BC3H-1 Myocytes Research Articles

Genomics, transcriptomics, proteomics, and numbers.

To review the advances in clinically useful molecular biologic techniques and to identify their applications in clinical practice, as presented at the 11th Annual William Beaumont Hospital DNA Symposium. The 8 manuscripts submitted were reviewed, and their major findings were compared with literature on the same or related topics. Manuscripts address the use of molecular techniques in microbiology to evaluate infectious disease and epidemiology; molecular microbiology methods, including rapid-cycle real-time polymerase chain reaction; peroxisome proliferator-activated receptor gamma as a potential therapeutic target in inflammatory bowel disease or colon cancer; the effect of nonapoptotic doses of the bisbenizamide dye Hoechst 33342 on luciferase expression in plasmid-transfected BC3H-1 myocytes; the routine use of cystic fibrosis screening and its challenges; and the use of flow cytometry and/or chromosomal translocation in the diagnostic evaluation of hematopoietic malignancies. Three current issues related to the use of molecular tests in clinical laboratories are (1) the restriction on introducing new tests secondary to existing patents or licenses; (2) the preanalytic variables for the different specimen types currently in use, including whole blood, plasma, serum, fresh or frozen tissues, and free-circulating DNA; and (3) the interpretation of studies evaluating the association of complex diseases with a single mutation or single-nucleotide polymorphism. Molecular methods have had a major impact on infectious disease through the rapid identification of organisms, the evaluation of outbreaks, and the characterization of drug resistance when compared with standard culture techniques. The activation of peroxisome proliferator-activated receptor gamma stimulated by thiazolidinedione is useful in the treatment of type II diabetes mellitus and may have value in preventing inflammatory bowel disease or colon cancer. Hoechst 33342 binding to adenine-thymine-rich regions in the minor groove of DNA is a fluorescent stain for DNA and initiates apoptosis at >10 microg/mL. Lower doses of Hoechst 33342 promote luciferase expression by a mechanism that may involve binding to cryptic promoters facilitated by dye-associated misalignment of the tertiary structure of DNA. The routine use of cystic fibrosis screening is complicated by the more than 1000 mutations associated with the disease. The use of 4-color flow cytometry and the detection of chromosomal translocation are both invaluable aids in establishing the diagnosis of lymphoid or myeloid hematopoietic malignancies. The current postgenomic era will continue to emphasize the use of microarrays and database software for genomic, transcriptomic, and proteomic screening in the search for useful clinical assays. The number of molecular pathologic techniques will expand as additional disease-associated mutations are defined.

Evidence for a direct effect of captopril on early steps of insulin action in BC3H-1 myocytes

Captopril, an angiotensin-converting enzyme (ACE) inhibitor, has been reported to improve insulin sensitivity. However, despite extensive investigation, the mechanisms responsible for this effect are not fully understood. Reduction of plasma angiotensin II and inhibition of kininase II have been suggested to contribute to improve insulin sensitivity. Insulin binding was measured at tracer insulin concentration in intact cells with or without captopril treatment. Specific binding, expressed as percent of total insulin added, was not different in control and captopril-treated cells. However, captopril treatment caused an increase in insulin-induced insulin receptor substrate-1 (IRS-1) phosphorylation accompanied by an increased association of IRS-1 with phosphoinositide-3 kinase (PI-3 kinase), despite no change on insulin receptor (IR) autophosphorylation. There was also an increased threonine kinase B (AKT) phosphorylation in captopril-treated cells followed by enhanced basal and insulin-stimulated glucose uptake. These results indicate that captopril treatment has a direct effect on early phosphorylation events induced by insulin in BC3H-1 myocytes. Copyright 2003, Elsevier Science (USA). All rights reserved.

Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells.

Abstract Context.—Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box–binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions. Objective.—To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis. Methods.— The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30–base pair double-stranded oligonucleotide that contained an E2F-1–binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction. Results.—Nuclear extracts from each cell line treated with 26.7 μmol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were inc...

Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells.

Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box-binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions. To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis. The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that contained an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction. Nuclear extracts from each cell line treated with 26.7 micromol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [32P]-labeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoechst 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly increased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. Hoechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines. Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein, another step in this specific apoptotic pathway.

