Β-globin Gene Cluster Research Articles

Activation of γ-globin expression by a common variant disrupting IKAROS-binding motif in β-thalassemia

Programmed silencing of γ-globin genes in adult erythropoiesis is mediated by several chromatin remodeling complexes, which determine the stage-specific genome architecture in this region. Identification of cis- or trans-acting mutations contributing to the diverse extent of Hb F might illustrate the underlying mechanism of γ-β globin switching. Here, we recruit a cohort of 1142 β-thalassemia patients and dissect the natural variants in the whole β-globin gene cluster through a targeted next-generation sequencing panel. A previously unreported SNP rs7948668, predicted to disrupt the binding motif of IKAROS as a key component of chromatin remodeling complexes, is identified to be significantly associated with higher levels of Hb F and age at onset. Gene-editing on this SNP leads to elevation of Hb F in both HUDEP-2 and primary CD34+ cells while the extent of elevation is amplified in the context of β-thalassemia mutations, indicating epistasis effects of the SNP in the regulation of Hb F. Finally, we perform ChIP-qPCR and 4C assays to prove that this variant disrupts the binding motif of IKAROS, leading to enhanced competitiveness of HBG promoters to locus control regions. This study highlights the significance of common regulatory SNPs and provides potential targets for treating of β-hemoglobinopathy.

Trans-acting genetic modifiers of clinical severity in heterozygous β-Thalassemia trait.

There is a group of beta (β)-thalassemia trait 'carriers' (with heterozygous mutations) who should be asymptomatic with minor abnormalities in their hematological parameters, but experience more severe disease manifestations than predicted based solely on their β-globin genotype. This review focuses on literature describing trans-acting genetic modifiers outside of the α- and β-globin gene clusters that could cause this phenomenon. These genetic modifiers are categorized into: mutations affecting the quantity of alpha-globin products, non-globin mutations affecting erythropoiesis, membranopathies, enzymopathies and erythrocyte-independent modifiers of complications relating to β-thalassemia. Although some genetic determinants seem to correlate more directly with β-thalassemia trait severity, such as mutations in SUPT5H, PIEZO1 and hereditary elliptocytosis, the difficulties of linking the contribution of other modulating factors are elucidated in this review. Targeted next generation sequencing of hemolytic anemias can be helpful but also raises another quandary in interpreting variants of uncertain significance. The accrual of knowledge, along with the increased availability of genetic testing for genetic modifiers has considerable potential for clinical applications such as genetic counselling, decision-making for clinical interventions and prognostication, and perhaps generating new therapeutic targets.

Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families

Backgroundβ-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.ResultsIn this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major.ConclusionOur study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

-Thalassemia: Report of two cases in a family.

Case 1 presented with severe anemia and received an intrauterine blood cell transfusion at 33weeks of gestation. The anemia spontaneously improved in early infancy. Case 2, the father of Case 1, had an uneventful birth with no evidence of anemia, though microcytic anemia was observed during childhood. The genetic analysis of the β-globin gene cluster identified a novel heterozygous deletion of DNA extending from the Gγ-globin gene downstream to the β-globin gene, confirming a diagnosis of (G γA γδβ)0 -thalassemia. In cases where thalassemia is suspected based on blood tests, a genetic diagnosis should be performed for the sake of the offspring.

Responses of β-thalassemia and compound heterozygote of Sickle/βthalassemia of BCL11A Gene Polymorphism in Pakistani Patients.

