Antiparallel Topology Research Articles

Selective Recognition of the Dimeric NG16 Parallel G-Quadruplex Structure Using Synthetic Turn-On Red Fluorescent Protein Chromophore.

Red fluorescent protein (RFP)-based fluorescent probes that can selectively interact with specific nucleic acids are of great importance for therapeutic and bioimaging applications. Herein, we have reported the synthesis of RFP chromophores for selective recognition of G-quadruplex nucleic acids in vitro and ex vivo. We identified DFHBI-DM as a fluorescent turn-on probe that binds to the dimeric NG16 parallel quadruplex with superior selectivity and sensitivity over various parallel, antiparallel, and hybrid topologies. The binding of DFHBI-DM to NG16 exhibited excellent photophysical properties, including high binding affinity, large Stokes shift, high photostability, and quantum yield. The MD simulation study supports the 1:1 binding stoichiometry. It confirms the planar conformation of DFHBI-DM, which makes strong binding interactions with a flat quartet of NG16 compared to other antiparallel and hybrid topologies. The cell imaging and MTT assays revealed that DFHBI-DM is a biocompatible and efficient fluorescent probe for intracellular imaging of NG16. Overall, these results demonstrated that DFHBI-DM could be an effective fluorescent G4-stabilizing agent for the dimeric NG16 parallel quadruplex, and it could be a promising candidate for further exploration of bioimaging and therapeutic applications.

A FRET biosensor constructed using pH sensitive G-quadruplex DNA for detecting mitochondrial autophagy

Mitochondria are crucial powerhouses and central organelles for maintaining normal physiological activities in eukaryotic cells. The use of highly specific optical biosensors to monitor mitochondrial autophagy (mitophagy) is an important way for detecting mitochondrial abnormalities. Herein, we report a pH responsive G-quadruplex (G4) structure folded by the oligonucleotide named P24. P24 is composed of four GGCCTG repeating units, and the high guanine content allows it to form an antiparallel G4 topology at pH 4.5 (lysosomal pH). However, when pH increases to around 7.4 (mitochondrial pH), P24 further transforms into a double-stranded structure. Unlike most oligonucleotides that enter lysosomes, P24 highly targets mitochondria in live cells. These characteristics enable P24 to construct a pH responsive optical biosensor by linking a pair of fluorescence resonance energy transfer (FRET) fluorophores. The P24 based biosensor demonstrates reliable applications in detecting mitophagy in live cells.

Hindered intermolecular stacking of anti-parallel telomeric G-quadruplexes.

Telomeric G-quadruplexes (G4s) are non-canonical DNA structures composed of TTAGGG repeats. They are extensively studied both as biomolecules key for genome stability and as promising building blocks and functional elements in synthetic biology and nanotechnology. This is why it is extremely important to understand how the interaction between G4s is affected by their topology. We used small-angle x-ray scattering to investigate the end-to-end stacking of antiparallel telomeric G-quadruplexes formed by the sequence AG3(T2AG3)3. To represent the experimental data, we developed a highly efficient coarse-grained fitting tool, which successfully described the samples as an equilibrium mixture of monomeric and dimeric G4 species. Our findings indicate that the antiparallel topology prevents the formation of long multimeric structures under self-crowding conditions, unlike the hybrid/parallel structures formed by the same DNA sequence. This result supports the idea that the stacking of monomeric G-quadruplexes is strongly affected by the presence of diagonal loops.

Examining DNA structures with in-droplet hydrogen/deuterium exchange mass spectrometry

