attP Region Research Articles

Delineation of the integrase-attachment and origin-of-transfer regions of the symbiosis island ICEMlSymR7A

Integrative and conjugative elements (ICEs) are chromosomally-integrated mobile genetic elements that excise from their host chromosome and transfer to other bacteria via conjugation. ICEMlSymR7A is the prototypical member of a large family of “symbiosis ICEs” which confer upon their hosts the ability to form a nitrogen-fixing symbiosis with a variety of legume species. Mesorhizobial symbiosis ICEs carry a common core of mobilisation genes required for integration, excision and conjugative transfer. IntS of ICEMlSymR7A enables recombination between the ICEMlSymR7A attachment site attP and the 3′ end of the phe-tRNA gene. Here we identified putative IntS attP arm (P) sites within the attP region and demonstrated that the outermost P1 and P5 sites demarcated the minimal region for efficient IntS-mediated integration. We also identified the ICEMlSymR7A origin-of-transfer (oriT) site directly upstream of the relaxase-gene rlxS. The ICEMlSymR7A conjugation system mobilised a plasmid carrying the cloned oriT to Escherichia coli in an rlxS-dependent manner. Surprisingly, an in-frame, markerless deletion mutation in the ICEMlSymR7A recombination directionality factor (excisionase) gene rdfS, but not a mutation in intS, abolished mobilisation, suggesting the rdfS deletion tentatively has downstream effects on conjugation or its regulation. In summary, this work defines two critical cis-acting regions required for excision and transfer of ICEMlSymR7A and related ICEs.

Whole genome sequencing of a novel temperate bacteriophage ofP. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Complete genomic sequence of the temperate bacteriophage ΦAT3 isolated from Lactobacillus casei ATCC 393

The complete genomic sequence of a temperate bacteriophage ΦAT3 isolated from Lactobacillus ( Lb.) casei ATCC 393 is reported. The phage consists of a linear DNA genome of 39,166 bp, an isometric head of 53 nm in diameter, and a flexible, noncontractile tail of approximately 200 nm in length. The number of potential open reading frames on the phage genome is 53. There are 15 unpaired nucleotides at both 5′ ends of the ΦAT3 genome, indicating that the phage uses a cos-site for DNA packaging. The ΦAT3 genome was grouped into five distinct functional clusters: DNA packaging, morphogenesis, lysis, lysogenic/lytic switch, and replication. The amino acid sequences at the NH2-termini of some major proteins were determined. An in vivo integration assay for the ΦAT3 integrase (Int) protein in several lactobacilli was conducted by constructing an integration vector including ΦAT3 int and the attP (int- attP) region. It was found that ΦAT3 integrated at the tRNA Arg gene locus of Lactobacillus rhamnosus HN 001, similar to that observed in its native host, Lb. casei ATCC 393.

The transcriptional switch of bacteriophage WPhi, a P2-related but heteroimmune coliphage.

Phage WPhi is a member of the nonlambdoid P2 family of temperate phages. The DNA sequence of the whole early-control region and the int and attP region of phage WPhi has been determined. The phage integration site was located at 88.6 min of the Escherichia coli K-12 map, where a 47-nucleotide sequence was found to be identical in the host and phage genomes. The WPhi Int protein belongs to the Int family of site-specific recombinases, and it seems to have the same arm binding recognition sequence as P2 Int, but the core sequence differs. The transcriptional switch contains two face-to-face promoters, Pe and Pc, and two repressors, C and Cox, controlling Pe and Pc, respectively. The early Pe promoter was found to be much stronger than the Pc promoter. Furthermore, the Pe transcript was shown to interfere with Pc transcription. By site-directed mutagenesis, the binding site of the immunity repressor was located to two direct repeats spanning the Pe promoter. A point mutation in one or the other repeat does not affect repression by C, but when it is included in both, C has no effect on the Pe promoter. The Cox repressor efficiently blocks expression from the Pc promoter, but its DNA recognition sequence was not evident. Most members of the P2 family of phages are able to function as helpers for satellite phage P4, which lacks genes encoding structural proteins and packaging and lysis functions. In this work it is shown that P4 E, known to function as an antirepressor by binding to P2 C, also turns the transcriptional switch of WPhi from the lysogenic to the lytic mode. However, in contrast to P2 Cox, WPhi Cox is unable to activate the P4 Pll promoter.

Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1 to obtain chromosomal single-copy transcriptional fusions in Lactococcus lactis.

Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp. cremoris (B. Christiansen, L. Brondsted, F. K. Vogensen, and K. Hammer, J. Bacteriol. 178:5164-5173, 1996). In this work, a further analysis of the phage-encoded elements involved in integration was performed. Here we demonstrate that even when the orf1 gene is separated from the attP region, the Orf1 protein is able to promote site-specific integration of an attP-carrying plasmid into the attB site on the L. lactis subsp. cremoris chromosome. Furthermore, the first detailed deletion analysis of an attP region of a phage infecting lactic acid bacteria was carried out. We show that a fragment containing 56 bp of the attP region, including the core, is sufficient for the site-specific integration of a nonreplicating plasmid into the chromosome of L. lactis subsp. cremoris when the orf1 gene is donated in trans. The functional 56-bp attP region of TP901-1 is substantially smaller than minimal attP regions identified for other phages. Based on the deletion analysis, several repeats located within the attP region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis was constructed. Two promoter-reporter integration vectors containing the reporter gene gusA or lacLM, encoding beta-glucuronidase or beta-galactosidase, respectively, were constructed. Immediately upstream of both genes are found translational stop codons in all three reading frames as well as multiple restriction enzyme sites suitable for cloning of the promoter of interest. By transformation of L. lactis subsp. cremoris MG1363 containing the integrase gene on a replicating plasmid, the promoter-reporter integration vectors integrated with a high frequency site specifically into the chromosomal attachment site attB used by bacteriophage TP901-1.

Site-specific integration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector.

The temperate bacteriophage VWB integrates into the chromosome of Streptomyces venezuelae ETH14630 via site-specific integration. Following recombination of the VWB attP region with the chromosomal attB sequence, the host-phage junctions attL and attR are formed. Nucleotide sequence analysis of attP, attB, attL and attR revealed a 45 bp common core sequence. In attB this 45 bp sequence consists of the 3' end of a putative tRNA Arg(AGG) gene with a 3'-terminal CCA sequence which is typical for prokaryotic tRNAs. Phage DNA integration restores the putative tRNA Arg(AGG) gene in attL. However, following recombination the CCA sequence is missing as is the case for most Streptomyces tRNA genes described so far. Adjacent to VWB attP, an ORF encoding a 427 aa protein was detected. The C-terminal region of this protein shows high similarity to the conserved C-terminal domain of site-specific recombinases belonging to the integrase family. To prove the functionality of this putative integrase gene (int), an integrative vector pKT02 was constructed. This vector consists of a 2.3 kb HindIII-SphI restriction fragment of VWB DNA containing attP and int cloned in a non-replicative Escherichia coli vector carrying a thiostrepton-resistance (tsr) gene. Integration of pKT02 was obtained after transformation of Streptomyces venezuelae ETH14630 and Streptomyces lividans TK24 protoplasts. This vector will thus be useful for a number of additional Streptomyces species in which a suitable tRNA gene can be functional as integration site.

Lysogenic bacteriophage M1 from Selenomonas ruminantium: isolation, characterization and DNA sequence analysis of the integration site.

Bacteriophage M1 from the ruminal bacterium Selenomonas ruminantium strain ML12 comprises a 30 nm icosahedral capsid, a 25 nm tail and 48 kb of linear dsDNA with cohesive ends. A restriction map of the phage genome has been constructed. The presence of bacteriophage M1 in the rumen has been demonstrated by PCR amplification and Southern blot analysis of DNA from rumen bacterial samples obtained from ten different sheep. Lysogeny was demonstrated by hybridization of M1 DNA to host chromosomal DNA and by identification and cloning of a 2.3 kb region of the phage containing the predicted attP domain which promotes chromosomal integration. DNA sequencing of the attP region demonstrated two major ORFs surrounding the predicted attP site and structural analysis of this region revealed a motif comprising three different inverted repeats surrounding a 12 bp palindrome. Analysis of the translated amino acid sequence upstream of the attP site demonstrated the presence of conserved residues found within integrase proteins of several temperate phages of different bacterial species.

Complete nucleotide sequence and molecular characterization of the temperate staphylococcal bacteriophage phiPVL carrying Panton-Valentine leukocidin genes.