Beta-thalassemia major (β-Thal) and compound heterozygote of Sickle β-thalassemia (S-β Thal) are hereditary autosomal recessive disorders resulting from mutations or deletion in β-globin gene cluster. Patients with increased HbF levels having polymorphism at BCL11A site loci have shown clinical significance. The present study aimed to assess the frequency of BCL11A gene polymorphism in a study population of β-Thal, S-β Thal & Controls using Sanger sequencing leading to plot the HbF response of polymorphism with reference to wild type. The sample size of the study is n=180, groups were divided in Controls, β-thal & S-β thal. One ml blood was drawn from patients and controls to extract DNA for PCR amplification and BCL11A locus genotyping using Sanger sequencing. This study was carried out at Dow Research Institute of Biotechnology and Biomedical Sciences, for one year from March 2021 to February 2022. The HbF response of three groups is hyperbolic with 83 for β-Thal, 16 for S-β Thal and close to zero for controls. The frequency of heterozygous variant GA of BCL11A gene polymorphism is 51%. The frequency of homozygous variant GG is 49%. Complete absence of wild type AA in patient group. The frequency of BCL11A polymorphism in control group was 43% (with male 18% and female 21%) showing wild type status of 57%. The patient groups of SCD and Beta thalassemia are devoid of wild type status. The wild type status of BCL11A is 57% even in control population. Higher level of HbF in B-thalassemia and SCD and B Thalassemia is a cost-effective screening marker before switching to an expensive genotyping testing.

The role of GATA switch in benzene metabolite hydroquinone inhibiting erythroid differentiation in K562 cells.

The phenolic metabolite of benzene, hydroquinone (HQ), has potential risks for hematological disorders and hematotoxicity in humans. Previous studies have revealed that reactive oxygen species, DNA methylation, and histone acetylation participate in benzene metabolites inhibiting erythroid differentiation in hemin-induced K562 cells. GATA1 and GATA2 are crucial erythroid-specific transcription factors that exhibit dynamic expression patterns during erythroid differentiation. We investigated the role of GATA factors in HQ-inhibited erythroid differentiation in K562 cells. When K562 cells were induced with 40μM hemin for 0-120h, the mRNA and protein levels of GATA1 and GATA2 changed dynamically. After exposure to 40μM HQ for 72h, K562 cells were induced with 40μM hemin for 48h. HQ considerably reduced the percentage of hemin-induced Hb-positive cells, decreased the GATA1 mRNA, protein, and occupancy levels at α-globin and β-globin gene clusters, and increased the GATA2 mRNA and protein levels significantly. ChIP-seq analysis revealed that HQ reduced GATA1 occupancy, and increased GATA2 occupancy at most gene loci in hemin-induced K562 cells. And GATA1 and GATA2 might play essential roles in the erythroid differentiation protein interaction network. These results elucidate that HQ decreases GATA1 occupancy and increases GATA2 occupancy at the erythroid gene loci, thereby downregulating GATA1 and upregulating GATA2 expression, which in turn modulates the expression of erythroid genes and inhibits erythroid differentiation. This partially explains the mechanism of benzene hematotoxicity.

Beta Globin Gene Cluster Haplotypes in Beta Thalassemia in the Kurdistan Region of Iraq

β-thalassemia is a prevalent inherited red cell disorder in the Kurdistan region of Iraq. To determine the chromosomal background of the frequent β-thalassemia mutations in the latter region, we investigated the β-globin gene cluster haplotypes in 202 β-thalassemia chromosomes. Haplotypes analysis utilized restriction fragment length polymorphism-PCR of seven restriction sites through the β-globin gene cluster. It was observed that IVS-II-1 (G > A) was mainly associated with haplotype III (68.8%), IVS-1-110 (G > A), codon 8/9 (+G) and codon 44 (-C) with haplotype I (in 90.0%, 100%, and 62.5% respectively), IVS-1-6 (T > C) with haplotype VI (97.4%), codon 8 (-AA) with haplotype IV (75%), codon 5(-CT) and IVS1.1 (G > A) with haplotype V (55.6% and 58.3% respectively), while codon 39 (C > T) and IVS1.5 (G > C) were mainly associated with haplotype VII (85.7% and 75% respectively). These observations support the notion that while some mutations may have originated in the Kurdistan region, others were more likely brought in by gene flow from neighboring countries or the Indian subcontinent. The association of some β-thalassemia defects with more than one haplotype may be due to mutations or recombination events.

εγ-Thalassemia, a New Hemoglobinopathy Category.

