Β-galactosidase Fusion Research Articles

Protein G: β-galactosidase fusion protein for multi-modal bioanalytical applications.

β-galactosidase (β-gal) is one of the most prevalent markers of gene expression. Its activity can be monitored via optical and fluorescence microscopy, electrochemistry, and many other ways after slight modification using protein engineering. Here, we have constructed a chimeric version that incorporates a streptococcal protein G domain at the N-terminus of β-gal that binds immunoglobins, namely IgG. This protein G: β-galactosidase fusion enables β-gal-based spectrophotometric and electrochemical measurements of IgG. Moreover, our results show linearity over an industrially relevant range. We demonstrate applicability with rapid spectroelectrochemical detection of IgG in several formats including using an electrochemical sensing interface that is rapidly assembled directly onto electrodes for incorporation into biohybrid devices. The fusion protein enables sensitive, linear, and rapid responses, and in our case, makes IgG measurements quite robust and simple, expanding the molecular diagnostics toolkit for biological measurement.

Nucleocytoplasmic shuttling of the human parainfluenza virus type 2 phosphoprotein

Human parainfluenza virus type 2 phosphoprotein (P) is an essential component of viral polymerase. The P gene encodes both P and accessory V proteins by a specific gene editing mechanism. Therefore, the N-terminal 164 amino acids of P protein are common to V protein. Interestingly, while P protein is located in the cytoplasm, V protein is found mainly in the nucleus. Using deletion mutants, we show the presence of a nuclear localization signal (NLS) in the P/V common domain, and a nuclear export signal (NES) in the C-terminal P specific region. The NLS region makes a complex with importin α5 or 7. In the presence of leptomycin B, P protein is retained in the nucleus, indicating that it contains a CRM1-dependent NES. We identified the NLS (65PVKPRRKK72) and the NES (225IIELLKGLDL234) using β-galactosidase fusion proteins. Moreover, nucleocytoplasmic shuttling of P protein appears to be important for efficient viral polymerase activity.

A Plasmid-Transposon Hybrid Mutagenesis System Effective in a Broad Range of Enterobacteria.

Random transposon mutagenesis is a powerful technique used to generate libraries of genetic insertions in many different bacterial strains. Here we develop a system facilitating random transposon mutagenesis in a range of different Gram-negative bacterial strains, including Pectobacterium atrosepticum, Citrobacter rodentium, Serratia sp. ATCC39006, Serratia plymuthica, Dickeya dadantii, and many more. Transposon mutagenesis was optimized in each of these strains and three studies are presented to show the efficacy of this system. Firstly, the important agricultural pathogen D. dadantii was mutagenized. Two mutants that showed reduced protease production and one mutant producing the previously cryptic pigment, indigoidine, were identified and characterized. Secondly, the enterobacterium, Serratia sp. ATCC39006 was mutagenized and mutants incapable of producing gas vesicles, proteinaceous intracellular organelles, were identified. One of these contained a β-galactosidase transcriptional fusion within the gene gvpA1, essential for gas vesicle production. Finally, the system was used to mutate the biosynthetic gene clusters of the antifungal, anti-oomycete and anticancer polyketide, oocydin A, in the plant-associated enterobacterium, Dickeya solani MK10. The mutagenesis system was developed to allow easy identification of transposon insertion sites by sequencing, after facile generation of a replicon encompassing the transposon and adjacent DNA, post-excision. Furthermore, the system can also create transcriptional fusions with either β-galactosidase or β-glucuronidase as reporters, and exploits a variety of drug resistance markers so that multiple selectable fusions can be generated in a single strain. This system of various transposons has wide utility and can be combined in many different ways.

Identification and characterization of complex dual nuclear localization signals in human bocavirus NP1

Human bocavirus (HBoV), closely related to canine minute virus (MVC) and bovine parvovirus (BPV), is a new member of the Bocavirus genus within the Parvoviridae family. The non-structural protein NP1 of HBoV is a nuclear localized protein and plays an important role in DNA replication as well as in the evasion of host innate immunity. In the current study, we provide the first evidence that NP1 possesses a non-classical nuclear localization signal (ncNLS) (amino acids 7-50). Embedded within this ncNLS is a classical bipartite nuclear localization signal (cNLS) (amino acids 14-28), capable of transporting a heterologous cytoplasmic protein β-galactosidase fusion protein (β-gal-EGFP) to the nucleus via the classical importin α/β1-mediated pathway. Amino acids 7-50 containing the cNLS and the ncNLS of NP1 or full-length NP1 interact with importin α1, importin β1 and importin β1Δ, which lacks the importin α binding domain, indicating that the nuclear import of NP1 is through both conventional importin α/β1 heterodimer- and non-classical importinß1-mediated pathways. Given that the arrangement of a cNLS embedded within an ncNLS is unusual in viral proteins, our data together reveal a novel molecular mechanism underlying the nuclear import of HBoV NP1, providing a basis for further understanding its biological function.

