Aptamer-conjugated Gold Nanoparticles Research Articles

Aptamer-conjugated gold nanoparticles for portable, ultrasensitive naked-eye detection of C-reactive protein based on the Tyndall effect

BackgroundC-reactive protein (CRP) represents an early clinical biomarker that indicates the presence of inflammatory or infectious conditions in the human body. Today's procedures approved by the Food and Drug Administration (FDA) imply expensive equipment and highly trained personnel to perform the test. Therefore, a new diagnostic method with high detection efficiency and less cost is urgently needed for delivering rapid and timely results in point-of-care (POC) service. ResultsHerein, we propose a new, equipment-free, and portable sensing method for the future POC detection of CRP based on the Tyndall effect (TE). In our study, aptamer-conjugated citrate-stabilized gold nanoparticles (apta-AuNPs) are exploited as the sensing platform. The apta-AuNPs’ interaction with CRP in a saline environment leads to their aggregation, thus enhancing the scattering of light when the solution is exposed to a 640 nm pointer laser line. Firstly, the enhancement of the scattering light as a function of increasing concentration of CRP in solution is measured spectroscopically using a typical 90-degree angle spectrofluorometer and then the measurements are compared to the classic colorimetric detection using an UV–Vis spectrophotometer. Finally, to achieve high portability and accessibility, we demonstrate that the measurement of CRP concentration can be performed with similar accuracy but in a more direct and inexpensive way by using a laser pointer pen as the excitation source and a camera of a low-budget smartphone as a quantitative reader instead of most expensive spectrofluorometer. SignificanceThe portable TE-based assay exhibits a wide linear dynamic range (1–60 μg/mL) for the detection of CRP with a limit of detection (LOD) of 92 ng/mL The proposed method is capable to integrate both standard and high-sensitivity CRP analysis in a single procedure with increased sensitivity and prompt delivery of analysis results. Moreover, the sensing procedure is significantly faster than the FDA approved ones with a detection time of only 10 min. Finally, as a proof-of-concept, our findings demonstrate excellent recovery for CRP detection in spiked and diluted urine samples, highlighting the strong potential of this sensing method for POC applications.

Portable smartphone-based aptasensor for nitrofuran detection

A portable electrochemical aptasensor for the detection of nitrofuran (NF) was developed. Aptamer-conjugated gold nanoparticles (Apt-AuNPs) were immobilized on a chitosan (CS) thin film electrodeposited on a screen-printed carbon electrode (SPCE). The modified electrode was connected to a smartphone-controlled near-field communication (NFC) potentiostat. The electrochemical aptasensor determined NF concentration using cyclic voltammetry (CV) and chronoamperometry (CA) techniques. Under optimal conditions, the developed aptasensor exhibited high sensitivity (11.26 ± 0.38 μA L/μg), a wide linear range (0.005 to 0.08 μg/L and 0.08 to 4.0 μg/L), and a low detection limit (0.004 μg/L). Our construction demonstrated excellent stability for NF, with a reduction in current of less than 10 % even after 330 days. Reproducibility (%RSD = 2.19 %) was good, and the device was portable, simple, and selective. Therefore, this aptasensor platform was applied as a smartphone-based wireless NFC potentiostat for NF detection in shrimp pond water and shrimp samples.

Simultaneous Detection of Infectious Diseases Using Aptamer-Conjugated Gold Nanoparticles in the Lateral Flow Immunoassay-Based Signal Amplification Platform.

Various platforms for the accurate diagnosis of infectious diseases have been studied because of the emergence of coronavirus disease (COVID-19) in 2019. Recently, it has become difficult to distinguish viruses with similar symptoms due to the continuous mutation of viruses, and there is an increasing need for a diagnostic method to detect them simultaneously. Therefore, we developed a paper-based rapid antigen diagnostic test using DNA aptamers for the simultaneous detection of influenza A, influenza B, and COVID-19. Aptamers specific for each target viral antigen were selected and attached to AuNPs for application in a rapid antigen diagnosis kit using our company's heterogeneous sandwich-type aptamer screening method (H-SELEX). We confirmed that the three viruses could be detected on the same membrane without cross-reactivity based on the high stability, specificity, and binding affinity of the selected aptamers. Further, the limit of detection was 2.89 pg·mL-1 when applied to develop signal amplification technology; each virus antigen was detected successfully in diluted nasopharyngeal samples. We believe that the developed simultaneous diagnostic kit, based on such high accuracy, can distinguish various infectious diseases, thereby increasing the therapeutic effect and contributing to the clinical field.

