Open AccessCCS ChemistryRESEARCH ARTICLE30 Mar 2022High Mannose-Specific Aptamers for Broad-Spectrum Virus Inhibition and Cancer Targeting Wei Li, Shuxin Xu, Ying Li, Jingran Chen, Yanyan Ma and Zhen Liu Wei Li State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023 Google Scholar More articles by this author , Shuxin Xu State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023 Google Scholar More articles by this author , Ying Li State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023 Google Scholar More articles by this author , Jingran Chen State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023 Google Scholar More articles by this author , Yanyan Ma State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023 Google Scholar More articles by this author and Zhen Liu *Corresponding author: E-mail Address: [email protected] State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023 Google Scholar More articles by this author https://doi.org/10.31635/ccschem.022.202101747 SectionsSupplemental MaterialAboutAbstractPDF ToolsAdd to favoritesDownload CitationsTrack Citations ShareFacebookTwitterLinked InEmail High mannose oligosaccharides are characteristic and essential for immune evasion of many viruses and cancer cells. They are potential targets for viral inhibition and cancer diagnosis/therapy. Particularly, high mannose-binding reagents may be a unique asset for fighting the ongoing and mutating SARS-CoV-2 virus. Lectins are prevailing reagents for saccharide binding but suffer from inadequate specificity and apparent immunogenicity. Meanwhile, other reagents for the same purpose, such as antibodies and aptamers, have rarely been reported. Herein, using molecularly imprinted magnetic nanoparticles as a potent platform, we report a smart selection method for fine screening of high mannose-specific aptamers. Monovalent aptamers were first effectively screened within eight rounds of selection. Multivalent aptamers, in the forms of dendritic polymer or tetrahedral DNA nanostructure (TDN), were further engineered. The aptamers exhibited high affinity toward the spike protein of SARS-CoV-2 and the envelope protein GP120 of HIV. Both the monovalent aptamer and its TDN form exhibited a certain inhibition effect to the SARS-CoV-2 pseudovirus. On the other hand, both the monovalent aptamer and its dendritic form permitted the recognition of cancer cells over normal cells. Therefore, as unprecedented reagents for broad-spectrum viral inhibition and cancer targeting, these aptamers hold great promise for clinical treatment and diagnosis. Download figure Download PowerPoint Introduction Dense and complex glycosylation is universal to all living organisms, in which the surface-displayed glycans act as mediators of cell adhesion and signalling as well as bacteria- and virus-host interactions.1,2 Glycosylation not only plays a central role in the correct folding of protein spatial structures, but also increases stability and regulates antigenicity.3,4N-linked high mannose glycans especially are expressed on the surface glycoproteins of many viruses. This is due to the rapid and simple synthesis of virus-associated glycoproteins, which directly bud from the endoplasmic reticulum-Golgi intermediate compartment without further processing into complex and diverse structures.5,6 Because the modification of oligosaccharides on viral particles acts as a biological masks or glycan shield and thereby provides protection from immune surveillance of infected hosts, high mannose glycans can be valuable targets in novel antiviral strategies. For instance, a monoclonal antibody capable of binding a cluster of high mannose glycans (Man5−9GlcNAc2) on HIV envelope protein GP120 has enabled a broad-spectrum neutralization against HIV isolates.7,8 Recent reports have proved that several coronavirus spike proteins are decorated with high mannose glycans.9–13 Considering coronaviruses, particularly SARS-CoV-2, are highly mutable, high mannose-binding reagents may provide a unique asset for developing new strategies for the prevention and treatment of COVID-19. On the other hand, due to a similar mechanism, high mannose glycosylation also occurs on the surface of cancer cells.14–17 The elevated expression of high mannose structures indicates a premature termination of the glycosylation pathway and an association with tumor progression.16 Although a number of plant lectins are present in nature, their insufficient specificity and apparent immunogenicity severely limit their wide clincal application.18 Meanwhile, high-performance anti-glycan