Apple Latent Spherical Virus Research Articles

A novel and efficient Apple latent spherical virus-based gene silencing method for functional genomic studies in Chenopodium quinoa

Quinoa (Chenopodium quinoa Willd.), with its resilience in harsh environments and excellent nutritional value, has become crucial for global food security. Despite recent progress in genomic research, the inability to perform functional studies in quinoa due to the absence of transformation techniques remains a significant obstacle. In this work, we present the development of a novel Apple Latent Spherical Virus (ALSV)-mediated virus-induced gene silencing (VIGS) protocol that will allow to perform functional genomics studies in quinoa in a fast and simple way. The method was fine-tuned using ALSV plasmids that carry partial gene sequences of phytoene desaturase (PDS) from Nicotiana benthamiana and quinoa. The developed technique involves an initial inoculation in Nicotiana plants through agroinfiltration with Agrobacterium tumefaciens cultures carrying the different viral constructs. Viral extracts were prepared using local or systemic leaves, which were then used as inoculum to infect quinoa leaves through mechanical damage. The method was successfully tested in two contrasting quinoa varieties, although some differences were observed in infection phenotype and viral susceptibility. The effect of insertion sequence size in the viral vectors was also analyzed, resulting in differences in bleaching or chlorosis phenotype and impact on plant growth. The presence of the virus in inoculated plants was confirmed, and the reduction in PDS gene expression in silenced plants was verified. Because quinoa lacks stable transformation protocols, limiting heterologous expression assays, our ALSV-based VIGS protocol is very attractive for loss-of-function gene studies.

The Resistance of Soybean Variety Heinong 84 to Apple Latent Spherical Virus Is Controlled by Two Genetic Loci.

Apple latent spherical virus (ALSV) is widely used as a virus-induced gene silencing (VIGS) vector for function genome study. However, the application of ALSV to soybeans is limited by the resistance of many varieties. In this study, the genetic locus linked to the resistance of a resistant soybean variety Heinong 84 was mapped by high-throughput sequencing-based bulk segregation analysis (HTS-BSA) using a hybrid population crossed from Heinong 84 and a susceptible variety, Zhonghuang 13. The results showed that the resistance of Heinong 84 to ALSV is controlled by two genetic loci located on chromosomes 2 and 11, respectively. Cleaved amplified polymorphic sequence (CAPS) markers were developed for identification and genotyping. Inheritance and biochemical analyses suggest that the resistance locus on chromosome 2 plays a dominant dose-dependent role, while the other locus contributes a secondary role in resisting ALSV. The resistance locus on chromosome 2 might encode a protein that can directly inhibit viral proliferation, while the secondary resistance locus on chromosome 11 may encode a host factor required for viral proliferation. Together, these data reveal novel insights on the resistance mechanism of Heinong 84 to ALSV, which will benefit the application of ALSV as a VIGS vector.

Rapid detection of apple latent spherical virus infecting Angelica sinensis by gold immunochromatography reverse transcription loop-mediated isothermal amplification assay

Apple latent spherical virus (ALSV; genus: Cheravirus, family: Secoviridae) is capable of infecting Angelica sinensis under natural conditions and causing symptoms of greenish discoloration and mottling, affecting plant growth and causing a reduction in root quality and yield. Virus detection of ALSV is an urgent need for the continued development of angelica industry. Consequently, it is necessary to develop simple, sensitive, and reliable ALSV detection methods. We describe the preparation of polyclonal antibodies with high titer and high specificity using recombinant ALSV coat protein (CP) as the antigen. Using these antibodies, we established and optimized a rapid detection system using colloidal gold immunochromatography assay (GICA) to detect ALSV. A real-time reverse transcription loop-mediated isothermal amplification (RT-LAMP) system with a minimum detection line of 2.72 × 103copys/μl was also developed to detect ALSV. This assay was further enhanced using a combination GICA-RT-LAMP assay. This GICA assay successfully detected ALSV in infected plants without cross reactivity recorded from three other plant viruses. The sensitivity of GICA was the same as that of GICA-RT-PCR, whereas the sensitivity of GICA-RT-LAMP was at least 10-fold higher than that of GICA and GICA-RT-PCR. These methods can detect and identify ALSV under field conditions and accurately measure virus concentration in the laboratory.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