Large β-globin gene cluster deletions (hereditary persistence of fetal hemoglobin [Hb] or β-, δβ-, γδβ-, and ϵγδβ-thalassemia), are associated with widely disparate phenotypes, including variable degrees of microcytic anemia and Hb F levels. When present, increased Hb A2 is used as a surrogate marker for β-thalassemia. Notably, ϵγδβ-thalassemias lack the essential regulatory locus control region (LCR) and cause severe transient perinatal anemia but normal newborn screen (NBS) results and Hb A2 levels. Herein, we report a novel deletion of the ϵ, Aγ, Gγ, and ψβ loci with intact LCR, δ-, and β-regions in 2 women and newborn twins. Capillary electrophoresis (CE), high-performance liquid chromatography (HPLC), DNA sequencing, multiplex ligation-dependent probe amplification (MLPA), gap-polymerase chain reaction (gap-PCR), and long-read sequencing (LRS) were performed. NBS showed an Hb A > Hb F pattern for both twins. At 20 months, Hb A2 was increased similarly to that in the mother and an unrelated woman. Unexplained microcytosis was absent and the twins lacked severe neonatal anemia. MLPA, LRS, and gap-PCR confirmed a 32 599 base pair deletion of ϵ (HBE1) through ψβ (HBBP1) loci. This deletion represents a hemoglobinopathy category with a distinct phenotype that has not been previously described, an ϵγ-thalassemia. Both the NBS Hb A > F pattern and the subsequent increased Hb A2 without microcytosis are unusual. A similar deletion should be considered when this pattern is encountered and appropriate test methods selected for detection. Knowledge of the clinical impact of this new category will improve genetic counselling, with distinction from the severe transient anemia associated with ϵγδβ-thalassemia.

To Study the β-Globin Haplotype Pattern of Descent of a Set of Linked Alleles Occurring on the Same Chromosome in the Northern Province of India.

To study the five mutations commonly prevalent in North India, i.e., IVS-I-5 (G→C), 619 bp deletion, IVS-I-1 (G→T), codon 41/42 (-TTCT), and codon 8/9 (+G), in the betathalassemia (β-thalassemia) major children. The specific β-thalassemia mutations of different haplotype patterns of the β-globin gene cluster will also be determined. A total of125 children diagnosed with β-thalassemia major visiting the Department of Pediatrics of King George's Medical University were involved in the study. As per the QIAamp (Qiagen, Hilden, Germany) manufacturer guidelines, genomic DNA was isolated from whole blood. To identify the haplotype pattern within the β-globin gene cluster, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis was used. The respective restriction endonucleases used were Hind III/GƔ, Hinc II/Ψß, Hinf I/ß, Ava II/ß,and BamHI for the haplotype analysis in the β-globin pattern of descent of a set of linked alleles occurring on the same chromosome. Among the five common mutations, 73 patients had IVS-I-5 (G→C), 28 patients had 619 bp deletion, 17 patients had IVS-I-1 (G→T), five patients had Cd 41/42 (-TTCT), and two patients had Cd 8/9 (+G) mutations. Fifteen haplotypes (haplotypes 1-15) were identified in 125 β-thalassemia major children. Among the five haplotypes observed in the IVS-I-5 (G→C) mutation, the H1 haplotype was most predominant with a frequency of 27.2%, followed by the H2, H4, H3, and H10 haplotypes in the given population. In 619 bp deletion, IVS-I-1 (G→T), codon 41/42, and codon 8/9, haplotype H9, H12, H11, and H5were seen, respectively. β-thalassemia was found to be the most common in the northern province of Uttar Pradesh. The linkage of β-globin gene haplotypes with β-thalassemia mutations was explored in the northern provinceof Uttar Pradesh. The population of different natives is being mixed up due to migration and industrialization. These were some reasons for the occurrence of haplotypic heterogeneity. This haplotype heterogeneity was correlated with the origin of these mutations found to be unlike the origin of common ones from different provinces.

Gene Therapy for β-Hemoglobinopathies: From Discovery to Clinical Trials.