antibodies face the challenge of complicated preparation.19 Therefore, the development of new mannose-specific binders with high recognition performance and low immunogenicity is of great importance to fight viruses and treat cancer. Aptamers are functional single-stranded DNA or RNA oligonucleotides with specific binding toward a range of target species, from small molecules to proteins to whole cells.20–22 They are attractive alternatives to lectins and antibodies for the recognition of antigens due to their highly favorable features, such as high stability, simple production, low cost, and biological compatibility.23,24 Nucleic acid aptamers, which are usually obtained through an in vitro evolution process called systematic evolution of ligands by exponential enrichment (SELEX),25,26 have been useful reagents for disease diagnosis and treatment.27,28 However, in contrast with a large number of protein-binding aptamers, glycan-binding aptamers have seldom been reported29 due to very poor availability of glycan targets from chemical synthesis and commercial sources. Molecularly imprinted polymers (MIPs),30,31 which are synthetic artificial receptors through polymerization in the presence of a template, exhibit wide applications in separation, catalysis, bioimaging, and therapy.32–34 Recently, the introduction of imprinted magnetic nanoparticles (MNPs) into SELEX has greatly facilitated the selection efficiency and success rate of aptamer screening.35,36 Particularly, flexible use of MIPs as potent affinity platforms for positive and negative selection has enabled efficient selection of glycan-specific aptamers.37 The long COVID-19 pandemic has particularly motivated us to develop high mannose-binding aptamers for the anti-viral fight. Herein, we present a smart MIP-based SELEX strategy for the efficient and fine selection of high mannose-specific aptamers. A triplet of elaborately selected proteins were used as alternate targets for glycan-guided aptamer selection, including the glycoprotein RNase B, which contains five high mannose glycans (Man5-9GlcNAc2), the nonglycoprotein RNase A, which shares an identical peptide sequence with RNase B but contains no glycans, and an artificial glycoprotein, Man3-RNase that contains the core pentasaccharide (Man3GlcNAc2). To facilitate the selection, these targets were immobilized onto epitope-imprinted MNPs prepared by an advanced strategy called molecular imprinting and cladding (MIC) that we recently reported.38,39 The principle of this MIP-based SELEX is illustrated in Scheme 1. RNase B was initially immobilized onto the MIP and incubated with an ssDNA library for positive selection. Afterward, RNase A and Man3-RNase were successively introduced as negative targets to eliminate unwanted binding of oligonucleotides to nonglycosylated regions and pentasaccharide (Man3GlcNAc2). After eight rounds of aptamer screening, the saturated pool was sent for sequence identification. The selected aptamer monomer was further engineered into multivalent forms, including dendritic polyvalent aptamer (PAP) and rigid aptamer-modified tetrahedral DNA nanostructure (AP-TDN). Both aptamer monomer and multivalent forms exhibited an apparent virus inhibition effect through binding with the glycan shield of viral antigen protein, thereby blocking the virus-receptor binding. In addition, cell imaging experiments demonstrated the ability of these high mannose-specific aptamers to specifically target cancer cells against normal cells. The MIP-based SELEX method is facile and productive, opening a new avenue to the fine screening of glycan-binding aptamers. The generated high mannose-binding aptamers hold great promise for many important applications. Scheme 1 | Schematic of MIP-based SELEX selection of high mannose-binding aptamers for virus inhibition and cancer targeting. Download figure Download PowerPoint Experimental Methods Reagents and materials All DNA sequences were obtained from Sangon Biotech (Shanghai, China), and the unmodified, carboxyfluorescein (FAM)-modified and biotin-modified ssDNA sequences are listed in Supporting Information Table S1. TaKaRa TaqTM DNA Polymerase Hot Start Version was obtained from Takara Bio, Inc. (Dalian, China). The binding buffer was 1× PBSM solution [1× phosphate-buffered saline (PBS) with 1 mM MgCl2, pH 7.4], and the washing buffer was 1× PBST solution (1× PBS with 0.05% Tween-20, pH 7.4). PBS, PBST, breast cancer cells (MCF-7), normal mammary epithelial cells (MCF-10A), parenzyme cell digestion solution (containing 0.25% trypase and 0.02% ethylene-diamine tetraacetic acid (EDTA)), and Dulbecco’s modified Eagle medium (DMEM, containing 4.5 mg/mL glucose, 80 U/mL penicillin, and 0.08 mg/mL streptomycin) were purchased from Keygen Biotech (Nanjing, China). ACE2-expressed HEK293T and SARS-CoV-2 D614G pseudoviruses were purchased from Fubio Biotechnology (Suzhou, China). Fetal bovine serum (FBS) was purchased from Gibco (Life Technologies, Thornton, Australia). Culture cells for cell culture and confocal imaging were purchased from NEST Biotech Co., Ltd. (Wuxi, China). Preparation of epitope-imprinted MNPs Epitope-imprinted MNPs were prepared according to a recently reported approach called boronate affinity-anchored epitope-oriented surface imprinting and cladding38 with slight modifications. Glycated C-terminal epitope (NPYVPVHFDASVK-fru) of RNase B was used as the template and immobilized onto boronic acid-functionalized MNPs (BA-MNPs) by virtue of boronate affinity. The preparation route is shown in Supporting Information Scheme S1, which was composed of the following three steps. Immobilization of template An amount of 2 mg fructose-modified epitope was dissolved in 2 mL of NH4HCO3 buffer (50 mM, pH 8.5) containing 500 mM NaCl. Then 20 mg of BA-MNPs was dispersed in 2 mL of the same buffer by ultrasonication, added into the above epitope solution, and shaken at room temperature for 2 h. The obtained epitope-immobilized BA-MNPs were collected by a magnet and washed with NH4HCO3 buffer (50 mM, pH 8.5) three times. Oriented imprinting and cladding Multiple silylating reagents, including aminopropyltriethoxysilane (APTES), 3-ureidopropyltriethoxy-silane (UPTES), benzyltriethoxysilane (BnTES), isobutyltriethoxysilane (IBTES), and tetraethyl orthosilicate (TEOS), that offer different functionalities to interact with the template, were used to form a silica coating to cover the template to an appropriate thickness on the substrate surface. The above collected epitope-immobilized BA-MNPs were dispersed into 150 mL of anhydrous ethanol containing 4.5 mL of NH3·H2O (28%), and 10 mL of water was added. The resulting suspension was mechanically stirred for 5 min. Different ratios of APTES, UPTES, BnTES, IBTES, and TEOS in 40 mL of anhydrous ethanol were added to the above suspension, and then the resulting solution was mechanically stirred at room temperature for 50, 60, 70, or 80 min. The obtained imprinted MNPs were collected by a magnet and redispersed into 160 mL of anhydrous ethanol containing 2.8 mL of NH3·H2O (28%). Then 40 mL of 10 mM TEOS in anhydrous ethanol was added and further stirred for cladding 10 min. The MNPs were collected again and washed with anhydrous ethanol three times and then dried at 40 °C in a vacuum oven overnight. Removal of template The obtained imprinted MNPs were dispersed into 2 mL of ACN:H2O:HAc = 50:49:1 (v/v) to disrupt noncovalent and boronate affinity interactions and shaken for 20 min at room temperature three times. After removing the template, the prepared epitope-imprinted MNPs were magnetically collected, washed with water and anhydrous ethanol three times each and then dried at 40 °C in a vacuum overnight. Nonimprinted MNPs were prepared using the same procedure except for the absence of template. Partial deglycosylation of RNase B Partially deglycosylated RNase B was prepared according to a literature method40 with minor modifications. A 1-mg amount of pure RNase B was incubated with α-mannosidase (1.0 U) in 1 mL sodium acetate buffer (1 M, pH 4.5) at 35 °C for 24 h. Subsequent purification and isolation of the reaction product were carried out by ultrafiltration at 14,000 rpm for 30 min with the Amicon Ultra-0.5 cartridge (3K cut-off size). Finally, the product was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). SELEX procedure Three target proteins (RNase A, Man3-RNase, and RNase B) were separately immobilized onto the imprinted MNPs through their same C-terminal epitope (NPYVPVHFDASV). 