The Effect of Hoechst 33342 on Luciferase Gene Transcription and Translation.

INTRODUCTION. Hoechst 33342 (H342) and Hoechst 33258 (H258) bind to AT regions of the DNA minor groove. H342, but not H258, induces apoptosis in various cells (1). Sequence-selective DNA-binding drugs inhibit transcription factors from binding to their target sites on gene promoters in vitro (2). In vivo studies demonstrate that H342-induced apoptosis is associated with degradation of TATA box binding protein (TBP) (3) and accumulation of intracellular E2F-1 (4). Here, we determine the effect of H342 and H258 on in vivo luciferase gene expression in BC3H-1 myocytes using 4 pGL-3 vectors: Basic, Promoter, Enhancer, and Control.

Hoechst 33342 induces apoptosis in HL-60 cells and inhibits topoisomerase I in vivo.

Bisbenzimides (Hoechst 33342 and Hoechst 33258) are cell-permeable, adenine-thymine-specific dyes that bind to the minor groove of DNA and stain DNA. Hoechst 33342 induces apoptosis in BC3H-1 myocytes and hepatoma cells. To determine if Hoechst 33342 or Hoechst 33258 induces apoptosis in human promyelocytic leukemia cells (HL-60) and inhibits topoisomerase I activity. A variety of methods were used to detect apoptosis: cell viability (trypan blue exclusion), nuclear fluorescence staining (Hoechst 33342 or Hoechst 33258 stained for 10 minutes), flow cytometric quantitation of annexin binding to phosphatidylserine, and DNA fragmentation (agarose gel electrophoresis). Topoisomerase I activity was determined by a plasmid unwinding assay. A large teaching hospital and research laboratories. None. None. Apoptosis is characterized by decreased cell viability, condensation of nuclear chromatin, increased phosphatidylserine translocation, and DNA fragmentation into oligonucleosomes composed of multiples of 180 to 200 base pairs. Inhibition of endogenous nuclear topoisomerase I is detected by the absence of plasmid unwinding from a tightly coiled to relaxed form. Hoechst 33342, but not Hoechst 33258, induced apoptosis in the HL-60 cells in a time- and dose-dependent manner. Endogenous nuclear topoisomerase I activity in HL-60 cells was inhibited by treatment with Hoechst 33342 but not Hoechst 33258. Hoechst 33342-induced HL-60 cell apoptosis may be related to the dye's inhibition of topoisomerase I activity.

Hoechst 33342 Induces Apoptosis and Alters Tata Box Binding Protein/DNA Complexes in Nuclei from BC3H-1 Myocytes

Hoechst 33342 and Hoechst 33258 bind to adenine-thymine rich regions of the minor groove of DNA. Hoechst 33342, but not Hoechst 33258, induces BC3H-1 myocyte cell death and DNA fragmentation into an internucleosomal pattern characteristic of apoptosis. Hoechst 33342 has been shown to inhibit endogenous nuclear topoisomerase I activity. Another enzymatic activity utilizing the minor groove of DNA, the initiation of RNA polymerase II activity by formation of a TATA box binding protein/TATA box promoter complex, is shown to be altered using a gel mobility shift assay. A [32P]-labeled 24-oligonucleotide containing a TATA box element formed one molecular weight complex in control and Hoechst 33258 treated cells. The presence of Hoechst 33342 (26.7 μM) decreased the amount of the control complex and increased the presence of lower molecular weight species suggesting degradation of nuclear TBP and/or release of other transcription factors from the complex creating a smaller sized molecular complex which retains TATA box binding capacity. These results suggest that the pathway utilized to induce apoptosis in BC3H-1 myocytes may also involve the alteration of normal TBP/DNA complex formation and reduction in the initiation of new transcription.