Investigations to understand the function and control of the globin genes have led to some of the most exciting molecular discoveries and biomedical breakthroughs of the 20th and 21st centuries. Extensive characterization of the globin gene locus, accompanied by pioneering work on the utilization of viruses as human gene delivery tools in human hematopoietic stem and progenitor cells (HPSCs), has led to transformative and successful therapies via autologous hematopoietic stem-cell transplant with gene therapy (HSCT-GT). Due to the advanced understanding of the β-globin gene cluster, the first diseases considered for autologous HSCT-GT were two prevalent β-hemoglobinopathies: sickle cell disease and β-thalassemia, both affecting functional β-globin chains and leading to substantial morbidity. Both conditions are suitable for allogeneic HSCT; however, this therapy comes with serious risks and is most effective using an HLA-matched family donor (which is not available for most patients) to obtain optimal therapeutic and safe benefits. Transplants from unrelated or haplo-identical donors carry higher risks, although they are progressively improving. Conversely, HSCT-GT utilizes the patient's own HSPCs, broadening access to more patients. Several gene therapy clinical trials have been reported to have achieved significant disease improvement, and more are underway. Based on the safety and the therapeutic success of autologous HSCT-GT, the U.S. Food and Drug Administration (FDA) in 2022 approved an HSCT-GT for β-thalassemia (Zynteglo™). This review illuminates the β-globin gene research journey, adversities faced, and achievements reached; it highlights important molecular and genetic findings of the β-globin locus, describes the predominant globin vectors, and concludes by describing promising results from clinical trials for both sickle cell disease and β-thalassemia.

Association of β-Globin Gene Haplotypes with Haematological Parameters and Foetal Haemoglobin among Patients with Sickle Cell Disorder in Raipur, Chhattisgarh, India

Introduction: Sickle cell disease is caused by a single nucleotide substitution in the β-globin gene. The variations in Foetal Haemoglobin (HbF) levels, β-globin gene cluster haplotype have been used as predictors of disease severity in sickle cell disease patients. Aim: To determine the frequency of β-globin gene haplotypes in sickle cell disease patients and also to establish their association with haematological parameters and HbF. Materials and Methods: The present cross-sectional study was conducted in Department of Biochemistry, Government Medical College, Jagdalpur, Chhattisgarh, India, in collaboration with Department of Biotechnology, Government Nagarjuna PG College of Science, Raipur, Chhattisgarh, India, from April 2021 to May 2022. A total of 100 patients with Sickle Cell Disease (SCD) and 50 with sickle cell traits were included in the study. Haplotypes were identified by Restriction Fragment Length Analysis (RFLP) method for seven polymorphic sites in β-globin gene cluster. Haematological parameters such as Hb, Haematocrit (HCT), Mean Cell Volume (MCV), Mean Cell Haemoglobin (MCH) and HbF levels were estimated. Data was analysed using various statistical tests such as ShapiroWilk test, Levene’s test, student t-test, Mann-Whitney test and Kruskal-Wallis tests as per analysis requirement. Results: In the present study, 51 (51%) males and 49 (49%) females were in sickle cell disease group (SS), while 25 (50%) males and 25 (50%) females were in sickle cell trait group (AS). The mean age of the sickle cell disease patients was 23.84±8.38 years and for sickle cell trait group was 26.3±7.37 years. There was a significant difference (p-value <0.0001) in HbF levels among haplotypes. Additionally, higher HbF concentration was found in Arab-Indian haplotypes in SCD patients. No significant association was observed between the haplotypes and haematological parameters. Conclusion: The findings suggested that haematological parameters were not significantly associated with β-globin gene haplotypes. The β-globin gene haplotypes influence the HbF levels in sickle cell patients.

Epidemiological and molecular study of hemoglobinopathies in Mauritanian patients.