2 mg of epitope-imprinted MNPs was mixed with 1 mg/mL protein solution and incubated at room temperature on a rotator for 2 h. After magnetic separation, the beads were washed three times to discard unbound protein, and then protein-bound imprinted MNPs were magnetically collected. Subsequently, 1 nmol of the initial ssDNA library was dissolved in 100 μL binding buffer and cooled on ice for 10 min after heating at 95 °C for 10 min. The obtained RNase B-bound imprinted MNPs were incubated with the ssDNA library at room temperature for 2 h on a rotary shaker. Through magnetic separation, the MNPs-RNase B-ssDNA complexes were washed twice with washing buffer to remove nonspecific sequences. The bound ssDNA was eluted by heating at 95 °C for 15 min with 100 μL binding buffer, and the elution was magnetically collected as a template for polymerase chain reaction (PCR) amplifying. After isolation by streptavidin-coated beads, the ssDNA pool was collected and used later for the next round of selection. Three rounds of positive screening later, a negative selection step was introduced to improve the selectivity of aptamers. Specifically, the evolved pool was incubated with the negative target (RNase A or Man3-RNase)-bound imprinted MNPs, prior to incubating with RNase B-bound imprinted MNPs. The incubation time and washing strength were gradually varied, and the detailed selection conditions are listed in Supporting Information Table S2. Monitoring the selection process The binding affinity of each round ssDNA pool toward a positive target was monitored by fluorescence detection. The equivalent FAM-ssDNA pool at each round in the binding buffer was heated at 95 °C for 10 min and then quickly cooled on ice for 10 min. 2 mg RNase B-bound imprinted MNPs was added and incubated at room temperature for 1 h on a rotary shaker. After magnetic separation, the supernatant was removed, and the particles were washed with washing buffer three times. The bound ssDNA was eluted by heating at 95 °C for 15 min with 100 μL binding buffer. Through magnetic separation, the elution was collected, and the fluorescence was detected on a microplate reader. For the control experiment, all the procedures were the same as described above except for the absence of ssDNA. All the measurements for each condition were repeated three times, and the data were control-subtracted. Dissociation constant (Kd) determination of the candidate aptamers The binding abilities of the selected aptamers to the target were evaluated by the fluorescence intensity method and biolayer interferometry (BLI). Each modified candidate aptamer in the binding buffer was heated at 95 °C for 10 min and then quickly cooled on ice for 10 min before use. For the fluorescence assay, FAM-modified candidate aptamers (from 0 to 1600 nM) were incubated with target-bound imprinted MNPs at room temperature for 1 h on a rotary shaker. After magnetic separation, the particles were washed three times, and the bound ssDNA was eluted by heating. Then, the elution was collected, and fluorescence was detected on a microplate reader. The apparent Kd values of candidate aptamers were calculated by nonlinear regression analysis using one-site binding equation. For the BLI assay, aptamers were biotin-modified for easy immobilization on streptavidin biosensors. The assay procedure included five steps: (1) baseline: sensors immersed 60 s in PBS buffer, (2) loading, sensors immersed 300 s in 100 nM aptamer solution, (3) baseline: sensors immersed 180 s in PBST buffer, (4) association: sensors immersed 5 min with target at different concentrations in PBST buffer, and (5) dissociation: sensors immersed 5 min in PBST buffer. The shake speed was 1000 rpm, and the solution volumes used were all 200 μL. The response data and affinity parameter were obtained using the ForteBio Data analysis software version 12. All the response data obtained were subtracted from the blank controls, which contained only buffer. As for epitope-binding assays, proteins were biotinylated with a biotinylation kit for easy immobilization on streptavidin biosensors, and all experiments were also performed on the Octet Red 96 instrument with shaking at 1000 rpm. Cell culture and imaging Breast cancer cell MCF-7 and normal mammary epithelial cell MCF-10A were cultured in DMEM supplemented with 10% FBS (37 °C, 5% CO2). The two kinds of cells were separately seeded on confocal dishes and cultured overnight. After washing three times, cells were blocked at 4 °C with 1% FBS-containing PBS for 1 h. Then 1 μM FAM-modified sequences were incubated with these cells, respectively, at 4 °C for 30 min. The cells were washed again, and 1 mL PBS was supplemented. The obtained cells were imaged under the confocal laser scanning microscope. For free sugars competition experiments, the FAM-labeled aptamer was first saturated with 10 μM of different saccharides, and then incubated with breast cancer cell MCF-7 for confocal imaging. Results and Discussion Preparation and characterization of epitope-imprinted MNPs The two natural bovine pancreatic ribonucleases, glycosylated form (RNase B) and nonglycosylated form (RNase A), exhibit identical amino acid sequences and three-dimensional protein structures, except that RNase B has a single high mannose