Average Number Of Nucleotide Differences Research Articles

Uganda chicken genetic resources: II. genetic diversity and population demographic history inferred from mitochondrial DNA D-loop sequences.

The genetic diversity of indigenous chickens, which comprise over 80% of the chicken resources in Uganda, is largely not well-characterized for their genetic contribution. This study assessed the genetic diversity and population structure of the indigenous chicken population in Uganda to serve as an essential component for improvement and conservation strategies. A set of 344 mitochondrial DNA (mtDNA) D-loop sequences among 12 Ugandan chicken populations was evaluated. Twenty-eight polymorphic sites, accounting for 4.26% of the total analyzed loci of 658bp, defined 32 haplotypes. The haplotype diversity (Hd) was 0.437, with a nucleotide diversity (π) of 0.0169, while the average number of nucleotide differences (k) was 0.576, indicating a population that is moderately genetically diverse. Analysis of molecular variance found 98.39% (ρ < 0.01) of the total sequence variation among the chicken haplotypes within populations, 1.08% (ρ < 0.05) among populations, and 0.75% (ρ > 0.05) among populations within regions. This revealed subtle genetic differentiation among the populations, which appeared to be influenced by population fragmentation, probably due to neutral mutation, random genetic drift, and/or balancing selection. All the haplotypes showed affinity exclusively to the haplogroup-E mtDNA phylogeny, with haplotype UGA01 signaling an ancestral haplotype in Uganda. Neutrality tests Tajima's D (-2.320) and Fu's Fs (-51.369), augmented with mismatch distribution to measure signatures of recent historical demographic events, supported a population expansion across the chicken populations. The results show one matrilineal ancestry of Ugandan chickens from a lineage widespread throughout the world that began in the Indian subcontinent. The lack of phylogeographic signals is consistent with recent expansion events with extensive within-country genetic intermixing among haplotypes. Thus, the findings in this study hold the potential to guide conservation strategies and breeding programs in Uganda, given that higher genetic diversity comes from within the chicken population.

First report on the molecular detection and genetic diversity of Anaplasma marginale in healthy dairy cattle in Khon Kaen province, Thailand

Background and Aim: Bovine anaplasmosis (BA) is one of the most important diseases of ruminants worldwide, causing significant economic losses in the livestock industry due to the high morbidity and mortality in susceptible cattle herds. Anaplasma marginale is the main causative agent of BA occurring worldwide in tropical and subtropical regions. This study aimed to investigate the first molecular detection and genetic diversity of A. marginale in dairy cattle in Khon Kaen Province, Thailand. Materials and Methods: Blood samples were collected from 385 lactating cows from 40 dairy farms in five districts of Khon Kaen, regardless of age and health status. To detect A. marginale, all DNA preparations were used for molecular diagnosis using a single polymerase chain reaction with the msp4 gene target. A phylogenetic tree was constructed from the msp4 gene sequences using molecular genetic characterization. Genetic diversity was calculated as haplotype diversity, haplotype number, number of nucleotide differences, nucleotide diversity, and average number of nucleotide differences. Results: The overall prevalence of A. marginale was 12.72% (49/385). The highest prevalence (17.19%) was found in Ubolratana district, followed by Muang, Kranuan, Khao Suan Kwang, and Nam Phong districts (14.94%, 14.74%, 13.79%, and 3.70%, respectively). Phylogenetic analysis showed that A. marginale was closely related to isolates from Australia (98.96%), China (99.68%), Spain (99.74%), and the USA (99.63%). Conclusion: The molecular prevalence of BA in dairy cattle is the first to be observed in this area, and the genetic variability with separated clusters shown in the msp4 gene of A. marginale revealed species variation in dairy cattle. This significant genetic diversity contributes to the understanding of the diversity of A. marginale and will be important for the control and prevention of A. marginale in dairy cattle. Keywords: Anaplasma marginale, bovine anaplasmosis, dairy cattle, molecular prevalence.