A fast and efficient method to introduce apple latent spherical virus to legume plants via Agrobacterium rhizogenes‐mediated transformation of hairy roots

AbstractVirus‐induced gene silencing (VIGS) is a functional genomics tool used to determine the function of unknown genes or assess the impact of gene silencing on plant phenotype. However, VIGS methods for analyzing gene function are not equally efficient across species, and virus inoculation is difficult for some legume species. We describe a fast and efficient inoculation method using Agrobacterium rhizogenes K599 harboring an apple latent spherical virus (ALSV) full‐length cDNA clone. Pisum sativum cv. AAC Lacombe and Lens culinaris cv. CDC Viceroy showed silencing rates of 100% and 47.7%, respectively, within 30 days starting from seed. To our knowledge, this is the first report of virus inoculation by A. rhizogenes‐mediated introduction to legume plants. This work paves the way for high throughput gene function screening in Pisum sativum and other closely related legume crops using ALSV as a symptomless VIGS vector.

Novel Functional Analysis for Pathogenic Proteins of Bursaphelenchus xylophilus in Pine Seed Embryos Using a Virus Vector.

Pine wilt disease (PWD), which is caused by the pine wood nematode Bursaphelenchus xylophilus, is among the most serious tree diseases worldwide. PWD is thought to be initiated by sequential excessive hypersensitive responses to B. xylophilus. Previous studies have reported candidate pathogenic molecules inducing hypersensitive responses in pine trees susceptible to B. xylophilus. The functions of some of these molecules have been analyzed in model plants using transient overexpression; however, whether they can induce hypersensitive responses in natural host pines remains unclear due to the lack of a suitable functional analysis method. In this study, we established a novel functional analysis method for susceptible black pine (Pinus thunbergii) seed embryos using transient overexpression by the Apple latent spherical virus vector and investigated five secreted proteins of B. xylophilus causing cell death in tobacco to determine whether they induce hypersensitive responses in pine. We found that three of five molecules induced significantly higher expression in pathogenesis-related genes ( p < 0.05), indicating hypersensitive response in pine seed embryos compared with mock and green fluorescence protein controls. This result suggests that tobacco-based screening may detect false positives. This study is the first to analyze the function of pathogenic candidate molecules of B. xylophilus in natural host pines using exogenous gene expression, which is anticipated to be a powerful tool for investigating the PWD mechanism.

Efficient virus-induced gene silencing system in pumpkin (Cucurbita maxima) using apple latent spherical virus vector

Crude-sap of apple latent spherical virus (ALSV)-infected Chenopodium quinoa leaves was rub-inoculated on the expanded cotyledons of various Cucurbitaceae plants. Most of the species were systemically infected with the virus without obvious symptoms, except pumpkin (Cucurbita maxima). In pumpkin, the ALSV infection was restricted to inoculated cotyledons; it did not spread to the upper true leaves. In situ hybridization showed that the ALSV was confined to part of the cotyledon tissues and it did not invade the phloem tissue, when inoculated at the expanded cotyledon stage. However, when total RNAs from ALSV-infected C. quinoa leaves were inoculated into the cotyledons immediately after germination (folded cotyledon stage) using particle bombardment, ALSV efficiently caused systemic infection. Systemic infection of pumpkin seedlings occurred only when the cotyledons were inoculated within a few days after germination. No systemic infection was observed in the seedlings 4 days after germination. In the grafting test, ALSV was not transmitted from the infected rootstocks to the healthy scions of pumpkins. An efficient virus-induced gene silencing system for pumpkins was established, in which infection with ALSV vectors harboring the phytoene desaturase or sulfur gene fragments resulted in a uniform phenotype in the true leaves of pumpkin seedlings.

