Apricot Orchards Research Articles

Regulated Deficit Irrigation Perspectives for Water Efficiency in Apricot Cultivation: A Review

Addressing agricultural water scarcity poses a current challenge of growing concern, exacerbated by climate change. This is particularly relevant for stone fruit trees, such as apricot, cultivated in semi-arid zones, where regulated deficit irrigation (RDI) strategies are gaining attention to tackle the challenge. The RDI method involves optimizing various factors based on how the plant responds physiologically to indicators of its water needs. Among these indicators, water potential is considered the most reliable and influential measure. For numerous apricot varieties and diverse geographic locations, research consistently shows that implementing water reduction strategies during non-critical developmental stages of floral bud development or fruit growth does not significantly impact crop yield. However, it does lead to reduced vegetative growth, which could offer additional benefits in crop management. Furthermore, the implementation of RDI strategies leads to advantageous improvements in fruit quality, particularly storage capacity and morphometric and chemical fruit characteristics, such as total soluble solids content. This scoping review study suggests that RDI is a feasible strategy to address water scarcity in apricot cultivation; however, further studies focused on continuous water monitoring alternatives are necessary to optimize RDI techniques. Future research should prioritize optimizing RDI for different growth stages, exploring advanced technologies for precise implementation, and assessing environmental impacts, while addressing research gaps including the influence of climate variability and the interaction with other agronomic practices, to refine RDI strategies and enhance apricot orchard sustainability and productivity.

Novel phages of Pseudomonas syringae unveil numerous potential auxiliary metabolic genes.

Relatively few phages that infect plant pathogens have been isolated and investigated. The Pseudomonas syringae species complex is present in various environments, including plants. It can cause major crop diseases, such as bacterial canker on apricot trees. This study presents a collection of 25 unique phage genomes that infect P. syringae. These phages were isolated from apricot orchards with bacterial canker symptoms after enrichment with 21 strains of P. syringae. This collection comprises mostly virulent phages, with only three being temperate. They belong to 14 genera, 11 of which are newly discovered, and 18 new species, revealing great genetic diversity within this collection. Novel DNA packaging systems have been identified bioinformatically in one of the new phage species, but experimental confirmation is required to define the precise mechanism. Additionally, many phage genomes contain numerous potential auxiliary metabolic genes with diversified putative functions. At least three phages encode genes involved in bacterial tellurite resistance, a toxic metalloid. This suggests that viruses could play a role in bacterial stress tolerance. This research emphasizes the significance of continuing the search for new phages in the agricultural ecosystem to unravel novel ecological diversity and new gene functions. This work contributes to the foundation for future fundamental and applied research on phages infecting phytopathogenic bacteria.

A host range survey of the M strain of plum pox virus in native Asteraceae weeds in Japanese apricot orchards and a possible infection cycle

A host range survey of the M strain of plum pox virus in native Asteraceae weeds in Japanese apricot orchards and a possible infection cycle

Further spread of the invasive apricot aphid Myzus mumecola (Hemiptera: Aphididae) in Central Europe and first insights into its phylogeny

AbstractA new aphid species infesting apricots (Prunus armeniaca L.) was identified for the first time in 2016 in Europe. The invasive aphid was assigned to the species Myzus mumecola (Matsumura, 1917). The species is native to India and East Asia, and it was found to be highly invasive and is currently spreading throughout Europe. Records were confirmed for Italy, Hungary, Serbia, and Germany. For a phylogenetic analysis, wingless (apterae) adults were sampled in spring 2022 in Italy, as well as in Austria and Germany in spring 2023. Our study reports the first record of M. mumecola for Austria. In all three countries, the new pest caused heavy infestations overall in organically managed apricot orchards. Aphids were identified morphologically based on external characteristics, and damages were compared to those reported in the literature. COI and 12S barcoding analyses for aphid samples from Italy, Germany, and Austria were performed to attain a molecular characterization of sampled specimens and to confirm the morphological identification. Only a few COI sequences of M. mumecola were present in NCBI GenBank or BOLD Systems, and no sequences were available for 12S. Therefore, the results provide a deeper insight into the phylogeny of this spreading pest insect. The results of the COI barcoding showed no differences between the sampled populations and other M. mumecola populations from Europe and Japan, while reports from China showed significant differences. All 12S sequences showed no variability between populations from Austria, Germany, and Italy. A phylogenetic analysis of COI and 12S sequences with sequences from other aphid species from NCBI GenBank or sampled in Italy revealed a close relationship of this species with the damson‐hope aphid, Phorodon humuli.