Cooperation between two ClpB isoforms enhances the recovery of the recombinant β-galactosidase from inclusion bodies

Bacterial ClpB is a molecular chaperone that solubilizes and reactivates aggregated proteins in cooperation with the DnaK chaperone system. The mechanism of protein disaggregation mediated by ClpB is linked to translocation of substrates through the central channel within the ring-hexameric structure of ClpB. Two isoforms of ClpB are produced in vivo: the full-length ClpB95 and the truncated ClpB80 (ClpBΔN), which does not contain the N-terminal domain. The functional specificity of the two ClpB isoforms and the biological role of the N-terminal domain are still not fully understood. Recently, it has been demonstrated that ClpB may achieve its full potential as an aggregate-reactivating chaperone through the functional interaction and synergistic cooperation of its two isoforms. It has been found that the most efficient resolubilization and reactivation of stress-aggregated proteins occurred in the presence of both ClpB95 and ClpB80. In this work, we asked if the two ClpB isoforms functionally cooperate in the solubilization and reactivation of proteins from insoluble inclusion bodies (IBs) in Escherichia coli cells. Using the model β-galactosidase fusion protein (VP1LAC), we found that solubilization and reactivation of enzymes entrapped in IBs occurred more efficiently in the presence of ClpB95 with ClpB80 than with either ClpB95 or ClpB80 alone. The two isoforms of ClpB chaperone acting together enhanced the solubility and enzymatic activity of β-galactosidase sequestered into IBs. Both ClpB isoforms were associated with IBs of β-galactosidase, what demonstrates their affinity to this type of aggregates. These results demonstrate a synergistic cooperation between the two isoforms of ClpB chaperone. In addition, no significant recovery of the β-galactosidase from IBs in ΔclpB mutant cells suggests that ClpB is a key chaperone in IB protein release.

Transcriptional Activity and Nuclear Localization of Cabut, the Drosophila Ortholog of Vertebrate TGF-β-Inducible Early-Response Gene (TIEG) Proteins

BackgroundCabut (Cbt) is a C2H2-class zinc finger transcription factor involved in embryonic dorsal closure, epithelial regeneration and other developmental processes in Drosophila melanogaster. Cbt orthologs have been identified in other Drosophila species and insects as well as in vertebrates. Indeed, Cbt is the Drosophila ortholog of the group of vertebrate proteins encoded by the TGF-ß-inducible early-response genes (TIEGs), which belong to Sp1-like/Krüppel-like family of transcription factors. Several functional domains involved in transcriptional control and subcellular localization have been identified in the vertebrate TIEGs. However, little is known of whether these domains and functions are also conserved in the Cbt protein.Methodology/Principal FindingsTo determine the transcriptional regulatory activity of the Drosophila Cbt protein, we performed Gal4-based luciferase assays in S2 cells and showed that Cbt is a transcriptional repressor and able to regulate its own expression. Truncated forms of Cbt were then generated to identify its functional domains. This analysis revealed a sequence similar to the mSin3A-interacting repressor domain found in vertebrate TIEGs, although located in a different part of the Cbt protein. Using β-Galactosidase and eGFP fusion proteins, we also showed that Cbt contains the bipartite nuclear localization signal (NLS) previously identified in TIEG proteins, although it is non-functional in insect cells. Instead, a monopartite NLS, located at the amino terminus of the protein and conserved across insects, is functional in Drosophila S2 and Spodoptera exigua Sec301 cells. Last but not least, genetic interaction and immunohistochemical assays suggested that Cbt nuclear import is mediated by Importin-α2.Conclusions/SignificanceOur results constitute the first characterization of the molecular mechanisms of Cbt-mediated transcriptional control as well as of Cbt nuclear import, and demonstrate the existence of similarities and differences in both aspects of Cbt function between the insect and the vertebrate TIEG proteins.