Development and application of a virus-induced gene silencing protocol for the study of gene function in narrow-leafed lupin

BackgroundLupins are promising protein crops with an increasing amount of genomic and transcriptomic resources. The new resources facilitate the in silico identification of candidate genes controlling important agronomic traits. However, a major bottleneck for lupin research and crop improvement is the in planta characterization of gene function. Here, we present an efficient protocol for virus-induced gene silencing (VIGS) to down-regulate endogenous genes in narrow-leafed lupin (NLL) using the apple latent spherical virus (ALSV).ResultsWe identified ALSV as an appropriate VIGS vector able to infect NLL without causing a discernible phenotype. We created improved ALSV vectors to allow for efficient cloning of gene fragments into the viral genome and for easier viral propagation via agroinfiltration of Nicotiana benthamiana. Using this system, we silenced the visual marker gene phytoene desaturase (PDS), which resulted in systemic, homogenous silencing as indicated by bleaching of newly produced tissues. Furthermore, by silencing lysine decarboxylase (LaLDC)—a gene likely to be involved in toxic alkaloid biosynthesis—we demonstrate the applicability of our VIGS method to silence a target gene alone or alongside PDS in a ‘PDS co-silencing’ approach. The co-silencing approach allows the visual identification of tissues where silencing is actively occurring, which eases tissue harvesting and downstream analysis, and is useful where the trait under study is not affected by PDS silencing. Silencing LaLDC resulted in a ~ 61% or ~ 67% decrease in transcript level, depending on whether LaLDC was silenced alone or alongside PDS. Overall, the silencing of LaLDC resulted in reduced alkaloid levels, providing direct evidence of its involvement in alkaloid biosynthesis in NLL.ConclusionsWe provide a rapid and efficient VIGS method for validating gene function in NLL. This will accelerate the research and improvement of this underutilized crop.

Development of a Csy4-processed guide RNA delivery system with soybean-infecting virus ALSV for genome editing

BackgroundA key issue for implementation of CRISPR-Cas9 genome editing for plant trait improvement and gene function analysis is to efficiently deliver the components, including guide RNAs (gRNAs) and Cas9, into plants. Plant virus-based gRNA delivery strategy has proven to be an important tool for genome editing. However, its application in soybean which is an important crop has not been reported yet. ALSV (apple latent spherical virus) is highly infectious virus and could be explored for delivering elements for genome editing.ResultsTo develop a ALSV-based gRNA delivery system, the Cas9-based Csy4-processed ALSV Carry (CCAC) system was developed. In this system, we engineered the soybean-infecting ALSV to carry and deliver gRNA(s). The endoribonuclease Csy4 effectively releases gRNAs that function efficiently in Cas9-mediated genome editing. Genome editing of endogenous phytoene desaturase (PDS) loci and exogenous 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) sequence in Nicotiana. benthamiana (N. benthamiana) through CCAC was confirmed using Sanger sequencing. Furthermore, CCAC-induced mutagenesis in two soybean endogenous GW2 paralogs was detected.ConclusionsWith the aid of the CCAC system, the target-specific gRNA(s) can be easily manipulated and efficiently delivered into soybean plant cells by viral infection. This is the first virus-based gRNA delivery system for soybean for genome editing and can be used for gene function study and trait improvement.

Virus-Mediated Transient Expression Techniques Enable Functional Genomics Studies and Modulations of Betalain Biosynthesis and Plant Height in Quinoa.

Quinoa (Chenopodium quinoa), native to the Andean region of South America, has been recognized as a potentially important crop in terms of global food and nutrition security since it can thrive in harsh environments and has an excellent nutritional profile. Even though challenges of analyzing the complex and heterogeneous allotetraploid genome of quinoa have recently been overcome, with the whole genome-sequencing of quinoa and the creation of genotyped inbred lines, the lack of technology to analyze gene function in planta is a major limiting factor in quinoa research. Here, we demonstrate that two virus-mediated transient expression techniques, virus-induced gene silencing (VIGS) and virus-mediated overexpression (VOX), can be used in quinoa. We show that apple latent spherical virus (ALSV) can induce gene silencing of quinoa phytoene desaturase (CqPDS1) in a broad range of quinoa inbred lines derived from the northern and southern highland and lowland sub-populations. In addition, we show that ALSV can be used as a VOX vector in roots. Our data also indicate that silencing a quinoa 3,4-dihydroxyphenylalanine 4,5-dioxygenase gene (CqDODA1) or a cytochrome P450 enzyme gene (CqCYP76AD1) inhibits betalain production and that knockdown of a reduced-height gene homolog (CqRHT1) causes an overgrowth phenotype in quinoa. Moreover, we show that ALSV can be transmitted to the progeny of quinoa plants. Thus, our findings enable functional genomics in quinoa, ushering in a new era of quinoa research.