Plasmodium falciparum population structure and genetic diversity of cell traversal protein for ookinetes and sporozoites (CelTOS) during malaria resurgences in Dielmo, Senegal

The ability to accurately measure the intensity of malaria transmission in areas with low transmission is extremely important to guide elimination efforts. Plasmodium falciparum Cell-traversal protein for ookinetes and sporozoites (PfCelTOS) is an important conserved sporozoite antigen reported as one of the promising malaria vaccine candidates, and could be used to estimate malaria transmission intensity. This study aimed at determining whether the diversity of PfCelTOS gene reflects the changes in malaria transmission that occurred between 2007 and 2014 in Dielmo, a Senegalese village, before and after the implementation of insecticide treated bed nets (ITNs). Of the 109 samples positive for PfCelTOS PCR, 96 (88%) were successfully sequenced and analysed for polymorphisms and population diversity. The number of segregating sites was higher during the pre-intervention period (13) and the malaria resurgences (11) than during the intervention period (5). Similarly, the number and diversity of haplotypes were higher during the pre-intervention period (16 and 0.914, respectively) and the malaria resurgences (6 and 0.821, respectively) than during the intervention period (4 and 0.758, respectively). Moreover, the average number of nucleotide differences was higher during the pre-intervention (3.792) and during malaria resurgences (3.467) than during the intervention period (2.189). The 3D7 KSSFNEP haplotype was only observed during the intervention period. Only two haplotypes were shared in both the pre-intervention and intervention periods while four haplotypes were shared between the pre-intervention and the malaria resurgences. The Fst values indicate moderate differentiation between pre-intervention and intervention periods (0.17433), and between intervention and malaria resurgences period (0.19198) as well as between pre-intervention and malaria resurgences periods (0.06607).PfCelTOS genetic diversity reflected changes of malaria transmission, with higher polymorphisms recorded before the large-scale implementation of ITNs and during the malaria resurgences. PfCelTOS is also a candidate vaccine; mapping its diversity across multiple endemic environments will facilitate the design and optimisation of a broad and efficacious vaccine.

Assessment of genetic diversity and phylogenetic relationship of local coffee populations in southwestern Saudi Arabia using DNA barcoding.

The genetic diversity of local coffee populations is crucial to breed new varieties better adapted to the increasingly stressful environment due to climate change and evolving consumer preferences. Unfortunately, local coffee germplasm conservation and genetic assessment have not received much attention. Molecular tools offer substantial benefits in identifying and selecting new cultivars or clones suitable for sustainable commercial utilization. New annotation methods, such as chloroplast barcoding, are necessary to produce accurate and high-quality phylogenetic analyses. This study used DNA barcoding techniques to examine the genetic relationships among fifty-six accessions collected from the southwestern part of Saudi Arabia. PCR amplification and sequence characterization were used to investigate the effectiveness of four barcoding loci: atpB-rbcl, trnL-trnF, trnT-trnL, and trnL. The maximum nucleotide sites, nucleotide diversity, and an average number of nucleotide differences were recorded for atpB-rbcl, while trnT-trnL had the highest variable polymorphic sites, segregating sites, and haploid diversity. Among the four barcode loci, trnT-trnL recorded the highest singleton variable sites, while trnL recorded the highest parsimony information sites. Furthermore, the phylogenetic analysis clustered the Coffea arabica genotypes into four different groups, with three genotypes (KSA31, KSA38, and KSA46) found to be the most divergent genotypes standing alone in the cluster and remained apart during the analysis. The study demonstrates the presence of considerable diversity among coffee populations in Saudi Arabia. Furthermore, it also shows that DNA barcoding is an effective technique for identifying local coffee genotypes, with potential applications in coffee conservation and breeding efforts.

Ecogroups and maternal haplogroups reveal the ancestral origin of native Chinese goat populations based on the variation of mtDNA D-loop sequences.

China is rich in goat breeding resources. Officially recognized local goat breeds are mainly distributed in agro-ecological regions. The population structure and matrilineal origin of native Chinese goats can be used to formulate protection and utilization strategies for these genetic resources. In this study, the genetic structure and maternal origin of native Chinese goats were investigated using mtDNA D-loop sequences. A total of 329 goat samples from 25 Chinese indigenous goat populations and five introduced goat breeds from abroad were collected; these populations were distributed in four ecogroups designated as Southwest, South-central, the North China Plain, and Foreign-ecogroup. A larger average number of nucleotide differences and richer nucleotide diversity were observed in South-central and Foreign-ecogroup, whereas these were lower in Southwest. The 216 haplotypes divided into several haplogroups, of which HapA contained 99 haplotypes distributed in Southwest, the North China Plain, and Foreign-ecogroup with high frequency (0.53-0.77), whereas the frequency of HapA in South-central was <0.09. HapB was mostly found in South-central (0.5538) and was distributed to the North China Plain (0.2667), while it was rare in Southwest (<0.08) and Foreign-ecogroup (<0.07). According to the estimation of kinship and ancestry, HapA had five ancestors (A2, A3, A5, A10, and A12), HapB had a single maternal ancestor (A8), and HapC had two maternal ancestors (A1 and A4). This study showed that native Chinese goat breeds were mainly divided into three haplogroups (HapA, HapB, and HapC) and goat populations have expanded in the ecological regions.