BackgroundHemoglobinopathies, inherited disorders of hemoglobin (Hb), are the most common hereditary monogenic diseases of the red cell in the world. Few studies have been conducted on hemoglobinopathies in Mauritania. Therefore, the aim of this work is to establish the molecular and epidemiological basis of hemoglobinopathies in a cohort of Mauritanian patients and to determine the haplotype of the β‐globin gene cluster in sickle cell subjects.MethodsThe molecular screening of Hb disorders in 40 Mauritanian patients was done by a polymerase‐restriction fragment length polymorphism (RFLP) for the sickle cell disease (SCD) mutation, a PCR/sequencing method for β‐thalassemia mutations, and by the multiplex polymerase chain reaction method for the α‐thalassemia. The exploration of eight polymorphic sites (SNPs) within the β‐globin gene cluster was conducted by PCR/RFLP method, to identify the HbS haplotypes from the sickle cell subjects.ResultsThe epidemiological study of our patients showed a high incidence in the Senegal River area (52.5%) and a high ethnic prevalence for the Heratin (47.5%) and the Pular (35%). Molecular study allowed us to identify eight different mutations in our sample analyzed. They are respectively: HbS (HBB:c.20A>T) (68.75%), Cd44 ‐C (HBB:c.135delC) (8.75%), −29A>G (HBB:c.‐79A>G) (4.8%), −α‐3.7 (g.34164_37967del3804) (3.75%), IVS‐II‐849A>G (HBB:c.316‐2A>G) (2.25%) and Cd24T>A (HBB:c.75T>A), Hb Siirt (HBB:c.83C>G) and HbC (HBB:c.19G>A) each with (1.25%). Six different haplotypes are being explored among the SCD subjects with the Senegal haplotype as the most prevalent (66.7%), followed by Benin (10%), Arab‐Indians (6.7%), Bantu (3.3%), and two atypical haplotypes.ConclusionOur findings enrich the epidemiological data in our population and could contribute to the establishment of a strategy of prevention and management through screening, genetic counseling, and prenatal diagnosis of Hemoglobinopathies in the Mauritanian population.

Segregation of α- and β-Globin Gene Cluster in Vertebrate Evolution: Chance or Necessity?

The review is devoted to the patterns of evolution of α- and β-globin gene domains. A hypothesis is presented according to which segregation of the ancestral cluster of α/β-globin genes in Amniota occurred due to the performance by α-globins and β-globins of non-canonical functions not related to oxygen transport.

A Novel 5 kb Deletion in the β-Globin Gene Cluster Identified in a Chinese Patient

β-Thalassemia (β-thal), a highly prevalent disease in tropical and subtropical regions of Southern China, is caused mainly by point mutations in the β-globin gene cluster. However, large deletions have also been found to contribute to some types of β-thal. We identified a novel 5 kb deletion in the β-globin cluster in a Chinese patient using multiplex ligation-dependent probe amplification (MLPA), and characterized it with single molecule real-time (SMRT) sequencing, gap-polymerase chain reaction (gap-PCR) and Sanger sequencing. The deletion was located between positions 5226189 and 5231091 on chromosome 11 (GRCh38), extending from 4 kb upstream of the 5' untranslated region (5'UTR) to the second intron of the β-globin gene. The patient with this deletion presented with microcytosis and hypochromic red cells, as well as relatively high Hb F and Hb A2 levels. Our research indicated that SMRT sequencing is a useful tool for accurate detection of large deletions. Our study broadens the spectrum of deletional β-thalassemias and provides a perspective for further study of the function of the β-globin cluster.

Haplotype analysis of Bangladeshi β-thalassaemia patients: A pilot study

β-thalassaemia is one of the major genetic disorders in Bangladeshi population. Nevertheless, systematic study on the genetic basis of this disease in Bangladeshi population is very limited. The major aim of this study was to identify and characterize the β-globin gene cluster haplotype in Bangladeshi β-thalassaemia patients. For this, β-thalassaemia patients diagnosed on haematological observations were tested at the genetic level for different β-globin cluster haplotypes. Twenty-eight β-globin gene clusters of fourteen confirmed β-thalassaemia patients were analyzed using PCR amplification and Restriction Fragment Length Polymorphism (RFLP). Type VII haplotype was found to be the most common β-globin gene cluster haplotype in the studied population. Two of the patients had Type VII haplotype in homozygous form. Only one patient had atypical haplotype in one locus. The study reports β-globin cluster haplotype of fourteen Bangladeshi patients for the first time. However, it should be noted that small size precludes the possibility of determining the detailed distribution of different haplotypes and their association with different β-thalassaemia mutations. Dhaka Univ. J. Biol. Sci. 30(3 CSI): 479-486, 2022 (June)

Hb F Levels in β-Thalassemia Carriers and Normal Individuals: Known and Unknown Quantitative Trait Loci in the β-Globin Gene Cluster