Aptamer-conjugated gold nanoparticles platform as the intracellular delivery of antibodies for cancer therapy

Antibodies are being increasingly used for therapeutic purposes due to their remarkable target specificity and affinity. However, currently available antibody therapies are restricted to target proteins in the outer cell membrane or in the extracellular fluids because of the lack of technologies for effective intracellular delivery of antibodies. Here, we report an efficient and versatile intracellular antibody delivery system. This system is based on gold nanoparticles (AuNPs) conjugated with DNA aptamers (Apt) against the Fc region of IgG (AuNP-AptIgG), allowing to load any antibodies onto the AuNP-AptIgG by simple mixing. This AuNP-AptIgG-Ab platform was effective for cytosolic delivery of antibodies to clinically important mutant proteins via scavenger receptors and caveolae-mediated endocytosis. Specifically, cancer cells expressing BRAFV600E, a variant of BRAF identified in numerous types of cancers, exhibited reduced cell viability by 70% when BRAFV600E antibodies were intracellularly delivered using the AuNP-AptIgG (AuNP-AptIgG-αBRAFV600E). In addition, subcutaneous injection of AuNP-AptIgG-αBRAFV600E into in vivo xenografted melanoma tumors expressing BRAFV600E resulted in both inhibition of proliferation and induction of apoptosis, leading to tumor regression in mice. Thus, our findings indicate that the AuNP-AptIgG-Ab system can serve as a promising platform for effective intracellular delivery of antibodies for therapeutic purposes.

Aptamer-conjugated gold nanoparticles and their diagnostic and therapeutic roles in cancer.

The burden of incidence rate and mortality of cancer is increasing rapidly, and the development of precise intervention measures for cancer detection and treatment will help reduce the burden and pain of cancer. At present, the sensitivity and specificity of tumor markers such as CEA and CA-125 used clinically are low, while PET, SPECT, and other imaging diagnoses with high sensitivity possess shortcomings, including long durations to obtain formal reports and the inability to identify the molecular pathological type of cancer. Cancer surgery is limited by stage and easy to recur. Radiotherapy and chemotherapy often cause damage to normal tissues, leading to evident side effects. Aptamers can selectively and exclusively bind to biomarkers and have, therefore, gained attention as ligands to be targeted for cancer detection and treatment. Gold nanoparticles (AuNPs) are considered as promising nano carriers for cancer diagnosis and treatment due to their strong light scattering characteristics, effective biocompatibility, and easy surface modification with targeted agents. The aptamer-gold nanoparticles targeting delivery system developed herein can combine the advantages of aptamers and gold nanoparticles, and shows excellent targeting, high specificity, low immunogenicity, minor side effects, etc., which builds a bridge for cancer markers to be used in early and efficient diagnosis and precise treatment. In this review, we summarize the latest progress in the application of aptamer-modified gold nanoparticles in cancer targeted diagnosis and delivery of therapeutic agents to cancer cells and emphasize the prospects and challenges of transforming these studies into clinical applications.