glycosylation site at Asn-34, with the possibility of attaching a high mannose glycan from Man5GlcNAc2 to Man9GlcNAc2.41,42 To prepare magnetic MIP for immobilization of the two proteins for positive and negative selection, the common C-terminal dodecapeptide of these proteins, NPYVPVHFDASV, was selected as an epitope. Epitope-imprinted MNPs were prepared according to a recently developed MIC strategy.38 The dodecapeptide epitope was first glycated as final imprinting template and then anchored onto BA-MNPs substrate for imprinting. The preparation process of MIP is illustrated in Supporting Information Scheme S1. The selectivity of BA-MNPs was first investigated. As shown in Supporting Information Figure S1, the boronate affinity toward cis-diol-containing compounds, including adenosine and horseradish peroxidase (HRP), was confirmed. To enhance the binding strength toward the peptide template, four silylating reagents, including APTES, UPTES, BnTES, and IBTES, were employed as functional monomers while TEOS was used as a cross-linker for the imprinting. These functional monomers can provide multiple interactions to the peptide template. To obtain a satisfactory imprinting effect, the monomer composition and imprinting time were optimized in terms of the imprinting factor (IF), which is an essential parameter for evaluating the imprinting effect and calculated by the ratio of the amount of template bound by an MIP over that by its corresponding nonimprinted polymer prepared under otherwise identical conditions. To simplify the optimization procedure, we selected the monomer ratios that have enabled successful imprinting of a range of epitope templates,38 and therefore most likely only a few trials with these ratios were needed in this study. As shown in Figures 1a–1c, the epitope-imprinted MNPs with the monomer ratio of APTES/UPTES/BnTES/IBTES/TEOS at 10:20:10:40:20 for 60 min (plus an extra 10 min cladding with TEOS as the only polymerizing agent to reduce nonspecific adsorption) exhibited the highest IF value (12.0). Such an IF is excellent due to the introduction of the cladding process, suggesting successful preparation of epitope-imprinted MIP with highly desirable binding properties. The epitope-imprinted MNPs under these conditions exhibited specific affinity toward both RNase A and RNase B, giving cross-reactivity less than 11% toward other proteins (Figure 1d). Figure 1 | Conditional optimization and selectivity characterization for epitope-imprinted MNPs. (a–c) Optimization of imprinting time for epitope-imprinted MNPs at monomer ratio of APTES/UPTES/BnTES/IBTES/TEOS: (a) 20:20:10:30:20, (b) 10:20:10:40:20, and (c) 10:10:10:50:20. (d) Selectivity test of imprinted and nonimprinted MNPs to different proteins. Error bars represent standard deviations for three parallel measurements. Download figure Download PowerPoint Selection of aptamers against high mannose type With glycoprotein RNase B as a positive target and nonglycosylated RNase A as a negative target, aptamers against high mannose-type oligosaccharides could be directly enriched during the selection progress. In addition, Man3-RNase was introduced as another negative target to eliminate unwanted binding of oligonucleotides to Man3GlcNAc2, which is the common N-linked core pentasaccharide structure. To prepare Man3-RNase, RNase B was partially deglycosylated by α-mannosidase treatment40 as illustrated in Supporting Information Figure S2, and the MALDI-TOF MS identification unambiguously confirmed that the digested product was exactly Man3-RNase. The sequence of the initial library for the selection is given in Supporting Information Table S1 while the detailed selection conditions are specified in Supporting Information Table S2. At each round of selection, the pressure was gradually enhanced by varying the incubation time and washing strength. As shown in Figure 2a, the bound fraction of ssDNA toward the positive target moderately increased as the screening round grew, and it reached a maximum after the 8th round, indicating successful enrichment of specific sequences. Subsequently, the specificities of the last three ssDNA pools from the 8th–10th round are confirmed in Figure 2b. These pools showed similarly high affinity to the positive selection target (RNase B), with limited binding to the two negative targets (RNase A and Man3-RNase). All the results suggest that the selection reached saturation at the 8th round, and thus its PCR product was sent for sequencing. Figure 2 | Evolution progress monitoring. (a) Evolution progress of specific ssDNA. (b) The binding