Capillary vibrating sharp-edge spray ionization (cVSSI) combined with hydrogen/deuterium exchange-mass spectrometry (HDX-MS) has been utilized to characterize different solution-phase DNA conformers including DNA G-quadruplex topologies as well as triplex DNA and duplex DNA. In general, G-quadruplex DNA shows a wide range of protection of hydrogens extending from ∼12% to ∼21% deuterium incorporation. Additionally, the DNA sequences selected to represent parallel, antiparallel, and hybrid G-quadruplex topologies exhibit slight differences in deuterium uptake levels which appear to loosely relate to overall conformer stability. Notably, the exchange level for one of the hybrid sequence sub topologies of G-quadruplex DNA (24 TTG) is significantly different (compared with the others studied here) despite the DNA sequences being highly comparable. For the quadruplex-forming sequences, correlation analysis suggests protection of base hydrogens involved in tetrad hydrogen bonding. For duplex DNA ∼19% deuterium incorporation is observed while only ∼16% is observed for triplex DNA. This increased protection of hydrogens may be due to the added backbone scaffolding and Hoogsteen base pairing of the latter species. These experiments lay the groundwork for future studies aimed at determining the structural source of this protection as well as the applicability of the approach for ascertaining different oligonucleotide folds, co-existing conformations, and/or overall conformer flexibility.

Structural effects of inosine substitution in telomeric DNA quadruplex.

The telomeric DNA, a distal region of eukaryotic chromosome containing guanine-rich repetitive sequence of (TTAGGG)n, has been shown to adopt higher-order structures, specifically G-quadruplexes (G4s). Previous studies have demonstrated the implication of G4 in tumor inhibition through chromosome maintenance and manipulation of oncogene expression featuring their G-rich promoter regions. Besides higher order structures, several regulatory roles are attributed to DNA epigenetic markers. In this work, we investigated how the structural dynamics of a G-quadruplex, formed by the telomeric sequence, is affected by inosine, a prevalent modified nucleotide. We used the standard (TTAGGG)n telomere repeats with guanosine mutated to inosine at each G position. Sequences (GGG)4, (IGG)4, (GIG)4, (GGI)4, (IGI)4, (IIG)4, (GII)4, and (III)4, bridged by TTA linker, are studied using biophysical experiments and molecular modeling. The effects of metal cations in quadruplex folding were explored in both Na+ and K+ containing buffers using CD and UV-melting studies. Our results show that antiparallel quadruplex topology forms with the native sequence (GGG)4 and the terminal modified DNAs (IGG)4 and (GGI)4 in both Na+ and K+ containing buffers. Specifically, quadruplex hybrid was observed for (GGG)4 in K+ buffer. Among the other modified sequences, (GIG)4, (IGI)4 and (GII)4 show parallel features, while (IIG)4 and (III)4 show no detectable conformation in the presence of either Na+ or K+. Our studies indicate that terminal lesions (IGG)4 and (GGI)4 may induce certain unknown conformations. The folding dynamics become undetectable in the presence of more than one inosine substitution except (IGI)4 in both buffer ions. In addition, both UV melting and CD melting studies implied that in most cases the K+ cation confers more thermodynamic stability compared to Na+. Collectively, our conformational studies revealed the diverse structural polymorphisms of G4 with position dependent G-to-I mutations in different ion conditions.

Mixed convection analysis in a dual-driven cavity with a stable vertical temperature gradient using the lattice Boltzmann method

The complex dynamics of mixed convection circumstances, concentrating on two examples. In the first case, mixed convection was investigated in a single-sided lid-driven cavity with a top and bottom walls arrangement and the second scenario explores parallel and anti-parallel topologies, focusing on mixed convection in a double-sided lid-driven cavity. The main parameters in this study are the Reynolds, Rayleigh, Prandtl, Grashof, and Richardson numbers. Calculation of numerical solutions to the Navier-Stokes equations over wide ranges in parameters, 0 ? Gr ? 106, 0 ? Re ? 3000, Pr~O(1), and an aspect ratio approximately O(1). The study analyzes these results systematically to understand the relative importance of natural convection and forced convection. As a result of this study, a two-dimensional cavity with specific boundary conditions was created. In a square domain with adiabatic side walls, a top wall is maintained at a higher temperature than the bottom wall. The flow characteristics approach those of a typical driven-cavity of a non-stratified fluid when Gr/Re2 ? 1. There are low fluctuations in temperature and well-mixed fluids throughout the majority of the interior. Much of the inner cavity?s middle and bottom are stationary when Gr/Re2?1. Temperature patterns in these areas are vertically linear and isotherms are nearly horizontal. Lattice Boltzmann method considers the effect of gravity on mixed convection by adjusting the y-velocity using a temperature-dependent forcing factor. The calculation of the Nusselt number at the top wall reveals enhanced heat transfer, with the results suggesting increased intensity when Gr/Re2?1.