Actin isoform utilization during differentiation and remodeling of BC3H1 myogenic cells

Mouse BC3H1 myogenic cells and a bi-functional chemical cross linking reagent were utilized to investigate the polymerization of newly-synthesized vascular smooth muscle (α-actin) and non-muscle (β- and γ-actin) actin monomers into native F-actin filament structures during myogenesis. Two actin dimer species were identified by SDS-PAGE analysis of phenylenebismaleimide-cross linked fractions of BC3H1 myoblasts and myocytes. P-dimer was derived from the F-actin-enriched, detergent-insoluble cytoskeleton. Pulse-chase analysis revealed that D-dimer initially was associated with the cytoskeleton but then accumulated in the soluble fraction of lysed muscle cells that contained a non-filamentous or aggregated actin pool. Immunoblot analysis indicated that non-muscle and smooth muscle actins were capable of forming both types of dimer. However, induction of smooth muscle α-actin in developing myoblasts coincided with an increase in D-dimer level which may facilitate actin stress fiber assembly. Smooth muscle α-actin was rapidly utilized in differentiating myoblasts to assemble extraction-resistant F-actin filaments in the cytoskeleton whereas non-muscle β- and γ-actin filaments were more readily dissociated from the cytoskeleton by an extraction buffer containing ATP and EGTA. The data indicate that cytoarchitectural remodeling in developing BC3H1 myogenic cells is accompanied by selective actin isoform utilization that effectively segregates multiple isoactins into different sub-cellular domains and/or supramolecular entities. J. Cell. Biochem. 67:514–527, 1997. © 1997 Wiley-Liss, Inc.

Actin isoform utilization during differentiation and remodeling of BC3H1 myogenic cells

Mouse BC3H1 myogenic cells and a bi-functional chemical cross linking reagent were utilized to investigate the polymerization of newly-synthesized vascular smooth muscle (alpha-actin) and non-muscle (beta- and gamma-actin) actin monomers into native F-actin filament structures during myogenesis. Two actin dimer species were identified by SDS-PAGE analysis of phenylenebismaleimide-cross linked fractions of BC3H1 myoblasts and myocytes. P-dimer was derived from the F-actin-enriched, detergent-insoluble cytoskeleton. Pulse-chase analysis revealed that D-dimer initially was associated with the cytoskeleton but then accumulated in the soluble fraction of lysed muscle cells that contained a non-filamentous or aggregated actin pool. Immunoblot analysis indicated that non-muscle and smooth muscle actins were capable of forming both types of dimer. However, induction of smooth muscle alpha-actin in developing myoblasts coincided with an increase in D-dimer level which may facilitate actin stress fiber assembly. Smooth muscle alpha-actin was rapidly utilized in differentiating myoblasts to assemble extraction-resistant F-actin filaments in the cytoskeleton whereas non-muscle beta- and gamma-actin filaments were more readily dissociated from the cytoskeleton by an extraction buffer containing ATP and EGTA. The data indicate that cytoarchitectural remodeling in developing BC3H1 myogenic cells is accompanied by selective actin isoform utilization that effectively segregates multiple isoactins into different sub-cellular domains and/or supramolecular entities.

Thiazolidinediones and their effects on glucose transporters.