Sandwich-like electrochemical aptasensing of heat shock protein 70 kDa (HSP70): Application in diagnosis/prognosis of coronavirus disease 2019 (COVID-19)

In this research, by using aptamer-conjugated gold nanoparticles (aptamer-AuNPs) and a modified glassy carbon electrode (GCE) with reduced graphene oxide (rGO) and Acropora-like gold (ALG) nanostructure, a sandwich-like system provided for sensitive detection of heat shock protein 70 kDa (HSP70), which applied as a functional biomarker in diagnosis/prognosis of COVID-19. Initially, the surface of the GCE was improved with rGO and ALG nanostructures, respectively. Then, an aptamer sequence as the first part of the bioreceptor was covalently bound on the surface of the GCE/rGO/ALG nanostructures. After adding the analyte, the second part of the bioreceptor (aptamer-AuNPs) was immobilized on the electrode surface to improve the diagnostic performance. The designed aptasensor detected HSP70 in a wide linear range, from 5 pg mL−1 to 75 ng mL−1, with a limit of detection (LOD) of ∼2 pg mL−1. The aptasensor was stable for 3 weeks and applicable in detecting 40 real plasma samples of COVID-19 patients. The diagnostic sensitivity and specificity were 90% and 85%, respectively, compared with the reverse transcription-polymerase chain reaction (RT-PCR) method.

Conformational switching of aptamer biointerfacing graphene-gold nanohybrid for ultrasensitive label-free sensing of cardiac Troponin I

The development of hybrid biofunctionalized nanomaterials has emerged as an attractive substitute for development of advanced biosensing platforms with superior synergistic properties. Herein, we report a label-free ultrasensitive electrochemical aptasensor comprising nanohybrid of graphene oxide (GO) and aptamer conjugated gold nanoparticles (GNP-A) for detection of cardiac biomarker Troponin I (TnI). The GNP-A are homogenously arranged by self-assembly on GO sheet to construct nanohybrid (GO@GNP-A) onto which the biomarker protein is analysed. TnI interactions at the aptamer biointerfaced nanohybrid surface causes electrochemical signal enhancement probed by using a redox active molecule. The consecutive increase in current signal is strongly attributed to conformational switching of aptamer and charge neutralization at the interface induced by TnI binding. The sensitivity of the nanohybrid aptasensor platform was found to be 0.001 pg/mL. The study has been further substantiated in Acute Myocardial Infarction (AMI) clinical samples for usage towards early, sensitive and efficient point-of-care detection of TnI.

A Simple Yet Effective Preanalytical Strategy Enabling the Application of Aptamer-Conjugated Gold Nanoparticles for the Colorimetric Detection of Antibiotic Residues in Raw Milk.

The misuse of antibiotics in the cattle sector can lead to milk contamination, with concomitant effects on the dairy industry and human health. Biosensors can be applied in this field; however, the influence of the milk matrix on their activity has been poorly studied in light of the preanalytical process. Herein, aptamer-conjugated gold nanoparticles (nanoaptasensors) were investigated for the colorimetric detection in raw milk of four antibiotics used in cattle. The effect of milk components on the colorimetric response of the nanoaptasensors was analyzed by following the selective aggregation of the nanoparticles, using the absorption ratio A520/A720. A preanalytical strategy was developed to apply the nanoaptasensors to antibiotic-contaminated raw milk samples, which involves a clarification step with Carrez reagents followed by the removal of cations through dilution, chelation (EDTA) or precipitation (NaHCO3). The colorimetric signals were detected in spiked samples at concentrations of antibiotics as low as 0.25-fold the maximum residue limits (MRLs) for kanamycin (37.5 μg/L), oxytetracycline (25 μg/L), sulfadimethoxine (6.25 μg/L) and ampicillin (1 μg/L), according to European and Chilean legislation. Overall, we conclude that this methodology holds potential for the semiquantitative analysis of antibiotic residues in raw milk obtained directly from dairy farms.

