Begonia Plants Research Articles

Genomic divergence and mutation load in the Begonia masoniana complex from limestone karsts

Understanding genome-wide diversity, inbreeding, and the burden of accumulated deleterious mutations in small and isolated populations is essential for predicting and enhancing population persistence and resilience. However, these effects are rarely studied in limestone karst plants. Here, we re-sequenced the nuclear genomes of 62 individuals of the Begonia masoniana complex (B. liuyanii, B. longgangensis, B. masoniana and B. variegata) and investigated genomic divergence and genetic load for these four species. Our analyses revealed four distinct clusters corresponding to each species within the complex. Notably, there was only limited admixture between B. liuyanii and B. longgangensis occurring in overlapping geographic regions. All species experienced historical bottlenecks during the Pleistocene, which were likely caused by glacial climate fluctuations. We detected an asymmetric historical gene flow between group pairs within this timeframe, highlighting a distinctive pattern of interspecific divergence attributable to karst geographic isolation. We found that isolated populations of B. masoniana have limited gene flow, the smallest recent population size, the highest inbreeding coefficients, and the greatest accumulation of recessive deleterious mutations. These findings underscore the urgency to prioritize conservation efforts for these isolated population. This study is among the first to disentangle the genetic differentiation and specific demographic history of karst Begonia plants at the whole-genome level, shedding light on the potential risks associated with the accumulation of deleterious mutations over generations of inbreeding. Moreover, our findings may facilitate conservation planning by providing critical baseline genetic data and a better understanding of the historical events that have shaped current population structure of rare and endangered karst plants.

Uma nova abordagem para micropropagação de begônias por explantes de botões florais

Abstract Begonias grown in greenhouses are susceptible to devastating disease caused by pathogenic bacteria and fungi, decreasing the quality of propagated material. Plant tissue culture provides an alternative for rapid propagation of healthy Begonia material. The present study was undertaken to develop the protocol of micropropagation of three Begonia species and one hybrid from inflorescence explants. Male flower buds with part of pedicel restricted to 1 mm have been cultured in vitro on 6 variants of modified N6 media. Adventitious shoot organogenesis has been shown to occur from both pedicel and receptacle tissues under the action of any type of cytokinin applied, whereas BA and 2-iP triggered mainly the direct organogenesis, while TDZ proceeding morphogenic events through the stage of callus formation. For the culture establishment in vitro the most effective was the medium, supplemented with 1.5 µM 2-iP + 0.54 µM NAA with the addition of 40 mg L-1 adenine sulfate, contributed to the highest shoot regeneration from floral explants of all begonias studied. Histological analysis of adventitious buds pathways approved that their induction occurs under the treatment directly from the subepidermal cells. Morphological analysis performed after plantlets adaptation to the greenhouse conditions showed no morphological or bloom variations in the progeny, derived from the begonias inflorescence. The suggested technique considered as a practical step toward obtaining the uniform planting material for the propagation of economically valuable Begonia plants.

Root morphology, growth, and physiology in Begonia (Malus × micromalus) grown in copper hydroxide containers

A major concern with container seedlings is root circling and deformation that will affect post-planting performance and stability. To improve root quality, 3-year-old Begonia ( Malus × micromalus) plants were grown in the containers treated on interior surfaces with different concentrations of copper hydroxide (Cu(OH)2) (0, 40, 80, 120, 160, and 200 g L−1) for 1 year. Compared with the standard container control (SC) and carrier asphalt container control (AC), the number of terminal lateral roots and lateral root volume were increased by 21% and 13% at 80 and 120 g L−1 Cu(OH)2 but decreased by 8% and 10% at 200 g L−1 Cu(OH)2. Only 80 g L−1 Cu(OH)2 increased the plant height and root weight, while other concentrations of Cu(OH)2 resulted in the declines. Phosphorus and potassium were improved with lower concentrations of Cu(OH)2 but decreased with 160 and 200 g L−1 Cu(OH)2. No significant difference in the concentrations of soluble protein and sugars in leaves was observed between Cu(OH)2 treatments and the controls. AC decreased nitrogen concentration in leaves by 12% over the SC across the whole growing season and increased taproot diameter by 17%. Our results indicate that 80 g L−1 Cu(OH)2 was the optimum concentration for root pruning and the maintenance of physiological function. Disadvantages in growth and physiology gradually showed up with increased concentrations.