The staphylococcal Panton-Valentine leukocidin (PVL) genes, [lukS-PV-lukF-PV], exist on the genome of a temperate bacteriophage phiPVL isolated from mitomycin C-induced Staphylococcus aureus V8 (ATCC 49775) (Kaneko, J., Kimura, T., Kawakami, Y., Tomita, T., Kamio, Y., 1997b. Panton-Valentine leukocidin genes in phage-like particle isolated from mitomycin C-treated Staphylococcus aureus V8 (ATCC 49775). Biosci. Biotechnol. Biochem. 61, 1960-1962). In this study, the complete nucleotide sequence of the phiPVL genome was analyzed, and the att sites (attL, attR, and attB) required for site-specific integration of phiPVL into the host chromosome were also determined. The linear double-stranded phiPVL genome comprised 41401bp with 3' staggered cohesive ends (cos) of nine bases and contained 63 ORFs, among which the regulatory proteins involved in DNA replication, structural proteins, a holin, a lysin, an integrase, and dUTPase, were tentatively identified by the comparison of the deduced amino acid sequences and by the analysis of the proteins isolated from phiPVL particles. The [lukS-PV-lukF-PV], attP, and int (integrase gene) of phiPVL were all located very close to one another within a 4.0-kb segment on the genome in the order given, and this segment was located at the center from the left and the right cos sites. In addition, the attP region contained five direct repeat sequences that showed a high degree of homology with the recombinase-binding sites of some other S. aureus bacteriophages. The phiPVL genome was found to integrate into an ORF encoding an unknown protein comprising 725 amino acid residues with two leucine zipper-like motifs.

Characterization of the lactococcal temperate phage TP901-1 and its site-specific integration.

The temperate lactococcal phage TP901-1, induced by UV light from Lactococcus lactis subsp. cremoris 901-1, was characterized. The restriction map was found to be circular, and the packaging of TP901-1 DNA was concluded to occur by a headful mechanism. The pac region was localized on the 38.4-kb phage genome. TP901-1 belongs to the class of P335 phages (V. Braun, S. Hertwig, H. Neve, A. Geis, and M. Teuber, J. Gen. Microbiol. 135:2551-2560, 1989). Evidence is presented that the phages TP936-1 (V. Braun, S. Hertwig, H. Neve, A. Geis, and M. Teuber, J. Gen. Microbiol. 135:2551-2560, 1989) and C3-T1 (A. W. Jarvis, V. R. Parker, and M. B. Bianchin, Can. J. Microbiol. 38:398-404, 1992) are very closely related to or are identical to TP901-1. The lytically propagated TP901-1 phages were able to lysogenize both indicator strains Lactococcus cremoris 3107 and Wg2. Lysogenization resulted in site-specific integration of the phage genome into the bacterial chromosome. Only one chromosomal attB site was found in 20 independent lysogens. The attP region of TP901-1 and the attL and attR regions were cloned and sequenced. The results showed a core region of only 5 bp, in which the recombination occurs, followed after a 1-bp mismatch by a 7-bp identical region, TCAAT(T/C)AAGGTAA. This result was further verified by sequencing of the attB region obtained by PCR. An integration vector was constructed with the 6.5-kb EcoRI fragment from TP901-1 containing attP. This vector also functions in the plasmid-free strains, MG1363 and LM0230 with only one specific attB site, strongly indicating a more general use of the TP901-1-based integration vector in lactococci.

Characterization of the binding sites of two proteins involved in the bacteriophage P2 site-specific recombination system

Integration of the bacteriophage P2 genome into the Escherichia coli host chromosome occurs by site-specific recombination between the phage attP and E. coli attB sites. The phage-encoded 38-kDa protein, integrase, is known to be necessary for both phage integration as well as excision. In order to begin the molecular characterization of this recombination event, we have cloned the int gene and overproduced and partially purified the Int protein and an N-terminal truncated form of Int. Both the wild-type Int protein and the integration host factor (IHF) of E. coli were required to mediate integrative recombination in vitro between a supercoiled attP plasmid and a linear attB substrate. Footprint experiments revealed one Int-protected region on both of the attP arms, each containing direct repeats of the consensus sequence TGTGGACA. The common core sequences at attP and attB were also protected by Int from nuclease digestion, and these contained a different consensus sequence, AA T/A T/A C/A T/G CCC, arranged as inverted repeats at each core. A single IHF-protected site was located on the P (left) arm, placed between the core- and P arm-binding site for Int. Cooperative binding by Int and IHF to the attP region was demonstrated with band-shift assays and footprinting studies. Our data support the existence of two DNA-binding domains on Int, having unrelated sequence specificities. We propose that P2 Int, IHF, attP, and attB assemble in a higher-order complex, or intasome, prior to site-specific integrative recombination analogous to that formed during lambda integration.