First Report of Neofusicoccum ribis Causing Cankers and Dieback Diseases on Apricot Trees in Canada and Worldwide.

Apricot trees (Prunus armeniaca L.) with cankers, gummosi and dieback symptoms were observed in a commercial orchard in Niagara-on-the-Lake, Ontario, Canada. In October 2018, up to 44.9% disease incidence (n = 318) was observed on 2-year-old 'Harostar™' trees grafted onto 'Haggith' rootstocks. Fungal colonies were consistently isolated and purified from small sections of wood collected from canker margins of symptomatic trunk and shoot tissue, as described by Ilyukhin et al. (2023). Purified mycelial isolates sharing similar morphological characteristics were categorized into five distinct morphotypes. One representative isolate from each morphotype was used to inoculate excised apricot shoots as described by Ilyukhin and Ellouze (2023). One morphotype displayed necrotic lesions on the shoots consistently yielded abundant white aerial mycelium that turned grey-brown on PDA after 7 days (Figure S1) and produced black pycnidia three weeks following incubtion at 22°C in the dark. Conidia were hyaline, one-celled, fusiform, with dimensions of 19.7 - 24.2 × 3.6 - 4.8 μm (average 22.1 × 4.3 μm, n = 30), the typical morphology of a Neofusicoccum sp. (Crous et al. 2006). Species identification was verified by extracting genomic DNA of the representative isolate M1-105, amplifying and sequencing the internal transcribed spacer (ITS), translation elongation factor 1-α (EF1-α) and β-tubulin (TUB2) gene regions with primers ITS1/ITS4, EF1-728F/EF1-986R and Bt2a/Bt2b. Nucleotide sequences (GenBank Accession No. ITS: OK287034; EF1-α: OK346636; TUB2: OK346633) have 100%, 99.61% and 99.55% identity with Neofusicoccum ribis isolates from different hosts and countries (MT587514, DQ235142, OL455952, respectively). Randomized accelerated maximum likelihood analysis (Stamatakis et al. 2008), using ITS, EF1-α and TUB2 sequence data, clustered M1-105 with the highest bootstrap support values with the N. ribis ex-epitype CBS 115475 (Figure S2). A living culture of M1-105 was deposited in the Canadian Collection of Fungal Cultures (DAOMC 252247). Pathogenicity was verified using 5 potted healthy 1-year-old 'Haroblush™' apricot cultivar grafted onto 'Krymsk® 86' rootstocks. Trunks and shoots were inoculated in a shallow wound made by a scalpel with mycelial plugs from a 5-day-old culture of M1-105. Five control trees were inoculated with sterile plugs. Trees were put in an open-air area and watered as needed. Canker symptoms appeared 7 days after inoculation, and spread above and below the inoculation point. Fifteen days post-inoculation, the upper portion of inoculated shoots showed necrosis, gummosis and wilt (Fig. S1). Neofusicoccum ribis was re-isolated from all infected trees and species identity was confirmed by sequencing as described above. Controls remained symptom-free and no fungi were isolated from the wood. Therefore, Koch's postulates were completed. Neofusicoccum ribis was reported to cause branch dieback of olive trees in Spain (Romero et al. 2005) and pistachio in Italy (Corazza et al. 1986), stem blight and dieback of blueberry in Michigan (Heger et al. 2023) and Florida (Wright and Harmon 2010) and postharvest decay of apple fruit from cold storage in Pennsylvania (Jurick et al. 2013). To the best of our knowledge, this is the first report of N. ribis causing canker and shoot dieback of apricot trees in Canada and worldwide. This report reveals N. ribis as a potential threat, causing canker and dieback. Without proper management, it could lead to significant losses in apricot orchards and the stone fruit industry. This study paves the way for crucial research on N. ribis outbreaks and effective disease control.