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P₅₂₂₈ promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P₅₂₂₈ promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P₅₂₂₈-β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P₅₂₂₈ promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

An Antirepressor, SrpR, Is Involved in Transcriptional Regulation of the SrpABC Solvent Tolerance Efflux Pump of Pseudomonas putida S12

Organic compounds exhibit various levels of toxicity toward living organisms based upon their ability to insert into biological membranes and disrupt normal membrane function. The primary mechanism responsible for organic solvent tolerance in many bacteria is energy-dependent extrusion via efflux pumps. One such bacterial strain, Pseudomonas putida S12, is known for its high tolerance to organic solvents as provided through the SrpABC resistance-nodulation-cell division (RND) family efflux pump. To determine how two putative regulatory proteins (SrpR and SrpS, encoded directly upstream of the SrpABC structural genes) influence SrpABC efflux pump expression, we conducted transcriptional analysis, β-galactosidase fusion experiments, electrophoretic mobility shift assays, and pulldown analysis. Together, the results of these experiments suggest that expression of the srpABC operon can be derepressed by two distinct but complementary mechanisms: direct inhibition of the SrpS repressor by organic solvents and binding of SrpS by its antirepressor SrpR.

A cryptic ribosome binding site, false signals in reporter systems and avoidance of protein translation chaos

The expression of reporter gene may be induced by activation of cryptic signalling sequences, as we found while constructing the mutS-lacZ fusion gene. We cloned the Escherichia coli lacZ gene encoding β-galactosidase into a plasmid vector carrying the Thermus thermophilus mutS gene. The clones expected to produce β-galactosidase as the C-terminal fusion were selected for the complementation of β-galactosidase activity in a lacZ deficient E. coli strain. Surprisingly, one of the clones, though displaying β-galactosidase activity, did not produce the fusion protein. As shown by DNA sequencing a 92 bp fragment in the 3′ part of mutS gene was substituted by a 19 bp sequence. As the consequence of the resultant frameshift, a truncated MutS peptide was translated instead of β-galactosidase fusion. The cloned lacZ gene lacked its ribosome binding site, so lacZ expression could be explained by activation of a cryptic ribosome binding site in the 3′ end of mutS gene. This observation shows that fusion domains in reporter systems are possible to produce accidentally misleading signals. This observation also suggests that some triplets like AGG and AGA, present in the canonical ribosome binding sequence, are rarely used codons to prevent chaotic protein translation.

A Transgenic Mouse Model for Congenital Dyserythropoietic Anemia Type I

The Congenital Dyseyrthropoetic Anemias (CDA) are a heterogeneous group of inborn defects characterized by anemia of varying severity and morphological abnormalities of bone marrow erythroblasts. Studying their pathology has the potential to contribute to the understanding of the normal process of erythropoiesis. In CDA type I, the phenotype is largely limited to the red cell lineage with erythroblasts showing characteristic spongy nuclear chromatin on electron microscopy. Its genetic basis is due to missense mutations in the CDAN1 gene (chromosome 15q15), but the biological function of the highly conserved and non-redundant codanin-1 protein remains entirely unknown.We have produced a mouse model for CDA type I by generating transgenic mice from an ES cell line carrying a gene-trap (splice acceptor/β-galactosidase gene/neomycin resistance gene) in intron 25 of the murine CDAN1 gene. Blood and bone marrow from CDAN1gt/wt heterozygotes is morphologically and quantitatively indistinguishable from wild type animals. Northern blot analysis and RT-qPCR of codanin-1 RNA expression confirms a broad pattern of expression with the highest levels seen in erythroid tissue. Flow-cytometric analysis of β-galactosidase activity in erythroid cells from phenylhydrazine treated adult spleens shows the highest levels in the CD71high/Ter119low early erythroblasts, declining with further erythroid maturation. Furthermore, indirect immunofluorescence localizes the codanin-1/β-galactosidase fusion product in the nucleus of the CD71high/Ter119low early erythroblasts, particularly at the interface between euchromatin and heterochromatin. The presence of an in-frame β-gal in the gene trap insert, therefore, provides a method to analyze gene and protein expression from the CDAN1 promoter, and additional distribution data from heterozygous embryos and adults will be presented. Heterozygote crosses produced no homozygotes among liveborn progeny, suggesting embryonic lethality of this state. Analysis of embryos at different stages suggests development of homozygotes ceased at ~6.5d of gestation, prior to the onset of erythropoiesis.These results from the first transgenic mouse model for CDA type I, highlight a non-erythroid role for codanin-1 in early embryonic development, in addition to its role in adult human erythropoiesis. The embryonic lethality of the mouse model is consistent with the absence of homozygote null mutations in the CDAN1 genes analyzed so far in human patients. Creation of mice with the CDA type I phenotype may have to await a knock-in transgenic containing a human mutation, which is currently in preparation. The model described here should be valuable for further studies of the intracellular localization of codanin-1 and the identification of any relevant protein binding partners.