Aptamer-conjugated gold nanoparticles for targeted paclitaxel delivery and photothermal therapy in breast cancer

The development of novel therapeutic approaches with high efficiency and precision like photothermal therapy (PTT) is essential to combat breast cancer. The gold nanoparticle (AuNPs) has shown critical ability both in PTT and targeted delivery. Herein, we evolved targeted PTT in a multifunctional drug delivery platform. The AuNPs were modified by poly (ethylene glycol) (PEG) to improve their biocompatibility, and the mucin1 (MUC1) aptamer-modified PEG-AuNPs were successfully prepared. The Paclitaxel (PTX)–loaded PEG-AuNPs@antiMUC1 system displayed a dual NIR/pH-dependent sustained release. The synergistic effect of PTX/PEG-AuNPs@antiMUC1 was evaluated in this research. In vitro cell cytotoxicity experiments on MUC1-positive and MUC1-negative breast cancer cells showed the desired selectivity of the prepared system towards MUC1-positive cells. The capability of the PTX/PEG-AuNPs@antiMUC1 in combination with near-infrared (NIR) irradiation in ablation of MUC1-positive cancer cells with excellent cellular uptake was also witnessed. Furthermore, simultaneous utilization of PTT and targeted drug delivery indicated a synergistic effect that increased cell death versus seldom PTT or chemotherapy. The protein expression analysis confirmed the increased expression of the apoptotic Caspase3 and declined expression of the anti-apoptotic Bcl-xL in the presence of the prepared synergistic combinational system, which showed its high potentials in cancer therapy.

Development of gold nanoparticles-aptamer nanocomposite for multiplexed analysis of antibiotics and design of molecular logic gates

The widespread use of antibiotics caused severe problems of antibiotic residues in foodstuffs and water, posing a serious threat to public health and thus urging the development of sensitive, selective, and rapid detection methods for antibiotics. In this study, a fluorescence resonance energy transfer (FRET)-based system is developed for the multiplexed analysis of chloramphenicol (CAP) and streptomycin (Strep) with detection limits of 2.51 and 8.69 μg l−1, respectively. The FRET-based system consists of Cy3-tagged anti-CAP aptamer-conjugated gold nanoparticles (AuNPs) (referred to as AuNPs-AptCAP) and Cy5-tagged anti-Strep aptamer-conjugated AuNPs (referred to as AuNPs-AptStrep). In addition, AuNPs-AptCAP and AuNPs-AptStrep have been demonstrated to serve as signal transducers for implementing a series of logic operations such as YES, NOT, INH, OR, (2-4)-Decoder and even more complicated multi-level logic gates (OR-INH). Based on the outputs of logic operations, it could be figured out whether targeted analytes were present or not, thus enabling multiplex sensing and evaluation of pollution status. This proof of concept study might provide a new route for the enhanced sensing performance to distinguish different pollution status as well as the design of molecular mimics of logic elements to demonstrate better applicability.

Biosensors based on aptamer-conjugated gold nanoparticles: A review.

Simply synthetized gold nanoparticles have been highly used in medicine and biotechnology as a result of their biocompatibility, conductivity, and being easily functionalized with biomolecules such as aptamer. Aptamer-conjugated gold nanoparticle structures synergically possess characteristics of both aptamer and gold nanoparticles including high binding affinity, high biocompatibility, enhanced target selectivity, and long circulatory half-life. Aptamer-conjugated gold nanoparticles have extensively gained considerable attention for designing of biosensing systems due to their interesting optical and electrochemical features. Moreover, biosensors based on aptamer-gold nanoparticles are easy to use, with fast response, and inexpensive which make them ideal in individualized medicine, disease markers detection, food safety, and so forth. Moreover, due to high selectivity and biocompatibility of aptamer-gold nanoparticles, these biosensing platforms are ideal tools for targeted drug delivery systems. The application of this nanostructure as diagnostic and therapeutic tool has been developed for detection of cancer in the early stage by detecting cancer biomarkers, pathogens, proteins, toxins, antibiotics, adenosine triphosphate, and other small molecules. This review obviously demonstrates that this nanostructure effectively is applicable in the field of biomedicine and possesses potential of commercialization aims.