Recently, considerable attention has been paid to a promising new family of antidiabetic therapeutic agents, the thiazolidinediones. Several members of this family have been shown to have potent effects to lower hyperglycemia, hyperinsulinemia and hypertriglyceridemia in insulin resistant humans and animals. Even as one member of this family, troglitazone (Rezulin), has become available for clinical use in the US and Japan, we still do not fully understand the mechanisms by which these agents exert their effects. Shimaya and colleagues (1) have employed an insulin resistant model system, the obese Zucker rat, to investigate potential mechanisms of thiazolidinedione action. Treatment of obese animals with a new thiazolidinedione analog, YM268, greatly reduced fasting glucose and insulin levels and improved glucose tolerance. These workers confirmed the reduced glucose transporter 4 (GLUT4) protein expression in adipocytes of obese animals compared with lean littermates and found that YM268 treatment resulted in large increases in GLUT4 protein, along with a generalized increase in membrane protein. They suggest that this change can account, at least in part, for the demonstrated amelioration of insulin resistance after treatment. This, and related work, give rise to two questions. First, what is the ultimate significance of changes in GLUT4 expression in adipose tissue? Secondly, how might thiazolidinediones be acting to regulate glucose transporter expression? Effects of thiazolidinediones on adipose tissue glucose transport activity and transporter expression have been reported since the earliest papers on these agents. A common observation, regardless of the animal model or agent tested, is that glucose transport activity is increased, as is GLUT4 expression (2–6) following treatment. These changes occur together with reductions in fasting glucose and insulin levels, so it is uncertain if the effects on transport/transporters are direct or due to the change in the metabolic environment. Considering the demonstrated abilities of glucose and insulin to regulate glucose transport, it is difficult to separate the cause from the effect. Studies in cultured cell systems, where glucose and insulin levels can be tightly controlled, could help to resolve this issue. 3T3-L1 and 3T3-F442A adipocytes have been treated with a variety of thiazolidinediones, resulting in increases in transport activity and transporter expression (7–11). However, these treatments were performed during fibroblast differentiation into adipocytes and, since the appearance of GLUT4 is one marker of adipocyte differentiation, it is uncertain whether this result is due to augmented differentiation, or a more specific effect on transport which would have greater relevance to the therapeutic situation where adipocytes are already differentiated. Given the results showing that thiazolidinediones alone can drive adipocyte differentiation (7, 11), or augment that due to insulin (7), it is even more difficult to draw definitive conclusions from the majority of these studies. However, it has been shown that troglitazone treatment of 3T3-L1 cells following differentiation into adipocytes resulted in upregulation of basal glucose transport and GLUT1 expression (11). GLUT4 expression was unaltered, further suggesting that changes in GLUT4 may be indirect responses in adipose cells. In even the most obese individual (or animal), the portion of a glucose load utilized in adipose tissue is a modest fraction of the total. It is glucose uptake into muscle that represents the major portion of insulinstimulated glucose uptake and is the most significant site of insulin resistance. Thiazolidinedione treatment of insulin resistant rodents has also been shown to augment glucose uptake into muscle as well as increase GLUT4 expression (2–4, 6, 8, 12–14). Such changes could account, to a greater extent, for increases in whole body glucose disposal and would represent the most significant action of thiazolidinediones. Again, the question remains whether these are direct effects of thiazolidinediones, or due to changes in insulin and glucose levels. Fortunately, data in cultured muscle cells are helpful in resolving this issue. Troglitazone treatment of L6 myocytes (15) and isolated rat cardiac myocytes (16) increased glucose transport and the expression of both GLUT1 and GLUT4. This effect was independent of differentiation because it occurred even in L6 cells that were not differentiated into myotubes (15) or in BC3H-1 myocytes (with pioglitazone) (17) that are incapable of differentiation. It should be noted that the non-differentiated myocytes express only GLUT1 and it is this isoform that is upregulated by thiazolidinedione treatment. We have performed similar European Journal of Endocrinology (1997) 137 610–612 ISSN 0804-4643

Evidence for involvement of protein kinase C (PKC)-zeta and noninvolvement of diacylglycerol-sensitive PKCs in insulin-stimulated glucose transport in L6 myotubes.

We examined the question of whether insulin activates protein kinase C (PKC)-zeta in L6 myotubes, and the dependence of this activation on phosphatidylinositol (PI) 3-kinase. We also evaluated a number of issues that are relevant to the question of whether diacylglycerol (DAG)-dependent PKCs or DAG-insensitive PKCs, such as PKC-zeta, are more likely to play a role in insulin-stimulated glucose transport in L6 myotubes and other insulin-sensitive cell types. We found that insulin increased the enzyme activity of immunoprecipitable PKC-zeta in L6 myotubes, and this effect was blocked by PI 3-kinase inhibitors, wortmannin and LY294002; this suggested that PKC-zeta operates downstream of PI 3-kinase during insulin action. We also found that treatment of L6 myotubes with 5 microM tetradecanoyl phorbol-13-acetate (TPA) for 24 h led to 80-100% losses of all DAG-dependent PKCs (alpha, beta1, beta2, delta, epsilon) and TPA-stimulated glucose transport (2-deoxyglucose uptake); in contrast, there was full retention of PKC-zeta, as well as insulin-stimulated glucose transport and translocation of GLUT4 and GLUT1 to the plasma membrane. Unlike what has been reported in BC3H-1 myocytes, TPA treatment did not elicit increases in PKCbeta2 messenger RNA or protein in L6 myotubes, and selective retention of this PKC isoform could not explain the retention of insulin effects on glucose transport after prolonged TPA treatment. Of further interest, TPA acutely activated membrane-associated PI 3-kinase in L6 myotubes, and acute effects of TPA on glucose transport were inhibited, not only by the PKC inhibitor, LY379196, but also by both wortmannin and LY294002; this suggested that DAG-sensitive PKCs activate glucose transport through cross-talk with phosphatidylinositol (PI) 3-kinase, rather than directly through PKC. Also, the cell-permeable, myristoylated PKC-zeta pseudosubstrate inhibited insulin-stimulated glucose transport both in non-down-regulated and PKC-depleted (TPA-treated) L6 myotubes; thus, the PKC-zeta pseudosubstrate appeared to inhibit a protein kinase that is required for insulin-stimulated glucose transport but is distinct from DAG-sensitive PKCs. In keeping with the latter dissociation of DAG-sensitive PKCs and insulin-stimulated glucose transport, LY379196, which inhibits PKC-beta (preferentially) and other DAG-sensitive PKCs at relatively low concentrations, inhibited insulin-stimulated glucose transport only at much higher concentrations, not only in L6 myotubes, but also in rat adipocytes, BC3H-1 myocytes, 3T3/L1 adipocytes and rat soleus muscles. Finally, stable and transient expression of a kinase-inactive PKC-zeta inhibited basal and insulin-stimulated glucose transport in L6 myotubes. Collectively, our findings suggest that, whereas PKC-zeta is a reasonable candidate to participate in insulin stimulation of glucose transport, DAG-sensitive PKCs are unlikely participants.