Identification of Pests and Diseases on Begonia Plants (Begonia sp) in Sewu Kembang Tourism Village, Karanganyar

Begonia (Begoniaceae) is one of the large genus in the Angiospermae group, with a distinctive leaf asymmetry. Begonias have considerable economic value and some Begonia plants have potential as medicinal plants and as vegetables. Pests and diseases are one of the problems in the development of Begonia cultivation. This study aims to identify and identify the types of pests and diseases that attack Begonia plants. The location of this research is in the area of ​​Sewu Kembang Tourism Park, Nglurah, Tawangmangu, Karanganyar Regency. This research was carried out from September 4 to October 3, 2021. This research was carried out for 30 days using 10 begonia plant samples. The tools used include a camera to take pictures and stationery to record data. The variables observed were pests and diseases that attack Begonia plants. In this study using direct observation and interviews with begonia plant owners. The data were analyzed by qualitative descriptive. The results of the study found 1 disease, namely nitrogen deficit and 2 pests, namely caterpillars and snails. Which causes damage to the leaves of the Begonia plant where the leaves of the Begonia plant are the attraction of the plant.

Lipidomic Remodeling in Begonia grandis Under Heat Stress.

Characterization of the alterations in leaf lipidome in Begonia (Begonia grandis Dry subsp. sinensis) under heat stress will aid in understanding the mechanisms of stress adaptation to high-temperature stress often occurring during hot seasons at southern areas in China. The comparative lipidomic analysis was performed using leaves taken from Begonia plants exposed to ambient temperature or heat stress. The amounts of total lipids and major lipid classes, including monoacylglycerol (MG), diacylglycerol (DG), triacylglycerols (TG), and ethanolamine-, choline-, serine-, inositol glycerophospholipids (PE, PC, PS, PI) and the variations in the content of lipid molecular species, were analyzed and identified by tandem high-resolution mass spectrometry. Upon exposure to heat stress, a substantial increase in three different types of TG, including 18:0/16:0/16:0, 16:0/16:0/18:1, and 18:3/18:3/18:3, was detected, which marked the first stage of adaptation processes. Notably, the reduced accumulation of some phospholipids, including PI, PC, and phosphatidylglycerol (PG) was accompanied by an increased accumulation of PS, PE, and phosphatidic acid (PA) under heat stress. In contrast to the significant increase in the abundance of TG, all of the detected lysophospholipids and sphingolipids were dramatically reduced in the Begonia leaves exposed to heat stress, suggesting that a very dynamic and specified lipid remodeling process is highly coordinated and synchronized in adaptation to heat stress in Begonia plants.

Perbedaan Media Tanam Limbah Kulit Buah Kolang Kaling dan Kulit Kopi terhadap Pertumbuhan Tanaman Begonia

This study aims to determine the differences in the planting media of kolang kaling fruit peel waste and coffee skin on the height, number of leaves and leaf width of begonia plants. The method used in this research is a quantitative experimental method with two treatments of growing media, namely the waste of kolang kaling fruit peel and coffee rind waste. Data collection techniques using observation sheets. The results of observations on the growth of begonias were analyzed using independent t-test. The results showed that there was a difference in begonia plant height with the value of Sig. of 0.648. The number of begonia plant leaves obtained the value of Sig. by 0.007 and the width of the leaves of begonia plants by 0.309. In conclusion, there are differences in the use of planting media for waste skin of kolang kaling fruit and coffee husk waste planting media on the number of leaves on begonia plants.
 Keywords: Planting Media, Begonia Growth

IN VITRO SCREENING FOR ANTIMICROBIAL POTENTIAL OF ETHANOLIC LEAF EXTRACTS OF SOME BEGONIA SPECIES AGAINST METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) STRAIN

