaling pathways closely associated with cell proliferation including PI3K-Akt, MAPK, Apelin, Wnt, FoxO, mTOR, Ras, VEGF, ErbB, Hippo, and AMPK. It was concluded that PAEs can effectively improve liver regeneration via the synergistic activation of different signaling pathways.

Viral Small RNA-Based Screening of Malus spp. Reveals Citrus Leaf Blotch Virus Infection of Kaido Crab Apple in China

Viral Small RNA-Based Screening of <i>Malus</i> spp. Reveals Citrus Leaf Blotch Virus Infection of Kaido Crab Apple in China

An optimisation of four SARS-CoV-2 qRT-PCR assays in a Kenyan laboratory to support the national COVID-19 rapid response teams.

Background: The global COVID-19 outbreak relies on a quantitative real-time polymerase chain reaction (qRT-PCR) for the detection of severe acute respiratory syndrome coronavirus (SARS-CoV-2), to facilitate the roll-out of patient care and infection control measures. There are several qRT-PCR assays with little evidence on their comparability. We report alterations to the developers' recommendations to sustain the testing capability in our setting, where the supply of testing reagents is limited. Methods: Standards generated from a serially-diluted positive control and previously identified positive/negative samples were used to determine the optimal volumes of the qRT-PCR reagents and to evaluate the validity and performance of four assays: Charité Berlin and European Virus Archive - GLOBAL (EVAg) primer-probe sets, and DAAN and Beijing Genomics Institute (BGI) premixed commercial kits. A multiplex and singleplex RT-PCR kit was used with the two primer-probe sets and the recommended assay volumes of the two premixed kits were altered. Results: In comparison to the multiplex RT-PCR kit, the singleplex RT-PCR kit combined with the primer-probe sets yielded consistent cycle threshold (Ct) values across the different titrations tested. The DAAN premixed kit produced comparable Ct values across the titrations, while the BGI kit showed incomparable Ct values and inconsistent results between batches using the manufacturer's recommended volumes. Conclusion: We achieved a 2.5-fold and 4-fold increase in the number of tests/kit for the premixed kits and the primer-probe sets, respectively. The primer-probe set assays were reliable and consistent, and we preferred a combination of an EVAg and a Berlin target. Any inconclusive result was repeated by different individuals following the same protocol. DAAN was a consistent and reliable assay even at lower concentrations from the stated recommendations. BGI in contrast, required dilution to improve its performance and was hence an assay that was used in combination with EVAg or Berlin targets.

Whole genome sequencing of a multidrug-resistant Bacillus thuringiensis HM-311 obtained from the Radiation and Heavy metal-polluted soil

ObjectivesBacillus thuringiensis (BT) is distributed widely in the environment and utilised frequently for its highly specific toxins to target insect. However, BT is potentially pathogenic due to the high similarity between BT and Bacillus anthracis (BA). Meanwhile, there are reports that heavy metal pressure can promote the proliferation of antibiotic resistance in microorganisms through the co-selection of metal resistance genes (MRGs) and antibiotic resistance genes (ARGs). The aim of this work was revealed the MRGs and ARGs in a novel heavy metal tolerant and drug-resistant strain – B. thuringiensis HM-311, which was isolated from radiation and heavy metal-contaminated soil in Xinjiang (China). MethodsThe genome of B. thuringiensis HM-311 was sequenced using a PacBio RS II platform and Illumina HiSeq 4000 platform at the Beijing Genomics Institute (BGI, Shenzhen, China). ResultsThe total size of B. thuringiensis HM-311 genome was 6,019,481bp with a GC content of 35.85%. 134 genes related to antibiotics resistance and 75 genes related to heavy metal resistance were predicted in the B. thuringiensis HM-311 genome, the main ARGs and MRGs were discussed. Moreover, 30 verified virulence factor genes and 297 predicted virulence factor genes were annotated in the B. thuringiensis HM-311 genome. ConclusionsThis genome can be used as a reference sequence for comparative genomic studies, elucidating antibiotic resistance development and the relationship between antibiotic resistance genes and heavy metal resistance genes in B. thuringiensis.

Modifier genes in SCN1A‐related epilepsy syndromes

Background SCN1A is one of the most important epilepsy‐related genes, with pathogenic variants leading to a range of phenotypes with varying disease severity. Different modifying factors have been hypothesized to influence SCN1A‐related phenotypes. We investigate the presence of rare and more common variants in epilepsy‐related genes as potential modifiers of SCN1A‐related disease severity.Methods87 patients with SCN1A‐related epilepsy were investigated. Whole‐exome sequencing was performed by the Beijing Genomics Institute (BGI). Functional variants in 422 genes associated with epilepsy and/or neuronal excitability were investigated. Differences in proportions of variants between the epilepsy genes and four control gene sets were calculated, and compared to the proportions of variants in the same genes in the ExAC database.ResultsStatistically significant excesses of variants in epilepsy genes were observed in the complete cohort and in the combined group of mildly and severely affected patients, particularly for variants with minor allele frequencies of <0.05. Patients with extreme phenotypes showed much greater excesses of epilepsy gene variants than patients with intermediate phenotypes.ConclusionOur results indicate that relatively common variants in epilepsy genes, which would not necessarily be classified as pathogenic, may play a large role in modulating SCN1A phenotypes. They may modify the phenotypes of both severely and mildly affected patients. Our results may be a first step toward meaningful testing of modifier gene variants in regular diagnostics for individual patients, to provide a better estimation of disease severity for newly diagnosed patients.