Insulin translocates PKC-ϵ and phorbol esters induce and persistently translocate PKC- β2 in BC3H-1 myocytes

Initial studies suggested that insulin increases diacylglycerol and activates protein kinase C (PKC) in BC3H-1 myocytes. In these earlier studies, insulin was found to translocate PKC-β, but the presence of PKC-ϵ was not appreciated. More recently, the presence of PKC-ϵ was documented, but PKC-β was not detected, and it was questioned whether insulin activates PKC in BC3H-1 myocytes [Stumpo, D.J., Haupt, D.M. and Blackshear, P.J. (1994) J. Biol. Chem. 269:21184–21190]. We questioned whether insulin translocates PKC-ϵ in BC3H-1 myocytes, and re-evaluated the question of whether myocytes truly contain a PKC-β isoform whose existence can be verified by its response to phorbol ester treatment. We found that PKC-ϵ was acutely translocated by insulin and phorbol esters from the cytosol to the membrane fraction in BC3H-1 myocytes; in addition, PKC-ϵ, like PKC-α, was depleted by chronic phorbol ester treatment. We also found that BC3H-I myocytes containing a 76,000 M r PKC-β isoform that is acutely translocated and subsequently depleted by phorbol esters. Moreover, chronic phorbol ester treatment induced an 84,000 Mr PKC- β 2 isoform that appeared to be persistently translocated and activated, as suggested by studies of myristoylated arginine-rich C kinase substrate (MARCKS) phosphorylation. We conclude that: (1) insulin acutely translocates PKC-ϵ, as well as PKC-β, in BC3H-1 myocytes; and (2) PKC-β is not truly downregulated by phorbol esters in BC3H-1 myocytes.

Protein degradation and increased mRNAs encoding proteins of the ubiquitin-proteasome proteolytic pathway in BC3H1 myocytes require an interaction between glucocorticoids and acidification.

In rats and humans, metabolic acidosis stimulates protein degradation and glucocorticoids have been implicated in this response. To evaluate the importance of glucocorticoids in stimulating proteolysis, we measured protein degradation in BC3H1 myocytes cultured in 12% serum. Acidification accelerated protein degradation but dexamethasone did not augment this response. To reduce the influence of glucocorticoids and other hormones and cytokines in 12% serum that could mediate proteolysis, we studied BC3H1 myocytes maintained in only 1% serum. Acidification of the medium or addition of dexamethasone at pH 7.4 did not significantly increase protein degradation, while acidification plus dexamethasone accelerated proteolysis. The steroid receptor antagonist RU 486 prevented this proteolytic response. Acidification of the medium with 1% serum did increase the mRNAs for ubiquitin and the C2 proteasome subunit, but when dexamethasone was added the mRNAs were increased significantly more. The steroid-receptor antagonist RU 486 suppressed this response to the addition of dexamethasone but the mRNAs remained at the levels measured in cells at pH 7.1 alone. Thus, acidification alone can increase the mRNAs of the ubiquitin-proteasome proteolytic pathway, but both acidosis and glucocorticoids are required to stimulate protein degradation. Since these changes occur without adding cytokines or other hormones, we conclude that the proteolytic response to acidification requires glucocorticoids.