A Novel Fluorescent Aptasensor for Sensitive Detection of Oxytetracycline Based on Gold Nanoparticles and OTC-Eu

We developed a simple and selective fluorescent aptasensor for the detection of oxytetracycline (OTC) using aptamer-conjugated gold nanoparticles (AuNPs) and a complex formed between oxytetracycline and a europium cation. In this study, AuNPs were modified with an OTC aptamer using two methods (Tween and NaCl methods). In the absence of OTC, an OTC-Eu3+ complex binds to the aptamer in the aptamer-conjugated AuNPs to give weak fluorescence emission. However, in the presence of OTC, the aptamer interacts with its target, causing a strong fluorescence emission. Under optimum conditions, the designed method showed high selectivity for OTC and a good linear range to OTC concentration from 15 to 500 nM with a limit of detection (LOD) of 10.6 nM for the NaCl method and linear range over 15–500 nM with an LOD of 8.8 nM for the Tween method. This biosensor was successfully employed to quantify OTC in milk and tablet samples.

Improving sensitivity of mercury detection using learning based smartphone colorimetry

Detection of various contaminations in drinking water such as heavy metal ions and toxic chemicals is costly, time-consuming and requires an accompanying computing device to capture and analyze the data. Hence, there is an extensive need for a rapid, user-friendly, cost-effective, sensitive and ubiquitous detection technique. Smartphones are an effective means to measure, analyze and share the results. In this work, a gadget was designed and printed using a lightweight 3D material, which can be attached to any smartphone and integrated with optical components. A full color TFT LCD display was used as the uniform source of any color of light. Aptamer conjugated gold nanoparticles were employed to determine the concentration of Hg2+ as the basis of a colorimetric sensor. Interaction between the aptamer and the analytes leads to a color change in the solution due to aggregation of gold nanoparticles. For the corresponding color change detection, a novel image processing protocol using RGB value was introduced for each captured image. Multiple linear regression analysis was also exploited to achieve a better sensor response model. Light source enhancement, colorimetry at more points of visible spectrum (470, 540, 640 nm) and a powerful post process technique including machine learning made it possible to obtain an excellent level of sensitivity (1 nM–0.2 ppb).

Targeted imaging of breast cancer cells using two different kinds of aptamers -functionalized nanoparticles

Breast cancer which is the most commonly diagnosed cancer among women; have been known as a serious threat for health and life around the world. So development of an approach for early-stage diagnosis of breast cancer is vital. In this study, we designed a double aptamer-nanoparticle conjugates-based (DANP) complex for specific detection and visualization of MCF-7 cells using Mucin 1 (MUC 1) aptamer-conjugated gold nanoparticles (MUC1 apt - GNPs) and adenosine triphosphate (ATP) aptamer-conjugated CdTe quantum dots (ATP apt-QDs). The ATP apt-QDs was attached onto MUC1 apt - GNPs surface through Van der Waals forces and electrostatic interactions between ATP aptamer and GNPs leading to the formation of DANP complex. Atomic force microscopy asserted DANP complex formation. The imaging process was based on the recognition of MUC1 protein on the surface of MCF-7 cells by MUC1 aptamer and specific internalization of DANP complex into target cells (MCF-7). Existence of abundant amounts of ATP in lysosome led to release of ATP apt-QDs from the MUC1 apt-GNPs surface resulting in strong fluorescence emission. The flow cytometry analysis and fluorescence microscopy confirmed significant internalization of DANP complex into MCF-7 cells (target) in comparison with CHO cells (non-target). Based on the obtained results, the DANP complex possesses high potency for efficient detection and monitoring of breast cancer cells (MCF-7).

Aptamer–gold nanoparticle conjugates for the colorimetric detection of arboviruses and vector mosquito species

The real-time, colorimetric detection of analytes via aptamer–gold nanoparticle technology has proven to be an important, emerging technique within the medical field. Of global health importance, the ability to detect vector mosquito species, such as the Aedes (Ae.) aegypti mosquito, and transmitted arboviruses, such as Zika virus, is paramount to mosquito control and surveillance efforts. Herein, we describe the detection of Ae. aegypti salivary protein for vector identification and the detection of Zika virus to assess mosquito infection status by aptamer–gold nanoparticle conjugates. Key to optimization of these diagnostics were gold nanoparticle capping agents and aptamer degree of labelling (i.e., the amount of aptamers per gold nanoparticle). In the present study, detection was achieved for as little as 10 ng Ae. aegypti salivary protein and 1.0 × 105 PFU live Zika virus. These aptamer–gold nanoparticle conjugate diagnostics could one day prove to be useful as deployable nano-based biosensors that provide easy-to-read optical read outs through a straightforward red-to-blue colour change either within a diagnostic solution or atop a card/membrane-based biosensor.