Comprehending conformational changes in EmrE, multidrug transporter at different pH: insights from molecular dynamics simulations

EmrE is a small multidrug resistance (SMR) pump of antiparallel topology that confers resistance to a broad range of polyaromatic cations in Escherichia coli. Atomic-level understanding of conformational changes for the selectivity of substrate and transport of a diverse array of drugs through the smallest known efflux pumps is crucial to multi-drug resistance. Therefore, the present study aims to provide insights into conformational changes during the transport through EmrE transporter at different pH. Molecular dynamics simulations have been carried out on the complete structure of EmrE in the absence of substrate. Computational analyses such as secondary structure, principal component, dynamic cross-correlation matrix, and hydrogen bond calculations have been performed. Analysis of MD trajectories in this study revealed pH-dependent interactions that influenced the structural dynamics of EmrE. Notably, at high pH, Glu14 and Tyr60 in both monomers formed electrostatic interactions, while these interactions decreased significantly at a low pH. Interestingly, a kink at helix 3 (H3) and dual open conformation of EmrE at low pH were also observed in contrast to a closed state discerned towards the periplasmic side at high pH. Significant interactions between C-terminal residues and residues at the edge of H1 & Loop1 and H3 & Loop3 were identified, suggesting their role in stabilizing the closed conformation of EmrE at the periplasmic end under high pH conditions. The present study enhances our understanding of EmrE’s conformational changes, shedding light on the pH-dependent mechanisms that are likely to impact its function in multi-drug resistance. Communicated by Ramaswamy H. Sarma

Improving the Biological Properties of Thrombin-Binding Aptamer by Incorporation of 8-Bromo-2'-Deoxyguanosine and 2'-Substituted RNA Analogues.

Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can efficiently bind to thrombin, thus producing an anticoagulant effect. The major limit to its therapeutic application is represented by its poor thermal and biological resistance. Therefore, numerous research studies have been focused on the design of TBA analogues with chemical modifications to improve its pharmacokinetic and pharmacodynamic properties. To maintain the functional recognition to protein surface on which TBA anticoagulant activity depends, it is essential to preserve the canonical antiparallel topology of the TBA quadruplex core. In this paper, we have designed three TBA variants with modified G-tetrads to evaluate the effects of nucleobase and sugar moiety chemical modifications on biological properties of TBA, preserving its chair-like G-quadruplex structure. All derivatives contain 8-bromo-2'-deoxyguanosine (GBr) in syn positions, while in the anti-positions, locked nucleic acid guanosine (GLNA) in the analogue TBABL, 2'-O-methylguanosine (GOMe) in TBABM, and 2'-F-riboguanosine (GF) in TBABF is present. CD (Circular Dichroism), CD melting, 1H-NMR (Nuclear Magnetic Resonance), and non-denaturing PAGE (Polyacrylamide Gel Electrophoresis), nuclease stability, prothrombin time (PT) and fibrinogen-clotting assays have been performed to investigate the structural and biological properties of these TBA analogues. The most interesting results have been obtained with TBABF, which revealed extraordinary thermal stability (Tm approximately 40 °C higher than that of TBA), anticoagulant activity almost doubled compared to the original aptamer, and, above all, a never-observed resistance to nucleases, as 50% of its G4 species was still present in 50% FBS at 24 h. These data indicate TBABF as one of the best TBA analogue ever designed and investigated, to the best of our knowledge, overcoming the main limitations to therapeutic applications of this aptamer.

Kinetic and Thermodynamic Control of G-Quadruplex Polymorphism by Na+ and K+ Cations.