Binding and Glutathione Conjugation of Porphyrinogens by Plant Glutathione Transferases

Overexpression in Escherichia coli of a tau (U) class glutathione transferase (GST) from maize (Zea mays L.), termed ZmGSTU1, caused a reduction in heme levels and an accumulation of porphyrin precursors. This disruption was highly specific, with the expression of the closely related ZmGSTU2 or other maize GSTs having little effect. Expression in E. coli of a series of chimeric ZmGSTU1/ZmGSTU2 proteins identified domains responsible for disrupting porphyrin metabolism. In addition to known heme precursors, expression of ZmGSTU1 led to the accumulation of a novel glutathione conjugate of harderoporphyrin(ogen) (2,7,12,18-tetramethyl-3-vinylporphyrin-8,13,17-tripropionic acid). Using the related protoporphyrinogen as a substrate, conjugation could be shown to occur on one vinyl group and was actively catalyzed by the ZmGSTU. In plant transgenesis studies, the ZmGSTUs did not perturb porphyrin metabolism when expressed in the cytosol of Arabidopsis or tobacco. However, expression of a ZmGSTU1-ZmGSTU2 chimera in the chloroplasts of tobacco resulted in the accumulation of the harderoporphyrin(ogen)-glutathione conjugate observed in the expression studies in bacteria. Our results show that the well known ability of GSTs to act as ligand binding (ligandin) proteins of porphyrins in vitro results in highly specific interactions with porphyrinogen intermediates, which can be demonstrated in both plants and bacteria in vivo.

Characterization of B cell epitopes on the 16K antigen of Mycobacterium tuberculosis.

To characterize the antigenic parts of the 16K protein of Mycobacterium tuberculosis, overlapping peptides according to the amino acid sequence of the 16K protein were synthesized. In total, 14 peptides of 20 amino acids in length with an overlap of 10 amino acids and two additional decapeptides (amino acids 31-40 and 61-70) were tested with eight anti-16K MoAbs and human sera. The common recognition site of MoAbs F67-8 and F67-16 was LRPTFDTRLM (amino acids 31-40) and of MoAbs F159-1 and F159-11 DPDKDVDIMV (amino acids 61-70). However, for binding of the MoAbs to these peptides additional amino acids were required at either the N- or C-terminus, suggesting that some kind of conformation is required. The recognition sites of the MoAbs F23-41, F23-49, F24-2 and TB68 could not be identified using the peptides, indicating that the MoAbs only bound to conformational epitopes and not to peptides which may contain parts of these epitopes. The MoAbs bound to beta-galactosidase fusion proteins comprising parts of the 16K protein, indicating that some kind of native conformation is present on the recombinant proteins. Sera from 14 of 19 patients with tuberculosis and none from 19 controls reacted with the purified 16K protein. Sera from four of these 14 patients reacted with two overlapping peptides (amino acids 71-100). Apparently, antibodies in patients' sera against the 16K protein are predominantly directed against conformational epitopes.

Nucleolar Binding Sequences of the Ribosomal Protein S6e Family Reside in Evolutionary Highly Conserved Peptide Clusters