Label-Free Sensitive Detection of Microcystin-LR via Aptamer-Conjugated Gold Nanoparticles Based on Solid-State Nanopores.

A versatile and highly sensitive strategy for nanopore detection of microcystin-LR (MC-LR) is proposed herein based on the aptamer and host-guest interactions by employing a gold nanoparticle (AuNP) probe. The aptamer of MC-LR and its complementary DNA (cDNA) are respectively immobilized on AuNPs with distinct sizes (5 nm AuNPs for the aptamer and 20 nm for the cDNA), and the constructed polymeric AuNP network via the hybridization of the aptamer and cDNA was disintegrated upon the addition of MC-LR. The specific interactions between the aptamer and MC-LR disrupt and release the cDNA-AuNPs that were then removed by centrifugation, leaving the MC-LR-aptamer-AuNP species in the supernatant for subsequent nanopore determination. By monitoring the current blockade of released MC-LR-aptamer-AuNPs using a specific tailored nanopore (10 and 20 nm in diameter, generated by current dielectric breakdown), we could deduce the presence of MC-LR, as the bulky NP network could not pass through a nanopore with a relatively smaller size. We realized the detection of MC-LR with a concentration as low as 0.1 nM; additionally, we have proved the specificity of the interaction between the aptamer and MC-LR by replacing MC-LR with other congener toxins (MC-RR and MC-YR), chlorophyll (a component abundantly coexists in water), and the mixture of the four.

Localized Surface Plasmon Resonance (LSPR)-Based Nanobiosensor for Methamphetamin Measurement

Aptamers are DNA or RNA single-stranded molecules that bind specifically to target molecules with high affinity. Function of nucleic acid aptamers is based on organized tertiary structure of them that is related to primary sequence, length of nucleic acid molecule, and environmental conditions. Herein, a localized surface plasmon resonance (LSPR) nanobioprobe has been developed based on specific aptamer-conjugated gold nanoparticles for rapid detection of methamphetamine. Detection of methamphetamine was studied via monitoring the gold nanoparticles (GNPs) LSPR band alterations in the presence of different concentrations. The covalent conjugation has been confirmed with FT-IR spectroscopy, and size alterations of gold nanoparticles before and after the conjugation state were monitored using dynamic light scattering (DLS) technique. The results show high affinity of aptamer to methamphetamine. Moreover, the results show conjugated aptamer with GNP in different concentrations of methamphetamine that contribute to color changes that is visible with unaided eye. Also, 14 nm LSPR shift was seen after conjugation of aptamer with GNP. Nanoparticle diameter after conjugation with aptamer was increased from 30 to 91 nm and decreased after incubation with methamphetamine (due to folding) from 91 to 84 nm. Detection limit of this designed nanoprobe is 500 nM. Plasmonic nanoparticle-based nanobioprobe is a new field for development of sensitive detection systems.

Prediction of shorter oligonucleotide sequences recognizing aflatoxin M1.