Phylogeny and taxonomy of five species associated with apricot canker in Beijing, China

AbstractApricot (Prunus armeniaca) is an economically important fruit tree in Beijing, China. However, canker diseases have become one of the main threats to apricot production. In the present study, a field survey was conducted in apricot orchards in Beijing and the disease incidence of apricots was surveyed (75.7%). Thirty fungal strains were isolated from branches of apricots. Five species were identified through multilocus phylogenetic (rDNA internal transcribed spacer [ITS], large subunit [LSU] and tef1‐a for Botryosphaeriales; ITS, act, rpb2, tef1‐a and tub2 for Cytospora) and morphological analyses, including two new species (Cytospora huairouensis and C. prunina) and three known species (C. leucostoma, Diplodia gallae and Phaeobotryon rhois). C. leucostoma and P. rhois were identified as the causal agents of canker of apricot by pathogenicity tests conducted on 3‐year‐old plants in the greenhouse. The current study contributed to a theoretical basis for predicting the potential risk of apricot canker in Beijing, China.

Accuracy evaluation of ET and its components from three remote sensing ET models and one process based hydrological model using ground measured eddy covariance and sap flow

Evapotranspiration (ET) and its components, transpiration (T) and soil evaporation (Es) are crucial to understand hydrological cycle and effective water loss in water resource management. Remote sensing models and process based hydrological models are two kinds of effective methods for evaluating ET and its partitions. Although the ability of remote sensing models to simulate ET has been widely verified, there is limited verification of ET components, especially T, which is the major component of ET. This research used ET obtained from eddy covariance system and T obtained from sap flow observation in an apricot orchard of north China to evaluate the accuracy of ET and its components from three remote sensing models (PT-JPL, PML, and SWH) and a process-based hydrological model (SHAW). The results showed that after calibrations, all the four models satisfactorily simulated total ET particularly at annual level. Among them, the PML model had the best fit efficiency, with the most satisfied R2 and NSE values. The PT-JPL estimated average ET was the most accurate, with the slope nearest to 1.0. While for the simulation of T, SHAW model had a better performance owing to the fact that SHAW model simulate plant transpiration using changes in soil water content. The average T/ET of the models for the growing season was close to the observed value of 0.70, except that the T/ET of SWH is high due to the lack of Ei calculation. Furthermore, nearly all the three remote sensing models underestimated ET in the dry spring and overestimated ET in the rainy summer. In comparison with the process-based SHAW model, it is suggested that remote sensing ET relies more heavily on the seasonal change of meteorological factors such as precipitation but less capable in reflecting the gradually delaying process of soil moisture in the dry season. Therefore, it is indicated that for future improvement of remote sensing ET models, adjustment of soil water availability in a much longer term is suggested at least for semi-humid and semi-arid ecosystems.

Characterization of causal agents of bacterial canker on apricot plantations and risk mapping using GIS in Aras Basin (Türkiye)

AbstractBacterial canker of stone fruits caused by Pseudomonas syringae pv. syringae (Pss) and Pseudomonas syringae pv. morsprunorum (Psm race‐1/Psm race‐2) may lead to significant yield and crop losses in apricot (Prunus armeniaca L.) cultivation areas in Türkiye. Strains pathogenic to apricot were isolated from trees with symptoms (mainly necrotized buds and dieback) of bacterial canker in orchards in Aras Basin. Pathogens were characterized using pathogenicity tests, phenotypic assays, end‐point PCR and multilocus sequence analysis (MLSA). Fifteen Pseudomonas syringae strains were isolated from 205 plant samples collected from apricot orchards showing symptoms of bacterial canker. As a consequence of the diagnostic tests, all isolates were identified as P. syringae pv. syringae. In this study, Pss, Psm R1 and Psm R2 strains in stone fruits were separated into different phylogroups (Pg‐2, Pg‐3, sPg‐1b) based on MLSA. Turkish strains obtained from stone fruits, particularly apricot, showed genetic heterogeneity, and clustered in different sub‐phylogroups (sPg‐2b, sPg‐2c, sPg‐2d). All these strains except strain K258 are also clustered in the same sub‐phylogroups (sPg‐2b and sPg‐2d) with other strains from different countries especially Iran, Lebanon, etc. Strain K258 isolated from apricot was clustered in sPg‐2c with Pss strain 642 (USA). The risk of bacterial canker disease in apricot growing areas is considered using GIS in this study. It was determined that a significant part of the Iğdır Plain, the biggest agricultural area in the Aras Basin, is at very high risk.