The genetic structure of populations of Isthmiophora melis (Schrank, 1788) (Digenea: Echinostomatidae). Does the host’s diet matter?

BackgroundHere we provide a comparative analysis of the genetic structure of populations (based on nad1 mtDNA) of Isthmiophora melis isolated from the American mink (Neogale vison), an introduced invasive species, commonly occurring in the territory of Poland, and from the striped field mouse (Apodemus agrarius).MethodsA total of 133 specimens of I. melis were obtained from naturally infected N. vison collected from six localities in Poland (108 samples) and 25 individuals of I. melis from A. agrarius. All sequences of the nad1 gene obtained during the present study were assembled and aligned. The standard statistics for haplotype composition, i.e., the number of haplotypes, haplotype diversity, nucleotide diversity, and average number of nucleotide differences, were calculated. Haplotype analysis and visualization of haplotype frequency among populations were performed using a median-joining network.ResultsBased on the samples collected from different localities in Poland, our study revealed that the overall genetic diversity of I. melis isolated from the American mink and of the striped field mouse do not differ significantly. The median-joining network showed that the three main haplotypes are in the centre of a star-like structure, with the remaining haplotypes as the satellites, reflecting the recent expansion of the populations.ConclusionsThe overall genetic diversity of I. melis isolated from the American mink and striped field mouse reveals a high level of homogeneity. Moreover, regional differences in the food composition of the definitive hosts play an important role in shaping the genetic structure of the trematode populations.Graphical

Genetic diversity and relationship among Indonesian local sheep breeds on Java Island based on mitochondrial cytochrome b gene sequences

BackgroundThe cytochrome b (Cyt b) gene is one of the most studied mitochondrial DNA (mtDNA) genes to determine sheep’s genetic profile. This study aimed to determine the genetic diversity and relationships of several Indonesian local sheep populations on Java Island, Indonesia, based on the mtDNA Cyt b gene sequences. Blood samples were collected from forty-one individual sheep in seven populations of Indonesia local sheep breeds on Java Island (Priangan = 6, Garut = 6, Batur = 7, Wonosobo = 5, Javanese Thin-Tailed/JTT = 7, Javanese Fat-Tailed/JFT = 5, and Sapudi = 5). DNA extraction was performed on blood samples, and the mtDNA Cyt b gene was amplified using specific primers (Alek-CBF: 5’-CAACCCCACCACTTACAA-3’ and Alek-CBR: 5’-CCTTGAGTCTTAGGGAGGTT-3’). The polymerase chain reaction (PCR) products were then sequenced, and data were analyzed using the MEGA version 7.0, DNA SP version 6.0, and NTSYS-pc version 2.11 software. ResultsA total of 1140 bp complete mtDNA Cyt b gene sequences in this study obtained 1134 monomorphic sites (I), six polymorphic sites (V), one segregation site (S), and five parsimony informative sites (P) with a nucleotide diversity (Pi), the average number of nucleotide differences (K), and sequence conservation (SC) were 0.00119, 1.35610, and 0.9947, respectively. There were six haplotypes consisting of two unique haplotypes and four shared haplotypes with a haplotype diversity (Hd) of 0.5415. The genetic distance within and between populations ranged from 0.0000 to 0.0016 and 0.0000 to 0.0020, respectively. Wonosobo, JFT, and Sapudi sheep have the closest relationship, and then these three breeds were close to JTT sheep, followed by Batur, Priangan, and Garut sheep. Two haplogroups have been found based on the Ovine haplogroup clustering. All Wonosobo, JTT, JFT, Sapudi sheep, and most Batur sheep were clustered into haplogroup B. In contrast, Garut sheep were mostly clustered into haplogroup A, while Priangan sheep were clustered into both haplogroups with the same percentage. ConclusionSeven Indonesian local sheep breeds on Java Island have a close relationship clustered into two haplogroups, namely haplogroups A and B. Most Indonesian local sheep breeds on Java Island in this study were clustered into haplogroup B, except for Garut and Priangan sheep.

Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria

This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation.