G-Quadruplexes (G4s) are ubiquitous nucleic acid folding motifs that exhibit structural diversity that is dependent on cationic conditions. In this work, we exploit temperature-controlled single-molecule fluorescence resonance energy transfer (smFRET) to elucidate the kinetic and thermodynamic mechanisms by which monovalent cations (K+ and Na+) impact folding topologies for a simple G-quadruplex sequence (5'-GGG-(TAAGGG)3-3') with a three-state folding equilibrium. Kinetic measurements indicate that Na+ and K+ influence G4 formation in two distinctly different ways: the presence of Na+ modestly enhances an antiparallel G4 topology through an induced fit (IF) mechanism with a low affinity (Kd = 228 ± 26 mM), while K+ drives G4 into a parallel/hybrid topology via a conformational selection (CS) mechanism with much higher affinity (Kd = 1.9 ± 0.2 mM). Additionally, temperature-dependent studies of folding rate constants and equilibrium ratios reveal distinctly different thermodynamic driving forces behind G4 binding to K+ (ΔH°bind > 0, ΔS°bind > 0) versus Na+ (ΔH°bind < 0, ΔS°bind < 0), which further illuminates the diversity of the possible pathways for monovalent facilitation of G-quadruplex folding.

Use of Single-Molecule Plasmon-Enhanced Fluorescence to Investigate Ligand Binding to G-Quadruplex DNA.

Single-molecule measurements are crucial for studying the interactions between G-quadruplex (GQ) DNA and ligands, as they provide higher resolution and sensitivity compared to those of bulk measurements. In this study, we employed plasmon-enhanced fluorescence to investigate the real-time interaction between the cationic porphyrin ligand TmPyP4 and different topologies of telomeric GQ DNA at the single-molecule level. By analyzing the time traces of the fluorescence bursts, we extracted dwell times for the ligand. For parallel telomeric GQ DNA, the dwell time distribution followed a biexponential fit, yielding mean dwell times of 5.6 and 18.6 ms. For the antiparallel topology of human telomeric GQ DNA, plasmon-enhanced fluorescence of TmPyP4 was observed, with dwell time distributions following a single-exponential fit and a mean dwell time of 5.9 ms. Our approach allows the nuances of GQ-ligand interactions to be captured and holds promise for studying weakly emitting GQ ligands at the single-molecule level.

Solution structure of the DNA binding domain of Arabidopsis transcription factor WRKY11

The Arabidopsis WRKY11 (AtWRKY11) protein is an important transcription factor involved in plant response to biotic and abiotic stresses. Its DNA-binding domain specifically binds to gene promoter regions harboring the W-box consensus motif. Herein we report the high-resolution structure of the AtWRKY11 DNA-binding domain (DBD) determined by solution NMR spectroscopy. The results show that AtWRKY11-DBD adopts an all-β fold comprising five β-strands packed in an antiparallel topology, stabilized by a zinc-finger motif. Structural comparison reveals that the long β1-β2 loop shows the highest structural variation from other available WRKY domain structures. Moreover, this loop was further found to contribute to the binding between AtWRKY11-DBD and W-box DNA. Our current study provides atomic-level structural basis for further understanding the structure-function relationship of plant WRKY proteins.

Regulation of thrombin activity by ligand-induced topological alteration in a thrombin-binding aptamer.

Thrombin-binding aptamer (TBA), which forms a G-quadruplex (G4) structure with anti-parallel topology, interacts with thrombin to inhibit its enzymatic activity. Here we show that the G4-topology-altering ligand L2H2-2M2EA-6LCO (6LCO) changes the anti-parallel topology of TBA G4 to the parallel topology, thereby abrogating the thrombin-inhibitory activity of TBA. This finding suggests that G4 ligands that alter topology may be promising drug candidates for diseases involving G4-binding proteins.

Self-Assembled Peptidyl Aggregates for the Fluorogenic Recognition of Mitochondrial DNA G-Quadruplexes.