In the already identified quantitative trait loci (QTL), modulating Hb F levels are cis-acting haplotypes of the β-globin gene cluster itself, although the single nucleotide polymorphisms (SNPs) accounting more for the association, remain uncertain. In this study, the role in Hb F production of previously reported candidate SNPs within the β-globin gene cluster was reexamined, along with a yet poorly studied variation in the BGLT3 gene. In a sample of β-thalassemia (β-thal) carriers, we succeeded in replicating the significant association between increased Hb F levels and rs7482144 (C>T) (HBG2 XmnI), which is the most well-established variation in the cluster influencing the trait. This SNP was found to be in strong linkage disequilibrium (LD) with a variation in the HBBP1 gene [rs10128556 (G>A)], which consistently revealed a similar association signal. Remarkably, much stronger than the latter associations were those involving both rs968857 (T allele) (3' HBBP1) and rs7924684 (G allele) (BGLT3), two SNPs that were also in strong LD. As the pattern of LD detected in the β-globin gene cluster does not correlate with a tight linkage between markers, complex interactions between SNPs at the cluster seem to modulate Hb F. Seeing that no such associations were detected in normal subjects, the question can be raised on whether, under erythropoiesis stress, epigenetic mechanisms contribute to change the regulation of the entire β-globin gene cluster. In conclusion, we provide statistical evidence for a new player within the β-globin gene cluster, BGLT3, that in cooperation with other regions influences Hb F levels in β-thal carriers.

Molecular Analysis of Xmn1-Polymorphic Site ´5 to Gγ of the β-Globin Gene Cluster in a Saudi Population of Jazan Region in Correlation with Hb F Expression.

The southern part of Saudi Arabia has an ethnically diverse population where sickle-cell anemia (sickle cell disease) is common, but little is known about its βs haplotypes. The goal of the current study is to ascertain the prevalence of the Hb S gene with analysis of Xmn1 ′5 to Gγ haplotype among the Saudi population in the Jazan area. Initially recorded findings of (1) Hb S gene and (2) hematological parameters with Hb F levels were collected from 5990 participants. Then, the second series of 70 different patients with established sickling disease and 30 healthy individuals as a control group was recruited, in which the genotype of Xmn1 ′5 to Gγ-SNP was performed by PCR-RFLP. In the first series, the prevalence of Hb types was AA at 86.8% (N = 5198), AS at 12.4% (N = 745), and SS at 0.8% (N = 47). Of the second series, three patients (4.3%) were (±) Xmn1 ′5 to Gγ and 67 (95.7%) were (−/−) in Xmn1 ′5 to Gγ. In the controls, the (±) Xmn1 ′5 to Gγ was observed in only one individual (3.3%), aged 30. These findings possibly represent a new Saudi haplotype, [±] Xmn1 ′5 to Gγ. Our results demonstrate that most patients with SCD in Jazan have [−/−] Xmn1 with higher levels of Hb F and positive Xmn1 ′5 to Gγ normally associated with a low level of Hb F.

Structural switching/polymorphism by sequential base substitution at quasi-palindromic SNP site (G → A) in LCR of human β-globin gene cluster

The human β-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression contains five tissue-specific DNase I-hypersensitive sites (HSs). A single nucleotide polymorphism (SNP) (A → G) present in HS4 region of locus control region (LCR), have shown a notable association between the G allele and the occurrence of β-thalassemia. This SNP site exhibiting a hairpin − duplex equilibrium manifested in A → B like DNA transition has previously been reported from this laboratory. Since, DNA is a dynamic and adaptable molecule, so any change of a single base within a primary DNA sequence can produce major biological consequences commonly manifested in genetic disorders such as sickle cell anemia and β-thalassemia. Herein, the differential behavior of sequential single base substitutions G → A on the quasi-palindromic sequence (d-TGGGGGCCCCA; HPG11) has been explored. A combination of native gel electrophoresis, circular dichroism (CD), and UV-thermal denaturation (Tm) techniques have been used to investigate the structural polymorphism associated with various variants of HPG11 i.e. HPG11A2 to HPG11A5. The CD spectra confirmed that all the HPG11 variants exhibit a hairpin − duplex equilibrium. Oligomer concentration dependence on CD spectra has been correlated with A → B DNA conformational transition. However, as revealed in gel electrophoresis, HPG11A2 → A5 exhibit the formation of a tetramolecular structure (four-way junction) at higher oligomer concentration. UV-melting studies also supported the melting of hairpin, duplex and four-way junction structure. This polymorphism pattern may possibly be significant for DNA-protein recognition, in the process of regulation of LCR in the β-globin gene.