Phylogenetic assessment of endangered and look‐alike Pigtoe species in a freshwater mussel diversity hotspot

The Green River in Kentucky in the eastern United States is a freshwater mussel biodiversity hotspot, with 71 known species. Among them, the endangered Pleurobema plenum coexists with other morphologically similar species in the genera Fusconaia and Pleurobema, known colloquially as "pigtoes." Identification of species in these genera is challenging even for mussel experts familiar with them. In our study, the correct identification of these species by experts ranged from 57% to 83%. We delineated taxonomic boundaries among seven species and tested for cryptic biodiversity among these look-alike mussels utilizing mitochondrial and nuclear DNA sequence variation. Phylogenetic analysis of combined (1215 bp) mitochondrial DNA cytochrome oxidase I (COI) and NADH dehydrogenase 1 (ND1) genes showed five well-diverged groups that included F.flava, F.subrotunda, P.cordatum, and P.plenum as distinct clades, with P.sintoxia and P.rubrum grouped into a single clade. While our mitochondrial DNA analyses did not distinguish P.sintoxia and P.rubrum as phylogenetically distinct species, the typical shell forms of these two nominal taxa are very distinct. Further phylogenetic analysis using nuclear ribosomal transcribed spacer region subunit I (ITS1) DNA sequences also showed that P.sintoxia and P.rubrum were not distinct lineages. No cryptic species were detected in the Fusconaia and Pleurobema samples analyzed from the Green River. The highest haplotype diversity (h), average number of nucleotide differences (k), and nucleotide diversity (π) were observed for F.subrotunda at both the COI (h=0.896, k=3.805, π=0.00808) and ND1 (h=0.984, k=6.595, π =0.00886) markers, with similarly high genetic diversity in the other taxa. Our results give managers confidence that cryptic taxa do not occur within or among these morphologically similar species in the Green River, and populations appear genetically diverse, indicative of large and healthy populations.

DNA Barcoding of Prunus Species Collection Conserved in the National Gene Bank of Egypt

Two intergenic spacers cpDNA barcoding regions were used to assess the genetic diversity and phylogenetic structure of a collection of 25 Prunus accessions. The trnH-psbA and trnL-trnF intergenic spacers were able to distinguish and identify only four Prunus species. The average aligned length was 316–352 bp and 701–756 bp for trnH-psbA and trnL-trnF, respectively. The overall evolutionary divergence was higher in trnH-psbA than trnL-trnF. The transition/transversion bias (R) recorded as 0.59 in trnL-trnF and 0.89 in trnH-psbA. The number of invariable sites, nucleotide diversity (Pi), and the average number of nucleotide differences (k) was higher in the trnH-psbA region. The trnL-trnF records was above the other region in the number of variable sites, number of singleton variable sites, and the parsimony informative sites. Phylogenetic relationships among the 25 accessions of Prunus species were investigated. Most of the different Prunus species clustered in a homogenized distribution in both regions, except for the plum (P. domestica) accession (African Rose) was assigned with the peach (P. persica) accessions. The two intergenic cpDNA trnH-psbA and trnL-trnF were able to distinguish and identify the four Prunus species accessions.

Genetic Diversity and Gene Flow Observed in Two Cereal Aphid (Hemiptera: Aphididae) Species and Populations in the Chinese Corn Belt Region

Abstract The cereal aphids, Rhopalosiphum maidis (Fitch) and Rhopalosiphum padi (L.) (Hemiptera: Aphididae), are serious pests of maize, Zea mays L., globally. Basic information about the genetic structure of these aphids is unknown. We, therefore, estimated the genetic diversity and genetic flow from partial fragments of the mitochondrial cytochrome oxidase I gene collected from different geographic populations of aphids throughout the Songliao Plain of northeastern China. Our analysis of a 425-bp sequence on 297 R. maidis and 287 R. padi individuals revealed 17 and 3 variable sites, respectively. Fifteen haplotypes were obtained among the R. maidis populations, and only haplotype RM1 was shared. Three shared haplotypes were obtained among the R. padi populations. No obvious geographical trends were detected based on the haplotype network and neighbor-joining tree. Relatively low haplotype diversity indices were observed in the R. maidis populations (haplotype diversity [Hd] = 0.14207, average number of nucleotide differences [K] = 0.17340, and nucleotide diversity [Pi] = 0.00041), whereas relatively high haplotype diversity indices were observed in the R. padi populations (Hd = 0.53249, K = 1.46614, and Pi = 0.00345). There was moderate gene flow (number of migrants [Nm] = 2.33) among R. maidis populations, but there was low gene flow (Nm = 0.82) among R. padi populations. Analysis of molecular variance showed high genetic differentiation within populations. Genetic distance and geographic distance were not significantly associated according to the Mantel test. The results suggest that the difference in the aphids' existence strategies has resulted in a different mitochondrial evolution pattern in the Songliao Plain region, and they provide a foundation for accurately forecasting systems against this pest.