Inositolphosphoglycans and diacylglycerol are possible mediators in the glycogenic effect of GLP-1(7-36)amide in BC3H-1 myocytes

Inositolphosphoglycans and diacylglycerol are possible mediators in the glycogenic effect of GLP-1(7-36)amide in BC3H-1 myocytes

Regulation of Alternative Splicing of Protein Kinase Cβ by Insulin

Insulin regulates a diverse array of cellular signaling processes involved in the control of growth, differentiation, and cellular metabolism. Insulin increases glucose transport via a protein kinase C (PKC)-dependent pathway in BC3H-1 myocytes, but the function of specific PKC isozymes in insulin action has not been elucidated. Two isoforms of PKC beta result via alternative splicing of precursor mRNA. As now shown, both isoforms are present in BC3H-1 myocytes, and insulin induces alternative splicing of the PKC beta mRNA thereby switching expression from PKC beta I to PKC beta II mRNA. This effect occurs rapidly (15 min after insulin treatment) and is dose-dependent. The switch in mRNA is reflected by increases in the protein levels of PKC beta II. High levels of 12-0-tetradecanoylphorbol-13-acetate, which are commonly used to deplete or down-regulate PKC in cells, also induce the switch to PKC beta II mRNA following overnight treatment, and protein levels of PKC beta II reflected mRNA increases. To investigate the functional importance of the shift in PKC beta isoform expression, stable transfectants of NIH-3T3 fibroblasts overexpressing PKC beta I and PKC beta II were established. The overexpression of PKC beta II but not PKC beta I in NIH-3T3 cells significantly enhanced insulin effects on glucose transport. This suggests that PKC beta II may be more selective than PKC beta I for enhancing the glucose transport effects of insulin in at least certain cells and, furthermore, that insulin can regulate the expression of PKC beta II by alternative mRNA splicing.

Monitoring metal concentrations in tissues and single cells using ultramicrosensors.

Intercellular and extracellular metal concentrations were measured using carbon fiber ultramicrosensors plated with mercury or with polymeric porphyrinic p-type semiconductors. Concentrations of unbound nickel and lead ions were studied within individual BC3H-1 myocytes, and H4-11-C3 rat hepatoma cells. Unbound ions are predominantly solvated inorganic ions not coordinated to biological cellular components. Fabrication of ultramicrosensors appropriate for the cells under investigation is described, including procedures for sharpening and waxing the microsensors in order to control the shape, area, and dimensions of the electroactive surface. Metal ion movement through cell membranes and intracellular ion diffusion in aorta tissue were studied.

Insulin-stimulated phosphatidylcholine hydrolysis, diacylglycerol/protein kinase C signalling, and hexose transport in pertussis toxin-treated BC3H-1 myocytes

Pertussis toxin was used to block insulin-stimulated phosphatidylinositol (PI)-glycan hydrolysis, consequent de novo synthesis of phosphatidic acid (PA) and the diacylglycerol (DAG) production that results from these two related processes in BC3H-1 myocytes. In contrast, pertussis toxin pretreatment did not inhibit insulin-stimulated hydrolysis of phosphatidylcholine (PC) which was found to be at least partly due to activation of a phospholipase D. Moreover, pertussis toxin-insensitive PC hydrolysis was accompanied by rapid biphasic increases in DAG and translocative activation of protein kinase C (PKC). Insulin-stimulated glucose transport was also insensitive to pertussis toxin pretreatment. Our findings suggest that insulin-stimulated PC hydrolysis pays an important role in DAG/PKC signalling during insulin action.