First report of the plum marbling disease associated agent, plum viroid I, in apricots (Prunus armeniaca) in South Africa.

Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.

Protecting Apricot Orchards with Rain Shelters Reduces Twig Blight Damage Caused by Monilinia spp. and Makes It Possible to Reduce Fungicide Use

Blossom and twig blight, caused by Monilinia spp., is the main disease in apricot trees. In this study, we installed transparent rain shelters in apricot orchards to study their influence on the modification of the microclimate at the level of the tree canopy and on the reduction in moniliosis damage in twigs. Rain shelters significantly reduced the leaf wetness time measured within the foliage compared to the unsheltered trees (a reduction of between 43% and 67%). However, very few differences were observed in the daily averaged air temperature (up to 6%) and daily averaged air relative humidity (up to 1%). In the first experiment, on the apricot variety Bergarouge® (CEP Innovation, Lyon, France), moniliosis damage on twigs in the absence of phytosanitary protection was reduced by up to 62% for the trees provided with rain protection compared to the trees that did not receive rain shelters. A second experiment, involving five apricot tree varieties, made it possible to verify that fungicide protection could be reduced for the trees protected by rain covers, reducing moniliosis damage on twigs compared to full fungicide protection combined without rain protection. Finally, a third experiment comprising two apricot tree varieties has shown that in organic orchards, rain protection provides protection against moniliosis (twig blight) that is equivalent to an organic farming fungicide protection programme based on the use of copper sulphate and calcium polysulphide.

Spatial distribution and risk associated with shot hole disease in apricot (Prunus armeniaca L.) in Northern Pakistan

Wilsonomyces carpophilus is the major fungus that produces shot hole disease (SHD) in apricots, which results in significant economic losses. This problem can be addressed through the monitoring of the diseases and spotlighting the risks connected with them. This study employed descriptive and geostatistical mapping techniques to track the spatial distribution and risk of SHD in apricot orchards in five apricot-growing valleys. The results showed a spatial distribution of the disease within the study area even varying within the valleys and orchards. A moderate spatial dependence of SHD prevalence (0.524), incidence (0.363), and severity index (0.313) were observed. GIS maps and trend analysis graphs also showed the spatial distribution of the disease from east-west and south-north directions. Climate and cultural practices favor the perpetuation of pathogens and the spread of SHD. This information will help apricot growers regarding disease management and improve sustainable profitability.

Water Cooperation and Ideology in Local Communities

This article addresses how ideology affects local water governance, focusing on a groundwater basin in central Iran. It offers a case study of a symbiotic relationship between upstream and downstream communities, allowing a sustainable form of water governance. The cooler weather, better pastures and greater amount of precipitation of the basin upstream drew nomadic communities, whose economy was not dependent on irrigation. Downstream, fertile soil and warm weather favored agriculture with a high demand for water that was supplied by the groundwater transferred from the basin upstream. The exchange of livestock products and agricultural goods between the basin’s upstream and downstream areas systematically tied their economic systems. However, Iran’s 1979 revolution brought a hybrid leftist-Islamist ideology that unbalanced this traditional relationship through the reorganization of geographical space. The upstream communities were encouraged to cultivate their pastures, which led to a boom in the number of irrigation wells. The downstream villages were persuaded to adopt a new cropping pattern that turned most of their water-efficient vineyards into apricot orchards with high water demands. Therefore, an abrupt increase in water demand in the basin upstream and downstream thwarted the cooperation between the two areas and drove the basin into “the tragedy of the unmanaged commons.”