The antimicrobial activities of ethanolic extracts obtained from the leaves of Begonia solimutata L.B. Sm. & Wassh., Begonia goegoensis N.E.Br., Begonia foliosa Kunth, Begonia × erythrophylla Hérincq, Begonia thiemei C.DC., Begonia peltata Otto & Dietr., Begonia heracleifolia Cham. & Schltdl., Begonia dregei Otto & Dietr., and Begonia mexicana G. Karst. ex Fotsch were assessed against methicillin-resistant Staphylococcus aureus (MRSA) strain. The leaves were brought into the laboratory for antimicrobial studies. Freshly crushed leaves were washed, weighed, and homogenized in 96% ethanol (in proportion 1:19) at room temperature. The extracts were then filtered and investigated for their antimicrobial activity. The testing of the antibacterial activity of the plant extracts was carried out in vitro by the Kirby-Bauer disc diffusion susceptibility test protocol. The most effective plants among species screened against S. aureus NCTC 12493 growth were B. peltata, B. thiemei, B. foliosa, Begonia × erythrophylla, and B. solimutata being highly active with the ethanolic extracts (diameters of inhibition zone ranged from 12.5 to 21 mm). The ethanolic extracts from nine Begonia plant species were evaluated for their antimicrobial activity against methicillin-resistant S. aureus (MRSA) strain. Extracts from all test Begonia plants caused a remarkable reduction in bacterial growth, measured as an inhibition zone diameters. The diameter of the inhibition zone for B. solimutata was (16.4±1.1) mm, for B. goegoensis – (14.2±1.0) mm, for B. foliosa – (14.9±1.2) mm, for Begonia × erythrophylla – (16.9±0.9) mm, for B. thiemei – (16.8±1.3) mm, for B. peltata – (18.1±0.9) mm, for B. heracleifolia – (15.3±0.9) mm, for B. dregei – (14.7±1.1) mm, and for B. mexicana – (13.8±0.9) mm/ The highly active antimicrobial effects of extracts obtained from B. peltata and B. thiemei noted against S. aureus NCTC 12493 growth is worthy of highlighting. Our studies indicated that Begonia plants are worthy of further investigation as a potential phytotherapeutic agent for treating infections caused by S. aureus., as well as for the development of innovative feed and preventative products in animal husbandry.

“Basura verde” como componente de sustrato en el cultivo de Begonia spp. en potes

The forest soil is the main substrate in the production of ornamental plants in pots, but its unlimited extraction causes a negative environmental impact. One alternative for replacing the forest soil is the garden waste, also called “green waste”. The aim of this study was to characterize and determine the optimal dose inclusion of green waste in order to use it as substrate component for begonia (Begonia spp.) container cultivation. This experiment was performed in Morelos State, Mexico, in 2015. Physical and chemical laboratory analysis, as well as an agronomic evaluation was performed. Different proportions (100%, 75%, 50%, and 25%) of green waste and forest soil, supplemented by a general substrate (coconut fiber and sawdust, 50/50, v/v) were mixed. A completely randomized design of eight treatments with eight replications was used. Green waste has similar physicochemical characteristics to forest soil. In the growth and development of begonia plants, the results were statistically equal, between treatments of 100% green waste use and forest soil use in six of the sixteen variables studied, and was superior to other treatments, in one of them. As a result of this study, we reached the following conclusion: that green waste is a material that has the necessary physicochemical characteristics for the Begonia spp. container cultivation, and that if its used as a substrate, it could replace the forest soil.

Root and Stem Rot of Begonia Caused by Phytopythium helicoides in Virginia.