Apple latent spherical virus structure with stable capsid frame supports quasi-stable protrusions expediting genome release

Picorna-like plant viruses are non-enveloped RNA spherical viruses of ~30 nm. Part of the survival of these viruses depends on their capsid being stable enough to harbour the viral genome and yet malleable enough to allow its release. However, molecular mechanisms remain obscure. Here, we report a structure of a picorna-like plant virus, apple latent spherical virus, at 2.87 Å resolution by single-particle cryo-electron microscopy (cryo-EM) with a cold-field emission beam. The cryo-EM map reveals a unique structure composed of three capsid proteins Vp25, Vp20, and Vp24. Strikingly Vp25 has a long N-terminal extension, which substantially stabilises the capsid frame of Vp25 and Vp20 subunits. Cryo-EM images also resolve RNA genome leaking from a pentameric protrusion of Vp24 subunits. The structures and observations suggest that genome release occurs through occasional opening of the Vp24 subunits, possibly suppressed to a low frequency by the rigid frame of the other subunits.

Apple latent spherical virus (ALSV)-induced gene silencing in a medicinal plant, Lithospermum erythrorhizon

Lithospermum erythrorhizon is a medicinal plant that produces shikonin, a red lipophilic naphthoquinone derivative that accumulates exclusively in roots. The biosynthetic steps required to complete the naphthalene ring of shikonin and its mechanism of secretion remain unclear. Multiple omics studies identified several candidate genes involved in shikonin production. The functions of these genes can be evaluated using virus-induced gene silencing (VIGS) systems, which have been shown advantageous in introducing iRNA genes into non-model plants. This study describes the development of a VIGS system using an apple latent spherical virus (ALSV) vector and a target gene, phytoene desaturase (LePDS1). Virus particles packaged in Nicotiana benthamiana were inoculated into L. erythrorhizon seedlings, yielding new leaves with albino phenotype but without disease symptoms. The levels of LePDS1 mRNAs were significantly lower in the albino plants than in mock control or escape plants. Virus-derived mRNA was detected in infected plants but not in escape and mock plants. Quantitative PCR and deep sequencing analysis indicated that transcription of another hypothetical PDS gene (LePDS2) also decreased in the defective leaves. Virus infection, however, had no effect on shikonin production. These results suggest that virus-based genetic transformation and the VIGS system silence target genes in soil-grown L. erythrorhizon.

Development of a Virus-Induced Gene Silencing System for Dioecious Coccinia grandis.

Coccinia grandis is an interesting model system to understand dioecy in Cucurbitaceae family. Recent transcriptomics and proteomics studies carried out to understand the sex expression in C. grandis have resulted in identification of many candidate sex-biased genes. In absence of an efficient genetic transformation protocol for C. grandis, virus-induced gene silencing (VIGS) would be a powerful tool to enable gene functional analysis. In current study, we explored the apple latent spherical virus (ALSV) for gene knockdown in C. grandis. The viral infection was achieved through mechanical inoculation of ALSV-infected Chenopodium quinoa leaf extract onto the cotyledons of C. grandis. ALSV-VIGS mediated knockdown of CgPDS gene was successfully achieved in C. grandis by mechanical inoculation method resulting in characteristic photobleaching. Subsequently, we developed agroinfiltration compatible vectors for direct infection of C. grandis and shortened the time-frame by skipping viral propagation in C. quinoa. Typical yellow-leaf phenotype was observed in C. grandis plants agroinfiltrated with ALSV-CgSU constructs, indicating robust silencing of CgSU gene. In addition, we improved the infection efficiency of ALSV by co-infiltration of P19 viral silencing suppressor. These results suggest that ALSV-VIGS is suitable for characterization of gene function in dioecious C. grandis and it can help us understand the mechanism of sex expression.