Assessment of macronutrients status using digital soil mapping techniques: a case study in Maru'ak area in Lorestan Province, Iran.

The present study was conducted to compare generalized linear model (GLM), random forest (RF), and Cubist to produce available phosphorus (AP) and potassium (AK) maps and to identify the covariates that control mineral distribution in Lorestan Province, Iran. To this end, the locations for collecting 173 soil samples were determined through the conditioned Latin hypercube sampling (cLHS) method, at four different land-uses (orchards, paddy fields, agricultural, and abandoned fields). The performance of the models was assessed by coefficient of determination (R2), root-mean-square error (RMSE), and mean absolute error (MAE) indices. The results showed that the RF model fitted better than GLM and Cubist models and could explain 40 and 57% of AP and AK distribution, respectively. The R2, RMSE, and MAE of the RF model were 0.4, 2.81, and 2.43 for predicting AP and equal to 0.57, 143.77, and 116.61 for predicting AK, respectively. The most important predictors selected by the RF model were valley depth and soil-adjusted vegetation index (SAVI) for AP and AK, respectively. The maps showed higher AP and AK content in apricot orchards compared to other land-uses. No difference was observed between AP and AK content on paddy fields, agricultural, and abandoned areas. The higher AP and AK contents were related to orchard management practices, such as failure to dispose of plant residuals and fertilizer consumption. It can be concluded that the orchards (by increasing soil quality) was the best land-use in line with sustainable management for the study area. However, generalizing the results needs more detailed research.

Variability and chemical composition of the extractive content of woody residues from three European orchard species: apricot (Prunus Armeniaca L.), olive (Olea Europea L.), and orange trees (Citrus Sinensis L.)

AbstractBackgroundThe huge quantity of agricultural biomass has led Europe to issue directives to ensure that it is properly managed. Among the permanent European crops area, olive, orange, and apricot orchards are the most present. The management of these crops produces significant amounts of biomass, which very often is burned in the field. With a view to the circular economy, this study aims to analyze the secondary metabolites present in the biomass of these three crops.ResultsSecondary metabolites were extracted from wood and bark by an Accelerated Solvent Extractor at 120° using water, ethanol, and a mixture of water and ethanol as solvents. In addition, the identification of the molecules present in the extracts was attempted using high‐performance liquid chromatography (HPLC) coupled with a mass spectrometer (MS). The analysis showed that in the three crops, the highest yields of extract were measured in the bark while the species that has shown the highest yield compared to the others was the olive tree. HPLC–MS technique revealed interesting molecular compounds, such as catechins, epicatechins, and oleuropein, respectively in the apricot and olive extracts.ConclusionThe biomass extractives of these three species highlighted an interesting potential for applications in various industrial sectors such as for example, pharmaceutical, nutraceutical, and agriculture.

Brassica plants promote Apis mellifera visitation to Japanese apricot in cold conditions

Floral resource enhancements are widely used to boost insect pollination in various crops. The Japanese apricot, a winter-flowering fruit crop, requires mid-winter pollination. However, cold weather can restrict pollinator activity. In this study, we explored the use of Brassica plants, which bloom fully during the Japanese apricot blossom period, as additional flower resources to promote honey bee visitation. We sowed Brassica rapa and used existing feral Brassica plants as additional floral resources to compare the honey bee visitation frequency, visitation behavior, and the number of pollen grains on the stigmas of Japanese apricot flowers with those of the control group. The visitation of the managed honey bee (Apis mellifera) to the Japanese apricot flowers was studied at temperatures below 15 ºC. Under such cold conditions, Brassica flowers increased A. mellifera visitation in both the experimental and commercial orchards. Brassica-rich orchards exhibited clear positive effects of flower resources. Observations of flower-visiting behavior and pollen grains on the stigmas suggest that the increased honey bee visitation to Japanese apricot flowers was not caused by spillover from the Brassica flowers. The flower resources did not increase the number of pollen grains on the Japanese apricot stigmas irrespective of the increase in the number of honey bee visits. Fruit production instability caused by cold weather is a major issue in the agricultural management of commercially cultivated Japanese apricot. The findings suggest that Brassica plants can solve pollination-related problems in Japanese apricot orchards. In addition, Brassica plants are easy to grow, do not have common pests with Japanese apricot, and are beneficial for both apiarists and farmers. Therefore, Brassica plants are a promising floral resource for use in Japanese apricot orchards.