The selective monitoring of G-quadruplex (G4) structures in living cells is important to elucidate their functions and reveal their value as diagnostic or therapeutic targets. Here we report a fluorogenic probe (CV2) able to selectively light-up parallel G4 DNA over antiparallel topologies. CV2 was constructed by conjugating the excimer-forming CV dye with a peptide sequence (l-Arg-l-Gly-glutaric acid) that specifically recognizes G4s. CV2 forms self-assembled, red excimer-emitting nanoaggregates in aqueous media, but specific binding to G4s triggers its disassembly into rigidified monomeric dyes, leading to a dramatic fluorescence enhancement. Moreover, selective permeation of CV2 stains G4s in mitochondria over the nucleus. CV2 was employed for tracking the folding and unfolding of G4s in living cells, and for monitoring mitochondrial DNA (mtDNA) damage. These properties make CV2 appealing to investigate the possible roles of mtDNA G4s in diseases that involve mitochondrial dysfunction.

Self‐Assembled Peptidyl Aggregates for the Fluorogenic Recognition of Mitochondrial DNA G‐Quadruplexes

AbstractThe selective monitoring of G‐quadruplex (G4) structures in living cells is important to elucidate their functions and reveal their value as diagnostic or therapeutic targets. Here we report a fluorogenic probe (CV2) able to selectively light‐up parallel G4 DNA over antiparallel topologies. CV2 was constructed by conjugating the excimer‐forming CV dye with a peptide sequence (l‐Arg‐l‐Gly‐glutaric acid) that specifically recognizes G4s. CV2 forms self‐assembled, red excimer‐emitting nanoaggregates in aqueous media, but specific binding to G4s triggers its disassembly into rigidified monomeric dyes, leading to a dramatic fluorescence enhancement. Moreover, selective permeation of CV2 stains G4s in mitochondria over the nucleus. CV2 was employed for tracking the folding and unfolding of G4s in living cells, and for monitoring mitochondrial DNA (mtDNA) damage. These properties make CV2 appealing to investigate the possible roles of mtDNA G4s in diseases that involve mitochondrial dysfunction.

Arginine 125 Is an Essential Residue for the Function of MRAP2.

MRAP2 is a small simple transmembrane protein arranged in a double antiparallel topology on the plasma membrane. It is expressed in the paraventricular nucleus of the hypothalamus, where it interacts with various G protein-coupled receptors, such as the prokineticin receptors, and regulates energy expenditure and appetite. The aim of this work was to analyze the functional role of the specific arginine residue at position 125 of MRAP2, which affects protein conformation, dimer formation, and PKR2 binding. Results obtained with the MRAP2 mutants R125H and R125C, which are found in human patients with extreme obesity, and mouse MRAP2, in which arginine 125 is normally replaced by histidine, were compared with those obtained with human MRAP2. Understanding the mechanism by which MRAP2 regulates G protein-coupled receptors helps in elucidating the metabolic pathways involved in metabolic dysfunction and in developing new drugs as specific targets of the MRAP2-PKR2 complex.

New insights into the effect of molecular crowding environment induced by dimethyl sulfoxide on the conformation and stability of G-quadruplex

Various structures of G-quadruplex in biosystems play an important role in different diseases and are often regulated by a variety of molecular crowding environments induced by internal and even external factors (e.g., a solvent). Dimethyl sulfoxide (DMSO), a universal solvent, has been widely used in biological studies and for drug therapy, but little is known regarding its effect on G-quadruplex structure and stability. Here, we report the influence of molecular crowding environment induced by DMSO on the conformation and stability of G-quadruplex structure. We show that the G-quadruplex-forming sequences such as human telomeric sequence, which may have diverse conformations in different environments, tend to convert their topologies to parallel structures under the molecular crowding stimulated by DMSO. Moreover, DMSO can increase the stability of the parallel and antiparallel topologies, especially the parallel G-quadruplex sequence c-kit, but not the hybrid topologies. Further analysis of c-kit using the CD and NMR technique, combined with the unique structural characteristics of c-kit, reveals that the crowding, dehydration and interaction of DMSO are conductive to the formation and stability of the parallel G-quadruplex. The present study suggests that, DMSO, a common solvent used in DNA experiments, may have a nonnegligible influence on the structure and stability of G-quadruplex.

Replication Control of Human Telomere G-Quadruplex DNA by G-Quadruplex Ligands Dependent on Solution Environment.