In the summer of 2011, severe root and stem rot of begonia (Begonia × semperflorens-cultorum cv. Vodka Dark Red) was observed during a field trial. Seventy-eight percent of the plants had symptoms included foliar blight, blackened and rotting roots, rotting stems, and collapsing crown, often leading to plant death. Isolation from the diseased plant roots consistently recovered a Pythium-like species and 41 isolates were subcultured for identification. These isolates produced very similar single-strand conformation polymorphism (SSCP) fingerprints (2), which were distinct from those of other oomycete pathogens known to attack begonia (1). These isolates produced proliferous, ovoid to globose, terminal, and papillate sporangia which were 30.6 to 45.4 μm (av. 38.7 μm) in length and 20.5 to 35.4 μm (av. 28.2 μm) in width. Oogonia were produced in single culture grown in clarified V8 juice agar. These smooth-walled oogonia were mostly aplerotic and 28.9 to 36.8 μm (av. 33.1 μm) in diameter. Each contained a single oospore with a diameter of 23.7 to 34.4 μm (av. 26.9 μm). Single to multiple antheridia were attached lengthwise to each oogonium. These morphological characteristics match the description of Phytopythium helicoides (= Pythium helicoides) (3). The identity of these isolates was confirmed by sequencing the rDNA internal transcribed spacer (ITS) 1 and 2 regions. ITS sequence of the representative isolate 55C7 (GenBank Accession No. KC907734) had 97 to 99% homology with P. helicoides sequences in GenBank. Two isolates, 55C7 and 56A7, were tested for pathogenicity to begonia in the summer of 2012. Twelve plants per isolate were inoculated by injecting ground P. helicoides-colonized rice grains into the root soil using a long-neck funnel. Sterile rice grains were used on control plants. Aboveground symptoms including foliar blight, stem rot, and collapsing crown were observed 7 days after inoculation and the disease progressed for additional 6 weeks. At 7 weeks, all inoculated plants showed different symptom levels. Four and 10 plants inoculated with 55C7 and 56A7, respectively, were already dead. Begonia roots showed severe symptoms including blackening, stunted growth, and rotting. Seven of 12 control plants also had notable symptoms due to cross contamination. Isolates recovered from all symptomatic plants had identical SSCP fingerprints to those of isolates 55C7 and 56A7. To our knowledge, this is the first report of P. helicoides attacking begonia plants. The avenue of this pathogen entering the 2011 field trial remains unknown. The field trial in 2011 and pathogenicity test in 2012 indicate that this pathogen is potentially destructive to begonia. Additional research is warranted to identify the origin and dissemination of this pathogen to mitigate the risk to begonia production.

First Report of Impatiens necrotic spot virus on Begonia in Bosnia and Herzegovina.

Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) are the most serious viral pathogens in the production of ornamental plants in Europe and North America (1). During a survey for the presence of tospoviruses in July 2012, potted begonia hybrids (Begonia × tuberhybrida Voss) exhibiting foliar chlorotic rings and zonal spots accompanied by leaf necrosis and distortion, were observed in a greenhouse in the vicinity of Banja Luka (Bosnia and Herzegovina). Leaf samples collected from 12 symptomatic plants were analyzed for the presence of INSV and TSWV by commercial double-antibody sandwich (DAS)-ELISA kits (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy begonia leaves were included in each ELISA. INSV was detected serologically in all 12 begonia samples and all tested samples were negative for TSWV. Five healthy plants of each Petunia × hybrida and Nicotiana benthamiana were mechanically inoculated with sap from an ELISA-positive sample (157-12) using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulphite. Local necrotic lesions on P. × hybrida and systemic chlorotic mottling on N. benthamiana were observed on all inoculated plants 4 and 10 days post-inoculation, respectively. For further confirmation of INSV infection, total RNAs were extracted from all ELISA-positive begonia plants as well as mechanically inoculated N. benthamiana plants with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used as template in reverse transcription (RT)-PCR. RT-PCR was performed with the OneStep RT-PCR Kit (Qiagen) using primer pair INSV-589 and TOS-R15 (3), specific to the partial INSV nucleocapsid (N) gene. Total RNA obtained from Serbian INSV isolate from a begonia (GenBank Accession No. HQ724289) and RNA extracts from healthy begonia plants were used as positive and negative controls, respectively. All naturally and mechanically infected plants as well as the positive control yielded an amplicon of the expected size (589 bp), while no amplification products were obtained from the healthy controls. The RT-PCR product derived from the isolate 157-12 was sequenced directly after purification with QIAquick PCR Purification Kit (Qiagen) and submitted to GenBank (KC494869). Pairwise comparison of the 157-12 isolate N sequence with other homologous sequences available in GenBank, conducted using MEGA5 software (2), revealed that begonia isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with the Chinese INSV isolate (FN400772) originating from Oncidium sp. To our knowledge, this is the first report of INSV on begonia in Bosnia and Herzegovina. Begonias are very popular and widely grown ornamentals in Bosnia and Herzegovina and the presence of a new and devastating pathogen could represent a serious threat for its production. Since begonia is commonly grown together with numerous ornamental plants susceptible to INSV, further investigations are needed in order to prevent spread of this potentially harmful pathogen to new hosts in Bosnia and Herzegovina.