First Report of Malus domestica Virus A Infecting an Apple Tree in South Korea

Apple (Malus domestica) is economically important and widely grown in South Korea. Many viruses and viroids infect apple trees, reducing the productivity of orchards (Baek et al. 2019; James et al. 2013). Apple stem grooving virus (ASGV), apple mosaic virus (ApMV), apple latent spherical virus (ALSV), apple chlorotic leaf spot virus (ACLSV), apple green crinkle associated virus (AGCaV), apple stem pitting virus (ASPV), and apple scar skin viroid (ASSVd) are the major viral pathogens that infect apple (Cho et al. 2016). Malus domestica virus A (MdoVA), a putative member of Velarivirus (Closteroviridae), has been identified from an apple tree in the Czech Republic (Koloniuk et al. 2019; Rubio et al. 2013). From August to September 2018, 11 asymptomatic and 11 symptomatic apple leaf samples showing mild mosaic symptoms, necrotic leaf spots, mottling, leaf distortion, or yellowing were collected from Uiseong (n = 4; cv. Fuji), Yeongcheon (n = 4; cv. Hongro), and Jangsu (n = 14; Fuji = 8 and Hongro = 6). Total RNA was extracted from two symptomatic and two asymptomatic samples using a HiYield Total RNA Mini Kit (Plant; RBC Bioscience). Four cDNA libraries were constructed and sequenced by the Illumina HiSeq4000 system at Macrogen. A total of 219,160,492 paired-end raw reads were generated from the four libraries with the Illumina HiSeq4000 sequencer. The raw reads were quality-trimmed and assembled into 387,422 contigs of 201 to 16,053 nt using Trinity v2.1.1 software. BLASTn analysis of the contigs indicated that the selected samples were infected with several apple viruses, including ASPV, ASGV, ACLSV, AGCaV, and apple hammerhead viroid (AHVd). A BLASTn search of the obtained contigs also detected seven contigs (741 to 5,138 nt) related to MdoVA (GenBank MN548734). The nucleotide (nt) similarities between these contigs and the MdoVA reference sequence were 88.1 to 93.9%. Specific primer sets (i.e., MdoVA-SK_F3 [nt position 2,496 to 2,515]: 5′-GTTGGCTCATGACAGTTTGC-3′; MdoVA-SK_R3 [3,722 to 3,741]: 5′-GGATGTGGTAAGGTAGTACA-3′; MdoVA-SK_F9 [9,269 to 9,288]: 5′-GTACATGAGGACTATCCTCG-3′; and MdoVA-SK_R9 [10,464 to 10,483]: TCTGACTTTCCTGAGGAACC-3′) were designed to confirm the presence of MdoVA in some of the apple leaf samples. Total RNA was extracted from the 22 samples individually and subjected to RT-PCR using SuPrimeScript RT-PCR Premix (GeNet Bio) with MdoVA-specific primers. The expected fragments of 1,246 and 1,215 bp were only detected in the sole asymptomatic Fuji sample that was included for high-throughput sequencing, suggesting that the virus was not associated with any of the symptoms observed. This sample was used to determine the complete genome sequence of this South Korea MdoVA isolate (MdoVA-SK). Specific primer sets were designed based on the seven contig sequences. All designed primer pairs successfully produced overlapping RT-PCR fragments of the expected size from the sample. PCR products were purified with an AccuPrep PCR Purification Kit (BIONEER) and cloned into an RBC TA cloning vector (RBC Bioscience). At least four clones of each fragment were Sanger sequenced. The obtained overlapping sequences were consistent with the original assembled contigs from paired-end RNA sequencing. The 5′- and 3′-terminal sequences were obtained using a 5′- and 3′-Rapid Amplification of cDNA Ends kit (RACE version 2.0; Invitrogen) based on the MdoVA-SK specific 5′ and 3′ RACE primers. The complete genome sequence of MdoVA-SK (17,004 nt) was assembled using DNAMAN v5.2.10 (Lynnon Biosoft) and deposited in GenBank (MN901923). BLASTn analysis showed that MdoVA-SK shared 91.3% sequence identity at the complete genome level with the sole MdoVA isolate (J1, MN548734) in GenBank. At the individual gene level, the identities between the isolates were 88.6 to 99.0%. This is the first report of MdoVA naturally infecting apple trees in South Korea and the second report in the world. Although the virus did not appear to be associated with any disease symptoms in apple trees, more research is needed to understand its biological and pathological properties.