Proteomic analyses of the nucleolus have revealed almost 700 functionally diverse proteins implicated in ribosome biogenesis, nucleolar assembly, and regulation of vital cellular processes. However, this nucleolar inventory has not unveiled a specific consensus motif necessary for nucleolar binding. The ribosomal protein family characterized by their basic nature should exhibit distinct binding sequences that enable interactions with the rRNA precursor molecules facilitating subunit assembly. We succeeded in delineating 2 minimal nucleolar binding sequences of human ribosomal protein S6 by fusing S6 cDNA fragments to the 5' end of the LacZ gene and subsequently detecting the intracellular localization of the beta-galactosidase fusion proteins. Nobis1 (nucleolar binding sequence 1), comprising of 4 highly conserved amino acid clusters separated by glycine or proline, functions independently of the 3 authentic nuclear localization signals (NLSs). Nobis2 consists of 2 conserved peptide clusters and requires the authentic NLS2 in its native context. Similarly, we deduced from previous publications that the single Nobis of ribosomal protein S25 is also highly conserved. The functional protein domain organization of the ribosomal protein S6e family consists of 3 modules: NLS, Nobis, and the C-terminal serine cluster of the phosphorylation sites. This modular structure is evolutionary conserved in vertebrates, invertebrates, and fungi. Remarkably, nucleolar binding sequences of small and large ribosomal proteins reside in peptide clusters conserved over millions of years.

Amyloid-linked cellular toxicity triggered by bacterial inclusion bodies

The aggregation of proteins in the form of amyloid fibrils and plaques is the characteristic feature of some pathological conditions ranging from neurodegenerative disorders to systemic amyloidoses. The mechanisms by which the aggregation processes result in cell damage are under intense investigation but recent data indicate that prefibrillar aggregates are the most proximate mediators of toxicity rather than mature fibrils. Since it has been shown that prefibrillar forms of the nondisease-related misfolded proteins are highly toxic to cultured mammalian cells we have studied the cytoxicity associated to bacterial inclusion bodies that have been recently described as protein deposits presenting amyloid-like structures. We have proved that bacterial inclusion bodies composed by a misfolding-prone β-galactosidase fusion protein are clearly toxic for mammalian cells but the β-galactosidase wild type enzyme forming more structured thermal aggregates does not impair cell viability, despite it also binds and enter into the cells. These results are in the line that the most cytotoxic aggregates are early prefibrilar assemblies but discard the hypothesis that the membrane destabilization is the key event to subsequent disruption of cellular processes, such as ion balance, oxidative state and the eventually cell death.

Overexpression of BetS, a Sinorhizobium meliloti High-Affinity Betaine Transporter, in Bacteroids from Medicago sativa Nodules Sustains Nitrogen Fixation During Early Salt Stress Adaptation

Sinorhizobium meliloti possesses several betaine transporters to cope with salt stress, and BetS represents a crucial high-affinity glycine and proline betaine uptake system involved in the rapid acquisition of betaines by cells subjected to osmotic upshock. Using a transcriptional lacZ (beta-galactosidase) fusion, we showed that betS is expressed during the establishment of the symbiosis and in mature nitrogen-fixing nodules. However, neither Nod nor Fix phenotypes were impaired in a betS mutant. BetS is functional in isolated bacteroids, and its activity is strongly activated by high osmolarity. In bacteroids from a betS mutant, glycine betaine and proline betaine uptake was reduced by 85 to 65%, indicating that BetS is a major component of the overall betaine uptake activity in bacteroids in response to osmotic stress. Upon betS overexpression (strain UNA349) in free-living cells, glycine betaine transport was 2.3-fold higher than in the wild-type strain. Interestingly, the accumulation of proline betaine, the endogenous betaine synthesized by alfalfa plants, was 41% higher in UNA349 bacteroids from alfalfa plants subjected to 1 week of salinization (0.3 M NaCl) than in wild-type bacteroids. In parallel, a much better maintenance of nitrogen fixation activity was observed in 7-day-salinized plants nodulated with the overexpressing strain than in wild-type nodulated plants. Taken altogether, these results are consistent with the major role of BetS as an emergency system involved in the rapid uptake of betaines in isolated and in planta osmotically stressed bacteroids of S. meliloti.

A New d,l -Endopeptidase Gene Product, YojL (Renamed CwlS), Plays a Role in Cell Separation with LytE and LytF in Bacillus subtilis