Evaluation of biological control agents for Fusarium wilt in Hiemalis begonia

Five laboratory-isolated Bacillus subtilis strains: CB1, CGB, JHB1, SSB1 and WW4; and five commercial biocontrol agents: Actinovate® (Stretomyces lydicus strain WYEC108), Serenade® MAX (Bacillus subtilis strain QST713), Mycostop® (Streptomyces griseoviridis strain K61), RootShield® (Trichoderma harzianum strain T-22), and Prestop® WP (Gliocladium catenulatum strain J1446) were evaluated for their potential to inhibit Fusarium foetens both in vitro in Petri dishes and in the greenhouse using potted begonia plants. Bacillus subtilis strain JHB1 inhibited F. foetens mycelial growth by 76% compared with the untreated dishes after seven days of dual culturing; and also provided significant protection to potted begonia plants against F. foetens under greenhouse conditions (two trials) when applied as two soil drenches prior to pathogen inoculation. Compared with the pathogen-inoculated control, disease severity (DS) was reduced by 33% and 50% by JHB1 in trial one and two, respectively. All of the commercial biocontrol agents significantly reduced DS compared with the control when applied as soil drenches prior to pathogen inoculation. Most of the commercial products delayed plant disease symptom development by seven or more days. Moreover, Mycostop, Prestop, Actinovate, RootShield and Serenade all significantly reduced the DS, and increased the shoot dry weights and chlorophyll content index for over 28 days after inoculation compared with the control.

First Report of Impatiens necrotic spot virus on Hiemalis Begonia (Begonia × hiemalis) in Canada.

Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5'CCAAGCTCAACATGTTTAGC 3', nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5'ACTGCATCTTGCCTATCCTT 3', nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

First Report of Bacterial Leaf Spot of Rieger Begonia Caused by Xanthomonas campestris pv. begoniae in China

Rieger begonia are collectively referred to as a begonia hybrid group. Its global annual sales is 90,000,000 cutting seedlings. It is one of the top ten potted plants. In the summer of 2011, serious outbreaks of a suspected bacterial leaf spot disease were observed on five Rieger begonia cultivars (Dark Britt, Rebecca, Blitz, Barkos, and Borias). These plants were grown for potted cutting seedling production in commercial nurseries located in Shilin county of Yunnan Province, China. The initial symptoms of the disease were small circular or polygonal water-soaked needle spots on leaf margin that later these spots expanded and joined together, forming bigger inverted V-shaped necrotic specks (4). Yellow-pigmented bacterial colonies were consistently isolated from diseased leaves and stems on NA agar medium and incubated at 28°C. Twelve bacterial strains were isolated and used for further studies. All the isolates were Gram-negative, rod-shaped, motile, aerobic, and non-sporing. All of the bacterial strains isolated in the present study were identified as Xanthomonas campestris pv. begoniae (Xcb) based on biochemical and physiological identification (Biolog carbon source utilization analysis) and 16S rDNA sequences analysis and further pathogenicity determination (1). The results show that the sequence homology rate of HT1-1 (GenBank Accession No. JN648097) and X. euvesicatoria (syn. X. campestris pv vesicatoria) (GeneBank Accession No. AM039952) is 99%. This strongly suggests that the Rieger begonia isolates belong to X. campestris pv. begoniae (2). For Koch's postulates, 10 surface-disinfected young leaves from five susceptible Rieger begonia plants (cv. Dark Britt) were inoculated by spraying a phosphate-buffered saline suspension of each bacterial isolate (3.0 × 108 CFU/ml) onto the leaves (3). Controls were inoculated similarly with phosphate-buffered saline solution. All inoculated plants were covered with polyethylene bags for 24 h at 25°C and then put in the greenhouse. After inoculation, water-soaked and necrotic symptoms were observed on inoculated Rieger begonia leaves within 7 to 9 days. No symptoms were observed on controls. Bacteria were reisolated and confirmed to be identical to the original isolates by the methods described above. To our knowledge, this is the first report of Xcb causing leaf spot on Rieger begonia plants in China. The infection process of Xcb on Rieger begonia plants and rapid detection of this pathogen are underway.

First Report of Begonia Elatior Wilt Disease Caused by Fusarium foetens in France.