Aflatoxin M1 (AFM1) is present in milk of lactating animals fed on aflatoxin B1 contaminated feeds. Aptamers are new emerging ligand molecules and can be employed in assay protocols. Shorter aptamers have several advantages. Untruncated (72-nucleotide long) and truncated (18- to 42-nucleotide long) aptamers were evaluated for AFM1 recognition that was detected by color change in aptamer-conjugated gold nanoparticles in the presence of AFM1. Truncation of 10 aptamers was designed to retain motifs. Untruncated and truncated aptamers recognized AFM1. Binding region on truncated aptamers was predicted by aligning sequences with reported aptamer "ACTGCTAGAGATTTTCCACAT". Aptamer "AFAS3Tr" (ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGA), APM15Tr (CAACGCCAGTCAGTATCTTATATGCTATACTGGCTGGTGTTG), AFA4Tr (AAAA-ACACTATGTAGTGGTGT), AFAM7Tr (CCGGCGGATGCTAATTGCAGAGCAGGTGTGCCGG), and APM6Tr (AAAAATAATTCTAGGTTA) derived from random region of oligonucleotide library had strong homology with 8-nucleotide (ACTGCTAG) sequence at 5' end of reported aptamer. Comparison of sequence alignment of each of five truncated aptamers with reported sequence has allowed concluding that CTGCTCTGACGCTG in AFAS3Tr, ACGCCAG in APM15Tr, ACTATGTAG in AFA4Tr, TGCTA in AFAM7Tr, AATTCTAG in APM6Tr, and ACTGCTAG in reported aptamer are probable binding regions in aptamers. Truncated aptamers APM15Tr, AFAS3Tr, AFAM7Tr, APM6Tr, AFA4Tr, and predicted shorter nucleotide sequences offer promise for further exploitation in developing sensitive methods for AFM1 measurement.

Cross-Reactive Plasmonic Aptasensors for Controlled Substance Identification.

In this work, we developed an assay to determine if an arbitrary white powder is a controlled substance, given the plasmonic response of aptamer-gold nanoparticle conjugates (Apt-AuNPs). Toward this end, we designed Apt-AuNPs with specific a response to common controlled substances without cross reactivity to chemicals typically used as fillers in street formulations. Plasmonic sensor variation was shown to produce unique data fingerprints for each chemical analyzed, supporting the application of multivariate statistical techniques to annotate unknown samples by chemical similarity. Importantly, the assay takes less than fifteen minutes to run, and requires only a few micrograms of the material, making the proposed assay easily deployable in field operations.

Gold nanoparticles modified with self-assembled hybrid monolayer of triblock aptamers as a photoreversible anticoagulant

We demonstrated that thrombin-binding aptamer-conjugated gold nanoparticles (TBA–Au NPs), prepared from a self-assembled hybrid monolayer (SAHM) of triblock aptamers on Au NPs (13nm), can effectively inhibit thrombin activity toward fibrinogen. The first block poly(adenine) at the end of the triblock TBA was used for the self-assembly on Au NP surface. The second block, in the middle of TBA, was composed of oligonucleotides that could hybridize with each other. The third block, containing TBA15 (15-base, binding to the exosite I of thrombin) and TBA29 (29-base, binding to the exosite II of thrombin) provided bivalent interaction with thrombin. The SAHM triblock aptamers have optimal distances between TBA15 and TBA29, aptamer density, and orientation on the Au NP surfaces. These properties strengthen the interactions with thrombin (Kd=1.5×10−11M), resulting in an extremely high anticoagulant potency. The thrombin clotting time mediated by SAHM TBA15/TBA29–Au NPs was >10 times longer than that of four commercially available drugs (heparin, argatroban, hirudin, or warfarin). In addition, the rat-tail bleeding assay time further demonstrated that the SAHM TBA15/TBA29–Au NPs were superior to heparin. The SAHM TBA15/TBA29–Au NPs exhibited excellent stability in the human plasma (half-life >14days) and good biocompatibility (low cytotoxicity and hemolysis). Most interestingly, the inhibition by SAHM TBA15/TBA29–Au NPs was controllable by the irradiation of green laser, via heat transfer-induced TBA release from Au NPs. Therefore, these easily prepared (self-assembled), low cost (non-thiolated aptamer), photo-controllable, multivalent TBA15/TBA29–Au NPs (high density of TBA15/TBA29 on Au NPs) show good potential for the treatment of various diseases related to blood-clotting disorders. Our study opens up the possibility of regulation of molecule binding, protein recognition, and enzyme activity using SAHM aptamer-functionalized nanomaterials.