The human telomere region is known to contain guanine-rich repeats and form a guanine-quadruplex (G4) structure. As telomeres play a role in the regulation of cancer progression, ligands that specifically bind and stabilize G4 have potential therapeutic applications. However, as the human telomere sequence can form G4 with various topologies due to direct interaction by ligands and indirect interaction by the solution environment, it is of great interest to study the topology-dependent control of replication by ligands. In the present study, a DNA replication assay of a template with a human telomere G4 sequence in the presence of various ligands was performed. Cyclic naphthalene diimides (cNDI1 and cNDI2) efficiently increased the replication stall of the template DNA at G4 with an anti-parallel topology. This inhibition was stability-dependent and topology-selective, as the replication of templates with hybrid or parallel G4 structures was not affected by the cNDI and cNDI2. Moreover, the G4 ligand fisetin repressed replication with selectivity for anti-parallel and hybrid G4 structures without stabilization. Finally, the method used, referred to as quantitative study of topology-dependent replication (QSTR), was adopted to evaluate the correlation between the replication kinetics and the stability of G4. Compared to previous results obtained using a modified human telomere sequence, the relationship between the stability of G4 and the effect on the topology-dependent replication varied. Our results suggest that native human telomere G4 is more flexible than the modified sequence for interacting with ligands. These findings indicate that the modification of the human telomeric sequence forces G4 to rigidly form a specific structure of G4, which can restrict the change in topology-dependent replication by some ligands.

Rapid label-free colorimetric dual-functional aptasensor for β-lactoglobulin detection based on a rational tailoring strategy

β-lactoglobulin (β-LG) is a nonnegligible allergenic protein found in cow milk. A label-free, enzyme-free, dual-functional aptameric sensor was constructed based on rational aptamer tailoring for β-LG detection. Via an established three-step rational tailoring strategy, the original aptamer was transformed from an inflexible antiparallel topology into the flexible, antiparallel/parallel hybrid topology, enlg2-pl3. enlg2-pl3 displayed the dual-functionality of not only binding with β-LG via the antiparallel conformation but also outputting signals via the parallel type. The dual-functionality depended on the conformational conversion of enlg2-pl3. The β-LG-driven conformational conversion to antiparallel type was the detection basis of aptasensor. The detection conditions were optimized regarding ions, hemin, chromogenic substrate, pH levels, and detection time. Furthermore, the aptasensor offered advantages, such as cost-efficiency, simple operation, 40 min rapid detection, excellent specificity, and a sensitivity of a three-orders of magnitude linear range and an 8.23-fold linear curve slope, meeting the point-of-care testing (POCT) requirements for dairy analysis.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Enhancement of the Immunostimulatory Effect of Phosphodiester CpG Oligodeoxynucleotides by an Antiparallel Guanine-Quadruplex Structural Scaffold.

Guanine-quadruplex-based CpG oligodeoxynucleotides (G4 CpG ODNs) have been developed as potent immunostimulatory agents with reduced sensitivity to nucleases. We designed new monomeric G4 ODNs with an antiparallel topology using antiparallel type duplex/G4 ODNs as robust scaffolds, and we characterized their topology and effects on cytokine secretion. Based on circular dichroism analysis and quantification of mRNA levels of immunostimulatory cytokines, it was found that monomeric antiparallel G4 CpG ODNs containing two CpG motifs in the first functional loop, named G2.0.0, could maintain antiparallel topology and generate a high level of immunostimulatory cytokines in RAW264 mouse macrophage-like cell lines. We also found that the flanking sequence in the CpG motif altered the immunostimulatory effects. Gc2c.0.0 and Ga2c.0.0 are monomeric antiparallel G4 CpG ODNs with one cytosine in the 3′ terminal and one cytosine/adenine in the 5′ terminal of CpG motifs that maintained the same resistance to degradation in serum as G2.0.0 and improved interleukin-6 production in RAW264 and bone marrow-derived macrophages. The immunostimulatory activity of antiparallel G4 CpG ODNs is superior to that of linear natural CpG ODNs. These results provide insights for the rational design of highly potent CpG ODNs using antiparallel G4 as a robust scaffold.