Fusarium foetens is a destructive vascular pathogen on Begonia, mainly on cultivars of Begonia elatior hybrids (Begonia × hiemalis), which has recently been identified in Europe and Northern America (1,3). This Fusarium species has been responsible for severe damage in the begonia flower industry (1) and is listed as an EPPO A2 quarantine pathogen since 2007. In May 2007, wilted potted plants of B. elatior showing chlorotic leaves and basal stem rot were observed in a nursery located in the west of France (La Flèche, Sarthe). Symptomatic foliar and basal stem pieces were plated on a Fusarium semi selective medium, dichloran chloramphenicol peptone agar (DCPA), and on malt agar medium supplemented with 100 ppm chloramphenicol. Homogeneous mycelium of a Fusarium species developed from both types of tissue and on both media, and was transferred to potato dextrose agar (PDA) and to spezieller nährstoffarmer agar (SNA) media for morphological examination. Microscope slides were then prepared by pressing gently a clear self-adhesive tape onto the surface covered by mycelium and sporodochia, which was further stained with lactic acid/methylene blue. Typical multiseptate (often three septa), hyaline, slightly curved Fusarium macroconidia 29.2 to 41.8 (32.5) × 3.6 to 4.5 (4.3) μm were collected in sporodochia. In the aerial mycelium, long and short conidiophores with mono- or polyphialidic cells bearing false heads of ellipsoidal microconidia were observed. In addition, a pungent distinctive odor was produced by the mycelium grown on PDA. These features were consistent with F. foetens (2). To support the diagnosis, total DNA was further extracted from the pure culture and a partial region of the translation elongation 1 (tef1) gene was amplified by PCR using EF1-EF2 primer pair (4). Nucleotide sequence was determined and deposited on GenBank (Accession No. JX298790). Analysis of the sequence by BLAST showed that it was 100% identical with all the available F. foetens sequences, which confirmed our morphological diagnosis. To our knowledge, this is the first official report of F. foetens in France. Since this first detection, F. foetens was again identified in 2010 in another nursery located in the Pays de la Loire on collapsed B. elatior. Approximately 15 to 20% of the Begonia plants showed typical Fusarium wilt symptoms and the infected lots were systematically destroyed. The origin of these infections could not be traced back since the mother plants tested negative. The disease is considered as eradicated in France but causes major economic losses to Begonia growers and marketers in regions where the disease is established (2).

Real-time PCR mediated monitoring of Fusarium foetens in symptomatic and non-symptomatic hosts

Fusarium foetens is a recently described aggressive vascular pathogen of Begonia x hiemalis. Since 2004, it has caused severe losses for Begonia growers in Northern Europe and North America. F. foetens is likely to be of exotic origin. Little is known about the accumulation of the fungus in Begonia plants before and during symptom expression and about its host range. We have optimised a molecular detection method for F. foetens by only using the plant part containing the largest amount of the pathogen and by optimising the tissue maceration and DNA extraction techniques. This allowed a reliable detection limit of 2310 spore equivalents per plant and a theoretical detection limit of as low as 84 to 167 spore equivalents per plant. Using this method, we demonstrated exponential accumulation of F. foetens DNA in Begonia roots, resulting in symptoms at a threshold of approximately 107 spore equivalents and levelling off at 109 spore equivalents per plant. The observed rate of accumulation and the amount of pathogen DNA in non-symptomatic plants can be combined to determine whether the cuttings were infected after delivery at the Begonia nursery and to calculate the estimated timing of symptom development. To test the host range, we applied the optimised molecular detection technique. During these tests, only Begonia x hiemalis plants became symptomatic, but many other plant species supported growth of the pathogen. This information can be used to aid pathogen control and has implications for pest risk assessment.

Growth of Six Begonia Species Under Shading

The Ornamental Plant Germplasm Center (OPGC) conserves begonia species. Limited cultural information is available concerning the effect of light intensity on the growth of begonia species other than cultivated hybrids in green- houses. The objective of this study was to evaluate the response of begonia species to different shade levels and to identify light intensities that favor the production and maintenance of quality begonia plants in greenhouses during summer. Plants of six begonia species, (Begonia albopicta, B. cucullata var. cucullata, B. echinosepala var. elongatifolia, B. holtonis, B. foliosa var. miniata, and B. 'Fuchsifoliosa' (B. fuchsioides x B. foliosa)), were grown in a greenhouse in Columbus, OH (lat. 40 N, long. 82.53 W) for 12 weeks (starting 23 July) either in full light (1000 - 1800 μmol·m -2 ·s -1 ) or shade-cloth tents providing three levels of shade (41, 62, and 76% of full sunlight in the greenhouse). Each plant was evaluated for the number of inflorescences, leaf greenness (SPAD readings), shoot length, leaf area, and shoot dry weight. Visual observa- tions of plant quality (chlorosis, necrosis, sunburn, deformed leaves, and plant mortality) were also recorded. Shade per- centage for optimal growth and quality of B. albopicta, B. echinosepala var. elongatifolia, B. holtonis, B. foliosa var. miniata, and B. 'Fuchsifoliosa' plants was 62% and 76 % for B. cucullata var. cucullata plants.