Genetic analysis of Escherichia coli integration host factor interactions with its bacteriophage lambda H' recognition site

The bacteriophage P22-based challenge phage system was used to study the binding of integration host factor (IHF) to its H' recognition site in the attP region of bacteriophage lambda. We constructed challenge phages that carried H' inserts in both orientations within the P22 Pant promoter, which is required for antirepressor synthesis. We found that IHF repressed expression of Pant from either challenge phage when expressed from an inducible Ptac promoter on a plasmid vector. Mutants containing changes in the H' inserts that decrease or eliminate IHF binding were isolated by selecting challenge phages that could synthesize antirepressor in the presence of IHF. Sequence analysis of 31 mutants showed that most changes were base pair substitutions within the H' insert. Approximately one-half of the mutants contained substitutions that changed base pairs that are part of the IHF consensus binding site; mutants were isolated that contained substitutions at six of the nine base pairs of the consensus site. Other mutants contained changes at base pairs between the two subdeterminants of the H' site, at positions that are not specified in the consensus sequence, and in the dA + dT-rich region that flanks the consensus region of the site. Taken together, these results show that single-base-pair changes at positions outside of the proposed consensus bases can weaken or drastically disrupt IHF binding to the mutated site.

Curved DNA fragments display retarded elution upon anion exchange HPLC.

Restriction fragments containing established curved regions, such as the pBR322 tn3 region, the phage lambda attP region and the SV40 T-antigen and terminus of replication regions, exhibit systematically retarded elution upon anion exchange based HPLC. Using this method, we were able to detect readily other SV40 curved regions, exhibiting also the polyacrylamide gel electrophoresis retardation anomaly, including several RNA polymerase initiation sites. Unlike gel retardation, HPLC retardation exhibited by curved DNA persists at 55 degrees C and is observed for fragments ranging from 150 bp up to 5 kb. The observed preferential attachment of DNA fragments containing curved DNA to the ionic groups of the column suggests a common dipole character of these regions due to the local accumulation of charges resulting apparently from the compression in the minor groove of curved DNA.

Interaction of integration host factor from Escherichia coli with the integration region of the Haemophilus influenzae bacteriophage HP1

The specific DNA-binding protein integration host factor (IHF) of Escherichia coli stimulates the site-specific recombination reaction between the attP site of bacteriophage HP1 and the attB site of its host, Haemophilus influenzae, in vitro and also appears to regulate the expression of HP1 integrase. IHF interacts specifically with DNA segments containing the att sites and the integrase regulatory region, as judged by IHF-dependent retardation of relevant DNA fragments during gel electrophoresis. The locations of the protein-binding sites were identified by DNase I protection experiments. Three sites in the HP1 attP region bound IHF, two binding sites were present in the vicinity of the attB region, and one region containing three partially overlapping sites was present in the HP1 integrase regulatory segment. The binding sites defined in these experiments all contained sequences which matched the consensus IHF binding sequences first identified in the lambda attP region. An activity which stimulated the HP1 site-specific integration reaction was found in extracts of H. influenzae, suggesting that an IHF-like protein is present in this organism.

Repression of transcription from the b2-att region of coliphage λ by integration host factor

The central b2-att region of coliphage λ is known to be transcriptionally active in vitro, but silent in vivo in λ lysogens. To explain such in vivo repression of transcription originating in the b2-att region, we explored the effect of the Escherichia coli integration host factor (11-IF), the product of E. coli genes himA and himD, especially since the att region contains several IHF-binding sites. Using various λ DNA templates, we mapped the transcripts which are initiated in vitro in the attP region by the RNA polymerase and found that there are three rightward (RI, RII, and Rill) and one leftward (L1) transcripts. All four of them are repressed by a factor of about 10 by 10 μg IHF/ml. Moreover, in in vivo experiments we found that plasmids carrying the attP fragment cannot be established and maintained in IHF-hosts. These results indicate that IHF may play a significant auxiliary role in repressing transcription in the prophage state.

Interaction of int protein with specific sites on λ att DNA

We have studied the interaction of highly purified Int protein with DNA restriction fragments from the lambda phage attachment site ( attP) region. Two different DNA sequences are protected by bound Int protein against partial digestion by either pancreatic DNAase or neocarzinostatin. One Int binding site includes the 15 bp common core sequence (the crossover region for site-specific recombination) plus several bases of sequence adjoining the core in both the P and P′ arms. The second Int-protected site occurs 70 bp to the right of the common core in the P′ arm, just at the distal end of the sequence encoding Int protein. The two Int binding sites are of comparable size, 30–35 bp, but do not share any extensive sequence homology. The interaction of Int with the two sites is distinctly different, as defined by the observation that only the site in the P′ arm and not the site at the common core region is protected by Int in the face of challenge by the polyanion heparin. Restriction fragments containing DNA from the bacterial attachment site ( attB) region exhibit a different pattern of interaction with Int. In the absence of heparin, a smaller (15 bp) sequence, which includes the left half of the common core region and the common core-B arm juncture, is protected against nuclease digestion by Int protein. No sequences from this region are protected by Int in the presence of heparin.