Virus-Induced Flowering by Apple Latent Spherical Virus Vector: Effective Use to Accelerate Breeding of Grapevine.

Apple latent spherical virus (ALSV) was successfully used in promoting flowering (virus-induced flowering, VIF) in apple and pear seedlings. In this paper, we report the use of ALSV vectors for VIF in seedlings and in vitro cultures of grapevine. After adjusting experimental conditions for biolistic inoculation of virus RNA, ALSV efficiently infected not only progeny seedlings of Vitis spp. ‘Koshu,’ but also in vitro cultures of V. vinifera ‘Neo Muscat’ without inducing viral symptoms. The grapevine seedlings and in vitro cultures inoculated with an ALSV vector expressing the ‘florigen’ gene (Arabidopsis Flowering locus T, AtFT) started to set floral buds 20–30 days after inoculation. This VIF technology was successfully used to promote flowering and produce grapes with viable seeds in in vitro cultures of F1 hybrids from crosses between V. ficifolia and V. vinifera and made it possible to analyze the quality of fruits within a year after germination. High-temperature (37 °C) treatment of ALSV-infected grapevine disabled virus movement to newly growing tissue to obtain ALSV-free shoots. Thus, the VIF using ALSV vectors can be used to shorten the generation time of grapevine seedlings and accelerate breeding of grapevines with desired traits.

ALSV-Based Virus-Induced Gene Silencing in Apple Tree (Malus×domestica L.).

Virus-induced gene silencing (VIGS) is a fast and efficient tool to investigate gene function in plant as an alternative to knock down/out transgenic lines, especially in plant species difficult to transform and challenging to regenerate such as perennial woody plants. In apple tree, a VIGS vector has been previously developed based on the Apple latent spherical virus (ALSV) and an efficient inoculation method has been optimized using biolistics. This report described detailed step-by-step procedure to design and silence a gene of interest (GOI) in apple tree tissues using the ALSV-based vector.

Agrobacterium‐mediated inoculation of asymptomatic Apple latent spherical virus as gene silencing vector in pea (Pisum sativum L.)

AbstractApple latent spherical virus (ALSV) has been developed into a virus‐induced gene silencing vector with a broad host range, including legumes. Using Agrobacterium tumefaciens, delivered via stem injection, we introduced ALSV vectors carrying a phytoene desaturase (PDS) sequence from Phaseolus vulgaris, resulting in highly uniform knockdown phenotypes on Pisum sativum L., 23 days postinoculation. The infection rate ranged from 7.6% to 36.3% on five different P. sativum varieties using Agrobacterium stem inoculation. Mechanical inoculation using infected pea sap improved the infection rates to 80% on P. sativum cultivar AAC Lacombe. Reverse transcription polymerase chain reaction and real‐time reverse transcription polymerase chain reaction demonstrated that ALSV virus RNA accumulated in roots, tendrils and leaves, accompanied by decreased PsPDS (Pisum sativum phytoene desaturase) expression level. ALSV virus RNA was also detected from sepals, petals, carpels, pods, and seed coats but not in embryos. This method simplifies the ALSV inoculation and improves the use of ALSV vectors for functional genomics in P. sativum.

Estimation of the functions of viral RNA silencing suppressors by apple latent spherical virus vector.

Apple latent spherical virus (ALSV) is a latent virus with wide host range of plant species. In the present study, we prepared ALSV vectors expressing RNA silencing suppressors (RSSs) from eight plant viruses: P19 of carnation Italian ring spot virus (tombusvirus), 2b of peanut stunt virus (cucumovirus), NSs of tomato spotted wilt virus (tospovirus), HC-Pro of bean yellow mosaic virus (potyvirus), γb of barley stripe mosaic virus (hordeivirus), P15 of peanut clump virus (pecluvirus), P1 of rice yellow mottle virus (sobemovirus), or P21 of beet yellows virus (closterovirus). These vectors were inoculated to Nicotiana benthamiana to investigate the effects of RSSs on the virulence and accumulation of ALSV. Among the vectors, ALSV expressing NSs (ALSV-NSs) developed severe mosaic symptoms in newly developed leaves followed by plant death. Infection of ALSV-γb induced characteristic concentric ringspot symptoms on leaves, and plants infected with ALSV-HC-Pro showed mosaic and dwarf symptoms. Infection of the other five ALSV vectors did not show symptoms. ELISA and immunoblot assay indicated that virus titer increased in leaves infected with ALSV-NSs, γb, HC-Pro, or P19. RT-qPCR indicated that the amount of ALSV in plants infected with ALSV-NSs was increased by approximately 45 times compared with that of wtALSV without expression of any RSS. When ALSV-P19, NSs, or HC-Pro was inoculated to Cucumis sativus plants, none of these ALSV vectors induced symptoms, but accumulation of ALSV in plants infected with ALSV-NSs was increased, suggesting that functions of RSSs on virulence and accumulation of ALSV depend on host species.