Insulin-like Effects of Sodium Orthovanadate on Diacylglycerol-Protein Kinase C Signaling in BC3H-1 Myocytes

In this paper we examine whether sodium orthovanadate activates diacylglycerol (DAG)/protein kinase C (PKC) signaling systems that are activated by insulin in BC3H-1 myocytes. Like insulin, sodium orthovanadate provoked increases in membrane DAG, PKC enzyme activity, and immunoreactive PKC-β. Concomitantly, both PKC enzyme activity and immunoreactive PKC-β decreased in the cytosol, suggesting that sodium orthovanadate, like insulin, stimulated the translocation of PKC-β from the cytosol to the membrane fraction. Sodium orthovanadate was also found to activate phospholipid signaling pathways that were previously reported to be activated by insulin, viz., inositol-lipid synthesis/turnover; phosphatidylcholine hydrolysis; and de novo phospholipid synthesis by activation of glycerol-3-PO4 acyltransferase. Our findings suggest that vanadate mimicks insulin in the activation of specific phospholipid/DAG/PKC signaling pathways.

Regulation of glucose transport by pioglitazone in cultured muscle cells

Recent evidence suggests that pioglitazone, a thiazolidinedione hypoglycemic agent, acts by increasing insulin responsiveness at the peripheral level. We studied the effect of pioglitazone (1 to 50 μg/mL) on the glucose transporter and glucose transport in BC3H-1 cells, a continuously cultured skeletal muscle cell line lacking the myoD transcription factor required for cell fusion. Glucose-fed cells (25 mmol/L) responded to insulin with a more than twofold increase in 2-deoxyglucose (2-DOG) uptake as compared with baseline. Treating these cells with pioglitazone alone for 24 hours resulted in a dose-dependent increase in hexose uptake, reaching twofold at 50 μg/mL. Combining long-term pioglitazone (10 μg/mL for 24 hours) and short-term insulin treatment resulted in an additive effect on 2-DOG uptake over a wide range of insulin concentrations (0.1 to 100 nmol/L) without the desensitization to 2-DOG uptake seen in other systems following long-term insulin administration. To determine the basis of the increased glucose uptake response, the level of specific mRNA and immunoreactive glucose transporter protein was determined. Northern and Western blot studies on glucose-treated cells (25 mmol/L) showed that glucose transporter mRNA and protein increased in parallel following treatment with either pioglitazone or insulin alone. The combination of insulin with pioglitazone resulted in an additive stimulation of glucose transporter mRNA and protein. In summary, pioglitazone stimulates hexose uptake both independently and in combination with insulin in BC3H-1 myocytes. These effects are largely accounted for by increases in glucose transporter mRNA and protein, indicating its potential efficacy in the treatment of non-insulin-dependent diabetes mellitus (NIDDM). These studies suggest that the hypoglycemic effect of pioglitazone is exerted in peripheral tissues at the pretranslational level, and provide a basis for studies of the molecular mechanisms of hypoglycemic agent action on glucose transporter gene transcription and mRNA stability.

Effects of insulin and phorbol esters on MARCKS (myristoylated alanine-rich C-kinase substrate) phosphorylation (and other parameters of protein kinase C activation) in rat adipocytes, rat soleus muscle and BC3H-1 myocytes

To evaluate the question of whether or not insulin activates protein kinase C (PKC), we compared the effects of insulin and phorbol esters on the phosphorylation of the PKC substrate, i.e. myristoylated alanine-rich C-kinase substrate (MARCKS). In rat adipocytes, rat soleus muscle and BC3H-1 myocytes, maximally effective concentrations of insulin and phorbol esters provoked comparable, rapid, 2-fold (on average), non-additive increases in the phosphorylation of immunoprecipitable MARCKS. These effects of insulin and phorbol esters on MARCKS phosphorylation in intact adipocytes and soleus muscles were paralleled by similar increases in the phosphorylation of an exogenous, soluble, 85 kDa PKC substrate (apparently a MARCKS protein) during incubation of post-nuclear membrane fractions in vitro. Increases in the phosphorylation of this 85 kDa PKC substrate in vitro were also observed in assays of both plasma membranes and microsomes obtained from rat adipocytes that had been treated with insulin or phorbol esters. These insulin-induced increases in PKC-dependent phosphorylating activities of adipocyte plasma membrane and microsomes were associated with increases in membrane contents of diacylglycerol, PKC-beta 1 and PKC-beta 2. Our findings suggest that insulin both translocates and activates PKC in rat adipocytes, rat soleus muscles and BC3H-1 myocytes.