Transcriptome analysis of the almond moth, Cadra cautella, female abdominal tissues and identification of reproduction control genes

BackgroundThe almond moth, Cadra cautella is a destructive pest of stored food commodities including dates that causes severe economic losses for the farming community worldwide. To date, no genetic information related to the molecular mechanism/strategies of its reproduction is available. Thus, transcriptome analysis of C. cautella female abdominal tissues was performed via next-generation sequencing (NGS) to recognize the genes responsible for reproduction.ResultsThe NGS was performed with an Illumina Hiseq 2000 sequencer (Beijing Genomics Institute: BGI). From the transcriptome data, 9,804,804,120 nucleotides were generated and their assemblage resulted in 62,687 unigenes. The functional annotation analyses done by different databases, annotated, 27,836 unigenes in total. The transcriptome data of C. cautella female abdominal tissue was submitted to the National Center for Biotechnology Information (accession no: PRJNA484692). The transcriptome analysis yielded several genes responsible for C. cautella reproduction including six Vg gene transcripts. Among the six Vg gene transcripts, only one was highly expressed with 3234.95 FPKM value (fragments per kilobase per million mapped reads) that was much higher than that of the other five transcripts. Higher differences in the expression level of the six Vg transcripts were confirmed by running the RT-PCR using gene specific primers, where the expression was observed only in one transcript it was named as the CcVg.ConclusionsThis is the first study to explore C. cautella reproduction control genes and it might be supportive to explore the reproduction mechanism in this pest at the molecular level. The NGS based transcriptome pool is valuable to study the functional genomics and will support to design biotech-based management strategies for C. cautella.

First Report of Grapevine Geminivirus A in Vitis in New Zealand

Grapevine geminivirus A (GGVA), a member of the family Geminiviridae, was originally described from the United States on Vitis vinifera, cultivars Black Beet and Nagano Purple, imported from Korea (Al Rwahnih et al. 2017). Since its initial characterization, GGVA has also been reported from the United States, China, and Korea in diverse Vitis spp. (Al Rwahnih et al. 2017; Fan et al. 2017; Jo et al. 2016). The transmission of GGVA by means of a vector and the economic impact of this virus are still unknown. In 2016, a small-scale, untargeted virus survey was done to assess the efficacy of high-throughput sequencing of small RNA (sRNA). Leaf samples from 20 vines were collected from the New Zealand Winegrowers’ germplasm collection, Lincoln, New Zealand. During the survey, GGVA was identified in an asymptomatic sample of Vitis vinifera, an interspecific cross Seibel 7052 (VID 280). sRNA was extracted using a mirVana miRNA Isolation Kit (Thermo Fisher Scientific). A library was prepared using the TruSeq Small RNA Sample Prep Kit (Illumina) and sequenced with 50-bp single-end reads (small RNA-Seq) on an Illumina HiSeq2000 at the Beijing Genomics Institute (Hong Kong), and a total of 32.6 million reads was obtained. When the reads were mapped to the reference sequence of GGVA (GenBank accession no. KX618694), 163,611 reads were assembled with a mean coverage level of 1,183× across the genome, yielding a near complete 2,902-nt GGVA genome sequence. Mapping was done using Bowtie2 (version 2.2.4) (Langmead and Salzberg 2012). Three viruses (grapevine leafroll-associated virus 2, grapevine rupestris stem pitting associated virus, and grapevine asteroid mosaic associated virus) and one viroid (hop stunt viroid) were also detected in this sample using the YABI Virus Surveillance and Diagnosis (VSD) toolkit (Barrero et al. 2017). The grapevine was resampled in July 2018, and the full genome was amplified by PCR using two abutting primers, 23-1F/2R (Fan et al. 2017). BLAST analysis of the sequence obtained (2,905 nt; GenBank accession no. MK690474) showed 99% nt similarity to the full genome of GGVA isolate Tamar (GenBank accession no. KX618694). The virus was detected in only one vine out of 20 (from 12 different cultivars) sequenced by sRNA-Seq from the same germplasm collection. Twenty additional grapevine samples from the South Island tested negative for GGVA by a species-specific PCR using the primers V1-F1/1R (Fan et al. 2017). To the best of our knowledge, this is the first report of GGVA in New Zealand.