First Report of Begonia Chlorotic Ringspot Caused by Zucchini yellow mosaic virus in Taiwan.

Begonia (Begonia semperflorens) showing symptoms of systemic chlorotic ringspots were observed in the central part of Taiwan in May 2006. Infected begonia plants showed faint ringspots in leaves at the early stage of infection. Symptoms turned chlorotic and coalesced as the disease progressed. Electron microscopic examination revealed filamentous virus particles approximately 750 × 13 nm in the crude sap of infected begonia. Typical pinwheel inclusion bodies of potyvirus infection were observed in the ultrathin sections of infected begonia. A virus culture was isolated via mechanical inoculations in Chenopodium quinoa and serologically identified as Zucchini yellow mosaic virus (ZYMV) (1) by ELISA, western blotting, and immunoelectron microscopy. Complementary DNA fragments of viral genomic RNA were cloned, sequenced, and the full-length sequence was submitted to the EMBL database (Accession No. AM422386). The genomic RNA consists of 9,591 nucleotides excluding the poly-A tail and has an identical genome organization to that reported for members of the genus, Potyvirus. The nucleotide sequence of the full-length genome and the deduced amino acid sequence of coat protein share 98% identity to those of ZYMV-CU (Accession No. AJ307036), ZYMV-SG (Accession No. AJ316228), and ZYMV-TW-TN3 (Accession No. AF127929). The virus caused local lesions on the inoculated leaves of C. quinoa, systemic mosaic in cucumber (Cucumis sativus), zucchini (Cucurbita pepo), and Cucumis metuliferus, and chlorotic ringspots in begonia. Symptoms caused by the begonia isolate in cucurbits were much milder than those caused by ZYMVs of cucurbit origin. A ringspot disease with symptoms similar to those caused by ZYMV is also produced on begonia by an Ilarvirus, Prunus necrotic ringspot virus (PNRSV), which was previously identified in begonia (2). To our knowledge, this is the first report of natural infection of ZYMV in begonia.

The use of green waste compost in peat-based potting mixtures: Fertilization and suppressiveness against soilborne diseases

Twelve commercially produced Dutch green waste composts were evaluated for their suitability to replace 20% (v/v) peat substrate in the cultivation of ornamentals. Salt concentrations were determined in water extracts of the composts and disease suppressive effects were assessed against various soilborne diseases. The Cl-concentration of the compost extract appeared to be the limiting factor for use of the composts in potting mixtures. The Cl-concentrations in 7 and 1 composts, respectively, were too high to replace 20% of peat for growing salt sensitive and moderately salt sensitive plants, according to guidelines set for these groups of plants. The suppressive effects of the composts were tested in peat-based potting mixtures using three bioassays: Phytophthora cinnamomi—lupin, Cylindrocladium spathiphylli— Spathiphyllum and Rhizoctonia solani AG2-1—cauliflower. Disease levels in compost-amended mixtures were compared with the non-amended controls. None of the composts induced suppressiveness against P. cinnamomi; 3 and 9 composts significantly induced suppressiveness against C. spathiphylli and R. solani, respectively. No significant disease enhancement was observed in any of the bioassays. The pH of the potting mixture showed a negative correlation with suppression of the Rhizoctonia disease ( R 2 = 0.56). The effect of pH (pH 4–6) on suppression of R. solani and P. cinnamomi was further studied in non-amended peat. Disease suppression of R. solani in cauliflower decreased with increasing pH in two different kinds of peat, while there was no effect on P. cinnamomi. The suppressive effect of 3 composts was assessed in two experiments against Fusarium wilt in Cyclamen persicum (caused by F. oxysporum f. sp. cyclamini) and Begonia eliator (caused by F. foetens) under near-commercial conditions. None of the composts had a significant effect on Fusarium wilt in Cyclamen. Two and 3 composts significantly induced suppressiveness against Fusarium wilt in Begonia in the first and second experiments, respectively. No significant differences were observed in growth characteristics between Begonia plants grown in compost-amended and non-amended potting mixture in both experiments. In the second experiment, Cyclamen plants grown in compost-amended potting mixture had significant lower number of flowers than plants grown in non-amended potting mixture, which may have been due to lower concentrations of N in the compost-amended potting mixtures. In conclusion, most composts of the origin and composition tested can replace 20% peat in potting mixtures for moderately salt sensitive and salt tolerant plants. Amendment of these composts can contribute to control of Fusarium wilt in Begonia plants.