Nucleotide sequence types (ntSTs) of Anaplasma marginale in cattle in Nigeria based on the major surface protein 5 (msp5) gene

Bovine anaplasmosis caused by Anaplasma marginale is an important endemic disease that exerts negative impact on livestock production with huge socioeconomic consequences in most developing countries. Genetic studies have reported the existence of diverse ntSTs of A. marginale with varying pathogenicity in different countries. Continuous studies to obtain accurate information on disease etiologies is desirable for the formulation of cost-effective control measures. To this end, 582 blood samples from cattle were collected from 10 out of the 36 States of Nigeria from April 2021 to March 2022 and analyzed based on the major surface protein 5 (msp5) gene to determine the ntSTs of A. marginale in Nigeria. In all, 38 out of the 582 samples (6.5%) from cattle in the different Agro-ecological Zones (AEZs) of Nigeria were positive. The Nigerian A. marginale nucleotide sequences were 96.7 to 100% identical to sequences from other countries and were placed in distinct clusters with other A. marginale sequences deposited in GenBank. Network analysis revealed three ntSTs (#2, #4 & #8) of A. marginale from Nigeria with a nucleotide sequence type diversity (Hd) of 0.8, nucleotide diversity (Pi) of 0.015 and average number of nucleotide differences (k) of 7.09. Two different amino acid substitution sites were found in Nigerian and worldwide sequences at positions 148 and 160. This is the first nationwide report on the ntST diversity and genetic characterization of A. marginale in cattle in Nigeria based on the msp5 gene. Bovine anaplasmosis is widespread in Nigeria and deserves further attention.

Assessing genetic diversity using the first polymorphic set of EST-SSRs markers and barcoding of Moroccan saffron

Saffron (Crocus sativus L.) is an aromatic and medicinal plant, commonly known as the world's most expensive spice. Understanding its genetic diversity is critical for developing conservation strategies and germplasm management. This study reports the first set of EST-SSRs markers using C. sativus sequencing data available on the National Center for Biotechnology Information (NCBI). A panel of 19 EST-SSRs markers was selected to assess genetic diversity among 14 saffron accessions, mainly from Morocco. Forty-two alleles were detected, the polymorphic loci percentage reached 31.57%, and an average polymorphism information content (PIC) of 0.32 was recorded. DNA sequence polymorphism (DnaSP) analysis of CS/UIZ21 locus (GLT3 gene) identified 9 haplotypes with a haplotype diversity (HD)= 0.848, the average number of nucleotide differences among haplotypes was 2.64 and the nucleotide diversity was Pi= 0.01059. The results indicate that GLT3 barcoding could distinguish between Moroccan, Greek, and French saffron accessions and differentiate Moroccan accessions from each other. We established for the first-time a barcode of Moroccan saffron. Our results demonstrate that EST-SSRs markers and GLT3 barcode are potent tools for evaluating genetic diversity and germplasm analysis, which could be capitalized in future conservation strategies and breeding programs to protect and improve this valuable crop.