affinity of the ssDNA pools after eighth, ninth, and tenth round toward positive and negative targets. Error bars represent standard deviations for three parallel measurements. Download figure Download PowerPoint Characterization of the selected aptamers Six candidate aptamers with high abundance were chosen after sequencing. The primary sequences are shown in Table 1, and the results of sequence alignment analysis indicate that no obvious conservative units were present in the six sequences except the primers at two ends ( Supporting Information Figure S3). By checking the sequences via the web-based server quadruplex forming G-rich sequences (QGRS) Mapper, four of them showed the possibility of forming G-quadruplexes ( Supporting Information Table S3). The 3′ primer set provides the highest chance of G4-forming aptamers, but the actual structure identification still needs further circular dichroism experiments. Because the binding ability of aptamers are closely related to their folding structures, the secondary structures of the aptamers were analyzed. As shown in Supporting Information Figure S4, the stem ring was the main structural form. The affinities and specificities of these candidate aptamers (AP1–AP6) were preliminarily evaluated using fluorescence assay. All six aptamers showed strong binding to RNase B as compared with RNase A and Man3-RNase, among which aptamer AP1, AP2, and AP5 exhibited the highest specificity (Figure 3a). Figure 3 | Property characterization of aptamers selected. (a) Preliminary evaluation of candidate aptamers AP1-6. (b–d) Characterization of the champion aptamer AP5. (b) The affinity to RNase B and (c) specificity to different proteins by fluorescence intensity method. (d) The binding affinity measurement toward MAN-5 by BLI method. Error bars represent standard deviations for three parallel measurements. Download figure Download PowerPoint Table 1 | The Sequences of Aptamer Candidates Aptamer Sequence (5′-CTTCTGCCCGCCTCCTTCC-(N25)-GGAGACGAGATAGGCGGACACT-3′) dG (kcal/mol) AP1 CTCATCCGGCCGTCGCCGGTTGGGC −14.98 AP2 AGGCACGCTGGTATCTGGTTAAGTG −11.47 AP3 CCGTGGCGCACCCTCAACCTCTGTG −9.37 AP4 CACATTGCGCGTGCGGTGATCGCCT −9.09 AP5 CCCAGCGAATACACACGGCTAGCGA −7.79 AP6 CCAGCTACGACCAGCCCGCATCCAT −7.16 Further, the apparent dissociation constants (Kd) of three aptamers (AP1, AP2, and AP5) were assessed by fluorescence assay and BLI. All these three aptamers exhibited satisfactory binding ability to RNase B (Figure 3b and Supporting Information Figures S5a and S5b). Particularly, aptamer AP5 exhibited the highest affinity, with a Kd value of (2.18 ± 0.47) × 10−7 M. Relevant parameters for BLI measurements are shown in Supporting Information Table S4. The results are considered reliable, with mutual authentication by the two methods and the R2 values not less than 0.93. As comparison, for the commonly used mannose-binding lectins from plants (ConA, BanLec, UDA, and GNA) or algae (CV-N, SVN, and GRFT), their binding affinities range from millimolar to sub-micromolar in the monomer or oligomerization state.43,44 Therefore, the generated aptamers are quite acceptable. To characterize the selective binding to high mannose sugars, the specificities of aptamers AP1, AP2, and AP5 at the protein level were investigated. As shown in Figure 3c and Supporting Information Figures S5c and S5d, these aptamers had obviously strong binding toward high mannose glycans-containing proteins, including RNase B, ovalbumin (OVA), recombinant human transferrin receptor-1 (TfR1), and human epidermal growth factor receptor-2 (HER2) (see Supporting Information Figures S2a and S6 for the main glycan structures). Other glycoproteins containing no high mannose glycans, including glycoproteins alpha fetoprotein (AFP), recombinant erythropoietin (EPO), HRP, and transferrin (TRF) (see Supporting Information Figure S7 for the main glycan structures), as well as nonglycoproteins, including catalase and bovine serum albumin (BSA), showed much lower signals. Overall, the recognition performance of the three aptamers were satisfactory, among which aptamer AP5 showed the best property. We further investigated the binding of aptamer AP5 to oligomannose-5 (Man5GlcNAc2 or MAN-5) and oligomannose-9 (Man9GlcNAc2 or MAN-9). As shown in Figure 3d and Supporting Information Figure S8, it yielded a Kd value of 3.64 and 14.9 μM to these high mannose glycans, respectively. The results indicate that the aptamer preferentially bound with MAN-5 as compared with MAN-9. This can be attributed to the high proportion of Man5GlcNAc2 glycoform in RNase B ( Supporting Inform