Detection of ‘Candidatus Phythoplasma prunorum’ in Apricot Trees and its Associated Psyllid Samples

‘Candidatus Phytoplasma prunorum’ is causing ever increasing economic losses through the decline of apricot trees in European countries, e.g., Hungary. In this study, the pathogen was identified from plant tissues and insects by nested-PCR. The insect species were identified via morphology and molecular methods. The incidence of the pathogen was 29.6% in randomly selected apricot trees. Most of the infected trees with symptoms died within a year. These results show that phytoplasma is significantly present and causes damage in the investigated plantations. The only known insect vector of this phytoplasma is the plum psyllid, Cacopsylla pruni, which was regularly encountered in the sampled apricot orchards and in their surroundings. In a two-year study, several adults among the sampled specimens were observed to be infected by the pathogen. This observation further confirms the role of the plum psyllid in vectoring the phytoplasma. All the sampled plum psyllid adults belonged to the ‘B’ biotype. Besides C. pruni, Cacopsylla crataegi was abundant in the samples. Several adults of the latter species were also infected by the pathogen ‘Ca. Phytoplasma prunorum’. The rates of occurrence of this phytoplasma in male and female adults of the two psyllid species appeared to be similar. The examined C. crataegi individuals showed genetic differences from each other and from specimens included in a previous investigation.

Geostatistical Analysis of Apricot Shot Hole Disease and Influence Factors in District Nagar, Gilgit-Baltistan, Pakistan

Apricot (Prunus armeniaca L.) is the most common, high-income generative fruit and consequently plays an important part in the region's socio-economic growth. However, apricots are susceptible to several diseases and pests that cause lower yields and significant financial losses, including apricot shot hole disease brought on by Wilsonomyces carpophilus, a polyphagous fungus, creates a serious threat to stone fruits, particularly the apricot tree. The current study used descriptive statistics and geostatistical approaches to evaluate the geographical distribution of the apricot shot hole disease (5 valleys, 30 orchards, and 480 apricot trees) in district Nagar, Gilgit-Baltistan, Pakistan. From each apricot tree, 150 apricot fruits, a total of 72,000, were randomly selected to assess the incidence, disease index, and severity. Results revealed that the disease is spatially distributed within the study area, varying within valleys and orchards. The range of disease prevalence was 50.0-67.70%, incidence 56.97-64.01%, index 32.49-40.56% and mean severity 0.21-0.24%. Geostatistical techniques were used to predict the spatial dependency class. Results revealed that disease prevalence had a nugget/sill ratio of 0.915, inferring weak spatial dependence, whereas incidence, disease index, and severity inferred moderate spatial dependence with nugget/sill ratios of 0.479, 0.628, and 0.393, respectively. Moreover, the spherical semivariogram model, trend analysis graph, and GIS maps indicate the region's spatial distribution of apricot shot hole disease. This information linked to metrological data (temperature, precipitation, and relative humidity) seemingly favored the apricot shot hole disease development during the growing period. Evaluation of geostatistical mapping strategies in monitoring spatial distributions of apricot shot hole disease in a field setting will improve the decision support for disease management, selection of resistant variety, and improve sanitation condition of apricot orchards. Continuous climate and pest monitoring are essential for creating an efficient disease warning system for farmers and other organizations involved in agriculture to prevent future plant epidemics.

Could an Early Treatment with GA and BA Impact Prolonged Cold Storage and Shelf Life of Apricot?