Genetic research and clinical analysis of β-globin gene cluster deletions in the Chinese population of Fujian province: A 14-year single-center experience.

BackgroundHeterozygotes of HPFH and δβ thalassemia are clinically asymptomatic or have mild hemoglobin (Hb) values. However, when both HPFH and δβ‐thalassemia are coinherited with heterozygous β‐thalassemia, patients may progress to a clinical phenotype of thalassemia intermedia or thalassemia major. The purpose of this study was to characterize the genotypes and analyze the phenotypes of these disorders in Fujian Province, to offer advice for genetic counseling and accurate prenatal diagnosis in this region. A total of 55 001 subjects were participated in thalassemia screening. 142 subjects with HbF levels ≥10%, before the blood transfusion, were selected for further investigation.MethodsMultiplex ligation‐dependent probe amplification (MLPA) and Gap‐PCR were used to screen for three β‐globin gene cluster deletions: Chinese Gγ(Aγδβ)0 thalassemia and Southeast Asia HPFH (SEA‐HPFH) deletion and 1357 bp deletion (NG‐000007.3:g.69997‐71353 del 1357).ResultsA total of 142 patients with HbF (≥10%) were enrolled to characterize the molecular basis of β‐globin gene cluster deletions in our study; 22 cases 0.04% (22/55 001) were definitively diagnosed with β‐globin gene cluster deletions. Ten cases were heterozygous for the Chinese Gγ(Aγδβ)0‐thal mutations, 10 cases were heterozygous for SEA‐HPFH, and one case was compound heterozygous for SEA‐HPFH and the α‐thal mutation. The 1357 bp deletion (NG‐000007.3:g.69997‐71353 del 1357) was detected in one case. Moreover, the hemoglobin A2 levels in patients who were heterozygous for Chinese Gγ(Aγδβ)0‐thal were statistically lower than in cases with SEA‐HPFH deletion(p < 0.05).ConclusionIn Fujian Province, the prevalence of common β‐globin gene cluster deletions was 0.04%. What's more, the most common β‐globin cluster deletions are the Chinese Gγ(Aγδβ)0 and SEA‐HPFH.

Improved Characterization of Complex β-Globin Gene Cluster Structural Variants Using Long-Read Sequencing

Complex insertion-deletion (indel) events in the globin genes manifest in widely variable clinical phenotypes. Many are incompletely characterized because of a historic lack of efficient methods. A more complete assessment enables improved prediction of clinical impact, which guides emerging therapeutic choices. Current methods have limited capacity for breakpoint assignment and accurate assessment of mutation extent, especially in cases containing duplications or multiple deletions and insertions. Technology, such as long-read sequencing, holds promise for significant impact in the characterization of indel events because of read lengths that span large regions, resulting in improved resolution. Four known complex β-globin gene cluster indel types were assessed using single-molecule, real-time sequencing technology and showed high correlation with previous reports, including the Caribbean locus control deletion (g.5,305,478_5,310,336del), a large β-gene duplication containing the Hb S mutation (g.4,640,335_5,290,171dup with g.5,248,232T>A, c.20A>T; variant allele fraction, 64%), and two nested variants (double deletions with intervening inversion): the Indian Gγ(Aγδβ)0-thalassemia (g.5,246,804-5,254,275del, g.5,254,276_5,269,600inv, and g.5,269,601_5,270,442del) and the Turkish/Macedonian (δβ)0 thalassemia (g.5,235,064_5,236,652del, g.5,236,653_5,244,280inv, and g.5,244,281_5,255,766del). Our data confirm long-read sequencing as an efficient and accurate method to identify these clinically significant complex events. Limitations include high-complexity sample preparation requirements, which hinder routine use in clinical laboratories. Continued improvements in sample and data workflow processes are needed to accommodate volumes in a tertiary clinical laboratory.