A PRELIMINARY COMPARISON OF MITOCHONDRIAL D-LOOP REGION OF FUNAAB ALPHA AND NIGERIAN INDIGENOUS CHICKENS

Nigerian indigenous chickens possess immunity from endemic diseases and have a better survival rate than commercial hybrid strains under local production conditions. FUNAAB Alpha chicken was developed by improving Nigerian indigenous chickens through crossbreeding and selection. This study compared the mitochondrial d-loop of FUNAAB Alpha and Nigerian indigenous chickens to check likely genetic erosion and loss of diversity in development of FUNAAB Alpha breed. Blood samples were collected from Nigerian indigenous (n=23) and FUNAAB Alpha (n=20) chickens sampled from farms and houses in Ogun state, Nigeria. The Hypervariable 1 (HV1) of the mitochondrial d-loop region was amplified and sequenced. Single nucleotide polymorphisms present in HV1 of chickens were identified using Clustal W. Genetic diversity of the region was determined using DnaSp v5 while selective forces acting on the chickens were predicted using HyPhy software implemented inside MEGA 6 software. Phylogenetic relationship among FUNAAB Alpha, Nigerian indigenous and other chicken breeds was determined using MEGA 6 software. Five polymorphisms were identified in FUNAAB Alpha chickens while twelve were identified in Nigerian indigenous chickens. All the polymorphisms identified in FUNAAB Alpha chickens were also observed in Nigerian indigenous chickens while seven polymorphisms were unique to Nigerian indigenous chickens. Higher diversity indices were observed in Nigerian indigenous chickens (number of haplotype: 4; haplotype diversity: 0.743±0.012; nucleotide diversity: 0.014±0.0013 and average number of nucleotide differences: 4.332) compared with FUNAAB Alpha chickens (number of haplotype: 2; haplotype diversity: 0.485±0.001; nucleotide diversity: 0.008±0.0001 and average number of nucleotide differences: 2.424). Positive selective forces were acting on FUNAAB Alpha chickens while negative selective forces were acting on Nigerian indigenous chickens. Phylogenetic analysis revealed that FUNAAB Alpha chickens clustered with Nigerian indigenous and South American chickens. It can be concluded that there was likely genetic erosion and loss of diversity in development of FUNAAB Alpha breed. Breeding programmes aimed at improvement of genetic diversity and reduction of genetic erosion should be applied in subsequent improvement of FUNAAB Alpha chickens.

Assessment of genetic diversity of Plasmodium falciparum circumsporozoite protein in Sudan: the RTS,S leading malaria vaccine candidate

BackgroundThe currently used malaria vaccine, RTS,S, is designed based on the Plasmodium falciparum circumsporozoite protein (PfCSP). The pfcsp gene, besides having different polymorphic patterns, can vary between P. falciparum isolates due to geographical origin and host immune response. Such aspects are essential when considering the deployment of the RTS,S vaccine in a certain region. Therefore, this study assessed the genetic diversity of P. falciparum in Sudan based on the pfcsp gene by investigating the diversity at the N-terminal, central repeat, and the C-terminal regions.MethodsA cross-sectional molecular study was conducted; P. falciparum isolates were collected from different health centres in Khartoum State between January and December 2019. During the study period, a total of 261 febrile patients were recruited. Malaria diagnosis was made by expert microscopists using Giemsa-stained thick and thin blood films. DNA samples were examined by the semi-nested polymerase chain reaction (PCR). Single clonal infection of the confirmed P. falciparum cases, were used to amplify the pfcsp gene. The amplified amplicons of pfcsp have been sequenced using the Sanger dideoxy method. The obtained sequences of pfcsp nucleotide diversity parameters including the numbers of haplotypes (Hap), haplotypes diversity (Hapd), the average number of nucleotide differences between two sequences (p), and the numbers of segregating sites (S) were obtained. The haplotype networks were constructed using the online tcsBU software. Natural selection theory was also tested on pfcsp using Fuand Li’s D, Fuand Li’s F statistics, and Tajima’s D test using DnaSP.ResultsIn comparison with the different pfcsp reference strains, the Sudanese isolates showed high similarity with other African isolates. The results of the N-terminal region showed the presence of 2 different haplotypes with a Hapd of 0.425 ± 0.00727. The presence of the unique insertion of NNNGDNGREGKDEDKRDGNN was reported. The KLKQP motif was conserved in all the studied isolates. At the central repeat region, 11 haplotypes were seen with a Hapd of 0.779 ± 0.00097. The analysis of the genetic diversity in the C-terminal region showed the presence of 10 haplotypes with a Hapd of 0.457 ± 0.073. Several non-synonymous amino acids changes were also seen at the Th2R and the Th3R T-cell epitope regions including T317K, E317K, Q318E, K321N, I322K, T322K, R322K, K324Q, I327L, G352N, S354P, R355K, N356D, Q357E, and E361A.ConclusionsIn this study, the results indicated a high conservation at the pfcsp gene. This may further contribute in understanding the genetic polymorphisms of P. falciparum prior to the deployment of the RTS,S vaccine in Sudan.