Application of plant growth regulators (PGRs) in apricot orchards is a common practice with a goal of improving yield and/or quality of fruits at harvest. However, the question of whether such treatment alters postharvest properties is seldom answered. The effects of an early application of PGRs on postharvest changes on apricots were investigated on cultivar NS-4, grown on Myrobalan rootstock with blackthorn interstock in a 5-year-old orchard. PGR treatments included 50 and 100 ppm of benzyladenine (BA) and 200 ppm of gibberellic acid (GA3), which were applied when the green ovary was surrounded by dying a sepal crown, at the stage where sepals beginning to fall. Apricots at the stage of commercial ripeness were used for the postharvest experiments. Analysis was performed at harvest, after 21 days of cold storage (at 1 ± 1 °C and 80 ± 10% RH), and after 3 days of shelf life (24 ± 2 °C). At harvest, significant differences were observed between treated and untreated fruits regarding flesh firmness, color, ethylene production and respiration rate, flavonoid, carotenoid and citric acid content, while application of BA100 changed TA and TSS. Prolonged cold storage reduced the initial differences in firmness, respiration rate, flavonoid and carotenoid contents, but new differences in fructose, malic and succinic acid contents began to appear. Shelf life reduced the difference in citric acid, but differences in TA, TSS, phenol and flavonoid content appeared. There is no difference in the sensory properties of treated and non-treated fruit after cold storage and shelf life.

Cacopsyllapruni (Hemiptera, Psyllidae) in an apricot orchard is more attracted to white sticky traps dependent on host phenology.

The colour preference of the plum psyllid, Cacopsyllapruni (Hemiptera, Psyllidae), is yet poorly studied. This species is the only known vector of the 'Candidatus Phytoplasma prunorum', the agent of European stone fruit yellows (ESFY), a devastating disease of several cultivated Prunus species in Europe. As ESFY is still uncurable, vector control, thus vector monitoring, is pivotal to protect these trees. Cacopsyllapruni is a univoltine, host-shelter-alternating species; overwintered adults migrate from conifer to wild or cultivated Prunus species (family Rosaceae) in late winter-early spring. To select the most effective colour indicating the arrivals of the immigrants, yellow, fluorescent yellow, white, red and transparent sticky traps were deployed in an apricot orchard in Hungary. The two most abundant species in sticky traps were C.pruni and C.melanoneura. Catches of white traps were significantly biased towards C.pruni as compared to C.melanoneura specimens. Moreover, white sticky traps were better at catching plum psyllids than the other colours. Attraction to white was strongest when immigrants from shelter plants kept arriving in the orchard, coinciding with the blooming principal phenophase of apricot trees. When the host flowering growth stage was over, catches of C.pruni in white traps declined sharply to the level of yellow traps that was highest during this post-blooming period. We recommended white sticky traps for promptly monitoring C.pruni in apricot orchards because it is more potent and more selective than yellow ones during the critically important early flowering interval.

Ecological potential assessment and land use area estimation of agricultural lands based on multi-time images of Sentinel-2 using ANP-WLC and GIS in Bastam, Iran.

The use of land-based ecological potential is a key management factor in achieving sustainable development and conserving soil and water resources. The purpose of this study is to use multi-time images of Sentinel-2 to determine the area of agricultural lands and evaluate their ecological potential in Bastam, Semnan Province, Iran. Therefore, in the first step, the most common agricultural lands (including apricot and grape orchards), field crops (including wheat and forage maize), and their phenological period were determined. Then, the information was classified using, namely support vector machine, maximum likelihood, and minimum distance. In the next step, soil, topography, and climate data were extracted according to expert opinions and the analysis of the basin's natural potential. The ecological evaluation models of the region were applied to homogeneous units, and after calculating the ecological potential index by the integrated ANP-WLC model, the ecological potential map was generated. The results of the land use classification showed that the support vector machine model and the minimum distance, respectively, had the best and worst performance with kappa coefficient of 0.82 and 0.61. The highest area of cultivated lands (3423 hectares) was estimated for wheat and the lowest (738 hectares) for forage maize. Moreover, the results of the ecological potential evaluation showed that 60% of apricot orchards, and 40.19% of the wheat fields, were in the class of good ecological potential. Overall, 2290 hectares were in the poor class, and 4030 hectares in the excellent class in terms of ecological potential.