A new peptidoglycan hydrolase, Bacillus subtilis YojL (cell wall-lytic enzyme associated with cell separation, renamed CwlS), exhibits high amino acid sequence similarity to LytE (CwlF) and LytF (CwlE), which are associated with cell separation. The N-terminal region of CwlS has four tandem repeat regions (LysM repeats) predicted to be a peptidoglycan-binding module. The C-terminal region exhibits high similarity to the cell wall hydrolase domains of LytE and LytF at their C-terminal ends. The C-terminal region of CwlS produced in Escherichia coli could hydrolyze the linkage of d-gamma-glutamyl-meso-diaminopimelic acid in the cell wall of B. subtilis, suggesting that CwlS is a d,l-endopeptidase. beta-Galactosidase fusion experiments and Northern hybridization analysis suggested that the cwlS gene is transcribed during the late vegetative and early stationary phases. A cwlS mutant exhibited a cell shape similar to that of the wild type; however, a lytE lytF cwlS triple mutant exhibited aggregated microfiber formation. Moreover, immunofluorescence microscopy showed that FLAG-tagged CwlS was localized at cell separation sites and cell poles during the late vegetative phase. The localization sites are similar to those of LytF and LytE, indicating that CwlS is involved in cell separation with LytF and LytE. These specific localizations may be dependent on the LysM repeats in their N-terminal domains. The roles of CwlS, LytF, and LytE in cell separation are discussed.

The N-terminal half of talin2 is sufficient for mouse development and survival

Using a talin2 gene-trapped embryonic stem cell clone, we have developed a talin2 mutant mouse line that expresses the N-terminal half (1–1295) of talin2 fused with β-galactosidase. The homozygous mutant mice appear to be normal and healthy. In the testis, talin2 expresses as a shorter form with a unique 30 residues at N-terminus linking to a common C-terminus from 1122 to 2453 of the long form. The resulting talin2 in the mutant testis only contains 204 residues of the wild-type testis talin2. However, it did not seem to affect the morphology of testis or reproduction of male mice. In fact, male and female mutant mice are fertile. Utilizing the expression of talin2(1–1295)/β-galactosidase fusion protein, we have examined the distribution of talin2 in tissues. In contrast to talin1, talin2 expression is more restricted in tissues and cell types.

Identification of an unconventional nuclear localization signal in human ribosomal protein S2

Ribosomal proteins must be imported into the nucleus after being synthesized in the cytoplasm. Since the rpS2 amino acid sequence does not contain a typical nuclear localization signal, we used deletion mutant analysis and rpS2–β-galactosidase chimeric proteins to identify the nuclear targeting domains in rpS2. Nuclear rpS2 is strictly localized in the nucleoplasm and is not targeted to the nucleoli. Subcellular localization analysis of deletion mutants of rpS2–β-galactosidase chimeras identified a central domain comprising 72 amino acids which is necessary and sufficient to target the chimeric β-galactosidase to the nucleus. The nuclear targeting domain shares no significant similarity to already characterized nuclear localization signals in ribosomal proteins or other nuclear proteins. Although a Nup153 fragment containing the importinβ binding site fused to VP22 blocks nuclear import of rpS2–β-galactosidase fusion proteins, nuclear uptake of rpS2 could be mediated by several import receptors since it binds to importinα/β and transportin.

Bacterial inclusion bodies are cytotoxic in vivo in absence of functional chaperones DnaK or GroEL

Cytotoxicity of cytoplasmic bacterial inclusion bodies has been explored in vivo in cells producing a model, misfolding-prone β-galactosidase fusion protein. The formation of such aggregates does not result in detectable toxicity on Escherichia coli producing cells. However, a deficiency in the main chaperones DnaK or GroEL but not in other components of the heat shock system such as the chaperone ClpA or the protease Lon, promotes a dramatic inhibition of cell growth. The role of DnaK and GroEL in minimizing toxicity of in vivo protein aggregation is discussed in the context of the conformational stress and the protein quality control system.

Lon and ClpP proteases participate in the physiological disintegration of bacterial inclusion bodies

Aggregated protein is solubilized by the combined activity of chaperones ClpB, DnaK and small heat-shock proteins, and this could account, at least partially, for the physiological disintegration of bacterial inclusion bodies. In vivo, the involvement of proteases in this process had been suspected but not investigated. By using an aggregation prone β-galactosidase fusion protein produced in Escherichia coli, we show in this study that the main ATP-dependent proteases Lon and ClpP participate in the physiological disintegration of cytoplasmic inclusion bodies, their absence minimizing the protein removal up to 40%. However, the role of these proteases is clearly distinguishable especially regarding the fate of solubilized protein. While Lon appears as a minor contributor in the disintegration process, ClpP directs an important attack on the released or releasable protein even not being irreversibly misfolded. ClpP is then observed as a wide-spectrum, main processor of aggregation-prone proteins and also of polypeptides physiologically released from inclusion bodies, even when occurring as soluble versions with a conformation compatible with their enzymatic activity.