Clustered Stomates in Begonia: An Exercise in Data Collection & Statistical Analysis of Biological Space

An important aspect of biology is spatial distribution and patterns of distribution can be either ordered, random, or clustered. For examples, deployment of mature trees in a forest is ordered, occurrence of zebras on a savannah is clustered, and location of clams on the ocean floor is random. Deployment can be examined in two directions; first is down the scale of order to study arrangement of organisms (trees, zebras, trout) in a population, leaves on a branch, stomates on a leaf, chloroplasts in a cell, etc. The second approach to the study of deployment is to provide a quantitative measure of a pattern. One means of quantifying space is by tile dispersion index, DI, which is tile variance over the mean, ([[sigma].sup.2]/m; a value greater than 1.0 indicates an ordered arrangement, a value of about 1.0 denotes a random pattern, and a D1 noticeably' less than 1.0 comes from clustering. An interesting example of all three patterns is the occurrence of clustered stomates on leaves in some Begonia cultivars (Figure 1). In this figure stomates are found in clusters and the arrangement of these clusters is indicated by the DI which is 0.64/3.25, or 0.19, much less than 1.0. Also notice that clusters are usually separated by one cell, again, a relation that gives an ordered pattern. For the arrangement of stomates the DI is 74/13, or 5.7, much greater than 1.0 and so the pattern is one of order. Finally, the number of stomates per cluster has a D1 of 3.1/3.6 (Table 1), or 0.87 close to 1.0 for a random number of stomates per cluster. [FIGURE 1 OMITTED] Data collection and statistical analysis of the data is the hallmark of modern science but few teaching exercises are designed lot students to experience this approach. The difficulty with handling data is that it requires either too many organisms or the technological requirements are unrealistic. For a class to study the spatial distribution of trees, animals in a herd, or clams on the sea floor is unrealistic both with respect to travel and to have sufficient numbers to make sound conclusions. One example where many data points can be collected with minimal equipment is that of stomates (Greek for openings) on the leaves of plants. In some cultivars of Begonia, stomates occur in clusters ranging from one to as many as ten (Payne, 1970) and these can be seen by a permanent preparation of a microscope slide as a fingernail polish imprint (Sampson, 1961) as shown in Figure 1. Seen under the microscope, 100 clusters can be counted for the number of stomates per cluster in only 15 minutes and, if desired, 500 within an hour. This data set can then be analyzed statistically by, calculating the average as well as variance and then tested to see if they fit a particular expected distribution, in this case the Poisson distribution. The exercise can be done in middle school classes by students making their own slides and seeing imprints of ceils, or at the high school level through collecting data of number of stomates per cluster and graphing the results, or in a college laboratory by comparing collected data to an expected Poisson distribution and doing a [chi square] test for goodness of fit. Procedures Begonia (B. X semprflorens) plants can be purchased in the spring at a local nursery or are grown indoors year round. Some cultivars have stomatal clusters, such as Vodka, Whiskey, or Lady Carol, while others, B. X tuberhybrid, have the more typical solitary stomates, so plants have to be checked well before class. A piece of leaf about the size of a postage stamp is cut off the plant and the imprinting method of Sampson (1961) is run as follows. The lower epidermis is swabbed with clear fingernail polish, left to dry for about 15 minutes, and then peeled off with a pair of forceps. This imprint is then placed on a dean microscope slide, a coverslip is placed over it, and a small dab of the fingernail polish is placed at two diagonal corners and allowed to dry in order to hold down the coverslip. …

Ralstonia solanacearumrace 1/biovar III causing wilt of begonia in the State of São Paulo, Brazil

A natural occurrence of Ralstonia solanacearum causing wilt on begonia plants was observed for the first time in Brazil. Pathogenicity and biochemical tests placed the isolates into race1/biovar III.