Pest categorisation of non-EU viruses and viroids of Cydonia Mill., Malus Mill. and Pyrus L.

Following a request from the EU Commission, the Panel on Plant Health performed a pest categorisation of 17 viruses and viroids, herein called viruses, of Cydonia Mill., Malus Mill. and Pyrus L. determined as being either non‐EU or of undetermined standing in a previous EFSA opinion. These viruses belong to different genera and are heterogeneous in their biology. They can be detected by available methods and are efficiently transmitted by vegetative propagation techniques, with plants for planting representing a major long‐distance spread mechanism and, potentially, a major entry pathway. Depending on the viruses, additional pathway(s) can also be seed, pollen and/or vector transmission. Most of the viruses categorised here are known to infect only one of few related plant genera, but some of them have a wider host range, thus extending the possible entry pathways. Three viruses (apple necrotic mosaic virus, cherry rasp leaf virus, temperate fruit decay‐associated virus) and one viroid (apple fruit crinkle viroid) satisfy all the criteria to be considered as Union quarantine pests. Five viruses (apple green crinkle‐associated virus, blackberry chlorotic ringspot virus, eggplant mottled crinkle virus, tobacco ringspot virus and tomato ringspot virus) and one viroid (apple scar skin viroid), satisfy the criteria to be considered as Union quarantine pests with the possible exception of being absent from the EU territory or having a restricted presence and being under official control. The remaining six viruses (apple geminivirus, apple latent spherical virus, apple‐associated luteovirus, Pyrus pyrifolia cryptic virus, Pyrus pyrifolia partitivirus 2 and Tulare apple mosaic virus) and one viroid (apple hammerhead viroid) were not found to satisfy one or more of these criteria. The Panel highlights that for several viruses, especially those recently discovered, the categorisation is associated with high uncertainties mainly linked to the absence of data on biology and distribution. Since this opinion addresses specifically the non‐EU viruses, in general these viruses do not meet the criteria assessed by EFSA to qualify as a potential Union regulated non‐quarantine pests.

Virus-induced gene silencing in chili pepper by apple latent spherical virus vector

Apple latent spherical virus (ALSV) can infect a variety of crops, usually without inducing symptoms. Partial gene sequences can be introduced into ALSV vectors for the induction of virus-induced gene silencing (VIGS). These features are beneficial for the estimation of gene functions in plants, with relatively concise experimental manipulations. Given that the infectability of chili peppers (Capsicum spp.) by ALSV was unknown, an ALSV infectivity test was performed on the highly pungent Capsicum chinense cultivar ‘Habanero’. The chili pepper plants were not infected after rub-inoculation with a crude homogenate of ALSV-infected Chenopodium quinoa leaves, whereas inoculating them with a concentrated ALSV virus preparation caused an infection. Inoculation with an ALSV RNA preparation by gold particle bombardment resulted in high infection rates (about 90%). The infection was systemic and the infected plants were symptomless. For the induction of VIGS, 201-nucleotide fragments of the putative aminotransferase (pAMT) gene were introduced into the ALSV vector. These ALSV vectors infected 80–90% of RNA-inoculated chili pepper seedlings. Expression of pAMT-mRNA was repressed in the placenta of immature fruit of infected plants. The silencing of pAMT in the infected plants caused a substantial decrease in capsaicin content and a concomitant moderate accumulation of the non-pungent bioactive metabolite capsiate in these plants. These results showed that ALSV could be used to study gene functions by VIGS and to enhance capsiate accumulation in chili pepper through genetic modification.