PSXII-8 Mitochondrial DNA diversity within domestic reindeer in Russia

Abstract Domestic reindeer in Russia are a valuable resource of vital importance to the physical and cultural survival of the Northern indigenous minority. During the last decades, the mitochondrial (mt) genetic markers have been widely used as a molecular tool to investigate genetic structure and diversity of livestock species. Here we aimed at the assessing the mtDNA diversity of the domestic reindeer inhabiting the area from the Kola Peninsula in the west to the Chukotka region in the east. A complete cytochrome b (cytb) sequences (1,140 bp) from representatives of six populations, including Nenets (NEN, n = 16), Evenk (EVK, n = 12), Even (EVN, n = 6), Chukotka (CHU, n = 6), Chukotka-Khargin (CHUKH, n = 6) and Tuva (TUVA, n = 6) were obtained. Sequences’ alignment was conducted using MUSCLE algorithm in R package msa. In total, 34 haplotypes were identified. Median-joining network, constructed in PopART 1.7, revealed three major groups of haplotypes: the first one joined the samples of all the populations, the second one included NEN, EVN and CHUKH, and the third group was presented by the one sample of CHU. AMOVA, calculated in Arlequin 3.5.2.2, showed that only 9.58% of molecular variance could be explained by the differences between populations and 90.42% - within populations. Genetic diversity parameters calculated in DnaSP 6.12.03, demonstrated that average number of nucleotide differences (K) was highest in CHUKH (28.333) and EVN (27.409) and lowest in TUVA (4.533) and EVK (5.400). Nucleotide diversity (Pi) was 0.01238±0.00559, 0.00474±0.00091, 0.02404±0.00453, 0.01281±0.00464, 0.02485±0.00744, and 0.00398±0.00110 for NEN, EVK, EVN, CHU, CHUKH and TUVA, respectively. Our study demonstrated the lack of clear genetic structure of the studied reindeer populations in relation to cytb sequence. The level of genetic diversity was associated with census size and was lowest in the smallest Tuva population. This study was supported by RSF-21-16-00071 and Russian Ministry of Science and Higher Education-0445-2019-0024.

The genetic diversity of the Vietnamese H’mong dog breed based on mitochondrial HV1 analysis

The H'mong docked tail is indigenous breed of dogs distributed in mountainous area of northern Vietnam. These dogs possess positive characteristics such as intelligence, agility, good health, good shape, human friendliness, ease of training and fully meet the criteria of a war dog. We had studied the diversity and origin of Vietnamese H’mong dogs based on the molecular data of the mitochondrial HV1 region. A total of seventy individual dogs were sampled from Lao Cai, Ha Giang and Hai Phong provinces of northern Vietnam and were sequenced. Among the targeted dogs, 29 haplotypes were recorded and divided into four main groups: A, B, C and E. In our study, nine new haplotypes were recorded and all of them belong to haplotype group A. Group A was the most common with 24 haplotypes (82.76%) followed by C, E and B with 2 (6.9%), 2 (6.9%) and 1 haplotypes (3.4%) respectively. The genetic variations in the H'mong dogs were high with nucleotide diversity (Pi = 0.03179), haplotype diversity (Hd = 0.95648) and average number of nucleotide differences (Kt = 5.18384) and the p-genetic distances range was from 0.2 to 2.9%. This study has provided a valuable platform for breeding and conservation and management of the species in Vietnam.

Pseudomonas spp. Mediate defense response in sugarcane through differential exudation of root phenolics

Pseudomonas spp., a ubiquitous biocontrol agent, protects the plants from phytopathogens by suppressing them directly by reinforcing the plant’s intrinsic defense mechanism. Root exudated phenolics play an important role in establishing the rhizobacteria population and cross the host boundaries in beneficial plant–microbe interaction. In this study, Pseudomonas spp. HU-8 & HU-9 antagonized the sugarcane red rot pathogen (C. falcatum) and showed a positive chemotactic response against different concentrations (10–30 µM) of synthetic phenolic acids like p-coumaric, vanillic, and 3,4 di-hydroxybenzoic acid. In a pot experiment, they effectively colonized the sugarcane rhizosphere and mediated defense response in sugarcane plants challenged with red rot pathogen C. falcatum by regulating the exudation of root phenolics under hydroponic conditions. They significantly induced the activity of the antioxidant enzymes CAT (1.24–1.64 fold), PO (0.78–1.61 fold), PAL (0.77–0.97 fold), and PPO (3.67–3.73 fold) over untreated plants in sugarcane. They also induced the total phenolic contents (TPC) in sugarcane in the presence (6.56–10.29 mg/g GAE) and absence (2.89–4.16 mg/g GAE) of the pathogen quantified through the Folin-Ciocalteu (FC) method. However, their effect was lower than that of the pathogen (4.34–8 mg/g GAE). The Pseudomonas spp. significantly colonized the sugarcane rhizosphere by maintaining a cell population of (1.0E + 07–1.3E + 08 CFU/mL). A significant positive Pearson’s correlation was observed between the root exudated total phenolic contents, antioxidant enzymatic activities, and rhizospheric population of inoculated bacteria. The 16S rRNA and rpoD gene analysis showed sequence conservation (C: 0.707), average number of nucleotide differences (k: 199.816), nucleotide diversity, (Pi): 0.09819), average number of informative nucleotide sites per site (Psi: 0.01275), GC content (0.57), and polymorphic sites (n = 656). These diverse Pseudomonas spp. could be an ideal bio-inoculants for a broad range of hosts especially graminaceous crops.

Genetic polymorphism of the extracellular region in surface associated interspersed 1.1 gene of Plasmodium falciparum field isolates from Thailand

BackgroundA novel variable surface antigens (VSAs), Surface-associated interspersed proteins (SUFRINs), is a protein that is modified on the surface of infected red blood cell (iRBC). Modified proteins on the iRBC surface cause severe malaria, which can lead to death throughout the life cycle of a malaria parasite. Previous study suggested that SURFIN1.1 is an immunogenic membrane-associated protein which was encoded by using the surf1.1 gene expressed during the trophozoite and schizont stages. This study aimed to identify the regions of SURFIN1.1 and investigate the genetic diversity of the extracellular region of the surf1.1 gene.MethodsA total of 32 blood samples from falciparum malaria cases that were diagnosed in Si Sa Ket Province, Thailand were collected. Plasmodium genomic DNA was extracted, and the extracellular region of surf1.1 gene was amplified using the polymerase chain reaction (PCR). A sequence analysis was then performed to obtain the number of haplotypes (H), the haplotype diversity (Hd), and the segregating sites (S), while the average number of nucleotide differences between two sequences (Pi); in addition, neutrality testing, Tajima’s D test, Fu and Li’s D* and F* statistics was also performed.ResultsFrom a total of 32 patient-isolated samples, 31 DNA sequences were obtained and analysed for surf1.1 gene extracellular region polymorphism. Researchers observed six distinct haplotypes in the current research area. Haplotype frequencies were 61.3%, 16.2%, and 12.9% for H1, H2, and H3, respectively. The remaining haplotype (H4-H6) frequency was 3.2% for each haplotype. Hd was 0.598 ± 0.089 with the Pi of 0.00381, and S was 15. The most common amino acid polymorphic site was E251Q; other sites included N48D, I49V, E228D, E235S, L265F, K267T, E276Q, and S288F. Fu and Li’s D* test value was − 1.24255, Fu and Li’s F* test value was − 1.10175, indicating a tendency toward negative balancing selection acting on the surf1.1 N-terminal region. The most polymorphic region was variable 2 (Var2) while cysteine-rich domain (CRD) was conserved in both the amino acid and nucleotide extracellular region of surf1.1 gene.ConclusionsThe Thai surf1.1 N-terminal region was well-conserved with only a few polymorphic sites remaining. In this study, the data regarding current bearing on the polymorphism of extracellular region of surf1.1 gene were reported, which might impact the biological roles of P. falciparum. In addition, may possibly serve as a suitable candidate for future development of SURFIN-based vaccines regarding malaria control.Graphic abstract

Genetic Diversity Analysis of Surface-Related Antigen (SRA) in Plasmodium falciparum Imported From Africa to China

Plasmodium falciparum surface-related antigen (SRA) is located on the surfaces of gametocyte and merozoite and has the structural and functional characteristics of potential targets for multistage vaccine development. However, little information is available regarding the genetic polymorphism of pfsra. To determine the extent of genetic variation about P. falciparum by characterizing the sra sequence, 74 P. falciparum samples were collected from migrant workers who returned to China from 12 countries of Africa between 2015 and 2019. The full length of the sra gene was amplified and sequenced. The average pairwise nucleotide diversities (π) of P. falciparum sra gene was 0.00132, and the haplotype diversity (Hd) was 0.770. The average number of nucleotide differences (k) for pfsra was 3.049. The ratio of non-synonymous (dN) to synonymous (dS) substitutions across sites (dN/dS) was 1.365. Amino acid substitutions of P. falciparum SRA could be categorized into 35 unique amino acid variants. Neutrality tests showed that the polymorphism of PfSRA was maintained by positive diversifying selection, which indicated its role as a potential target of protective immune responses and a vaccine candidate. Overall, the ability of the N-terminal of PfSRA antibodies to evoke inhibition of merozoite invasion of erythrocytes and conserved amino acid at low genetic diversity suggest that the N-terminal of PfSRA could be evaluated as a vaccine candidate against P. falciparum infection.