Angular Lesions Research Articles

A critical review on bacterial black spot of mango caused by Xanthomonas citri pv. mangiferaeindicae: Current status and direction for future research

AbstractBacterial black spot (BBS) of mango, caused by the bacterium Xanthomonas citri pv. mangiferaeindicae, is an emerging disease affecting mango‐producing areas in Asia, Africa, Oceania, and the Americas. The disease spreads primarily through wind‐driven rain and farm implements, and its host range is limited, affecting mango, cashew, and pepper plants. BBS is characterized by dark, angular lesions with elevated borders on infected leaves and fruits in the lower and upper parts of the tree canopy. Infected plants display numerous tiny water‐soaked black lesions on leaves, fruits, and stems. Early symptoms on leaves include tiny, veined, water‐soaked patches with angular black dots and occasionally chlorotic spots. Managing BBS presents challenges, but various control measures have shown effectiveness in different regions. Integrated disease control measures, such as cultural methods and removing diseased plant parts, could further reduce BBS prevalence in the field. This paper reviews the detrimental effects associated with the disease, while also offering a concise overview of the existing body of research concerning BBS and its implications for mango cultivation.

Aphelenchoides besseyi Parasitizing Common Bean in Brazil.

Aphelenchoides besseyi is the causal agent of soybean green stem and foliar retention syndrome known as "Soja Louca II." This nematode has recently been reported parasitizing cotton in Brazil. In Costa Rica, it causes the symptoms known as "amachamiento" and false angular spots in common bean (Phaseolus vulgaris). Due to the great importance of beans to Brazilian agriculture, the objective of this research was to study the pathogenicity of A. besseyi in common bean under greenhouse conditions, including its endoparasitic relationships by staining root and shoot system tissues with fuchsin acid. In addition, A. besseyi was collected and quantified from shoot systems 30 days after inoculation by washing the tissue in water and blender centrifugal flotation. We observed the symptoms of amachamiento, leaf and vein deformation in the expanded trifoliate leaves, and also leaves with necrotic, brown to reddish and angular lesions, characteristics from false angular spot, and deformed stems characterized by enlargement of nodes, retortions, and necrotic lesions. High numbers of nematodes were found inside common bean plants. This is the first report of the pathogenicity and symptoms caused by A. besseyi in common bean in Brazil. These findings are important for development of management strategies to avoid losses on bean cropped in infested areas.

First Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Georgia, U.S.A.

HomePlant DiseaseVol. 104, No. 3First Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Georgia, U.S.A. PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Georgia, U.S.A.M. E. Ali, O. Hudson, S. Waliullah, J. Brock, B. Hayes, J. L. Williams-Woodward, and J. E. OliverM. E. Ali†Corresponding author: M. E. Ali; E-mail Address: ma49268@uga.eduhttp://orcid.org/0000-0002-5871-5055Department of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, O. HudsonDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, S. WaliullahDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, J. BrockDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author, B. HayesUniversity of Georgia Cooperative Extension, Mitchell County, Camilla, GA 31730Search for more papers by this author, J. L. Williams-WoodwardDepartment of Plant Pathology, University of Georgia, Athens, GA 30602Search for more papers by this author, and J. E. OliverDepartment of Plant Pathology, University of Georgia, Tifton, GA 31793Search for more papers by this author AffiliationsAuthors and Affiliations M. E. Ali1 † O. Hudson1 S. Waliullah1 J. Brock1 B. Hayes2 J. L. Williams-Woodward3 J. E. Oliver1 1Department of Plant Pathology, University of Georgia, Tifton, GA 31793 2University of Georgia Cooperative Extension, Mitchell County, Camilla, GA 31730 3Department of Plant Pathology, University of Georgia, Athens, GA 30602 Published Online:30 Dec 2019https://doi.org/10.1094/PDIS-09-19-1962-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Blackberries (Rubus L. subgenus Rubus) are small, round, aggregate berries comprising a cluster of tiny fruits called drupelets that grow on flowering shrubs or trailing vines (Clark et al. 2007). The acreage of blackberry production in Georgia has increased 10-fold in the last 15 years to 880 acres (NASS 2017). Downy mildew of blackberry, caused by the oomycete pathogen Peronospora sparsa, is a systemic disease that impacts blackberry production in many regions worldwide. Symptoms of downy mildew on blackberry include yellowing on the upper leaf surface and reddish-brown angular lesions with necrotic centers and chlorotic margins. In May 2019, leaf symptoms typical of blackberry downy mildew were observed on blackberry cultivar ‘Ouachita’ plantlets at a nursery in Mitchell County, Georgia. Initial identification was done based on the morphological characteristics of the sporangia and sporangiophores. Round or slightly ovoid sporangia were observed that were colorless to yellowish-brown, consistent with Peronospora sp. (Gubler and Rebollar-Alviter 2017). The identification of P. sparsa was further confirmed using nucleic acid-based molecular methods directly on infected plant tissue. Genomic DNA was extracted from symptomatic leaf tissue and tested for the presence of P. sparsa by targeting the P. sparsa-specific rDNA-ITS region using “P” primer pair P1 (5′-CACGTGAACCGTATCAACC-3′) and P2 (5′-GATAGGGCTTGCCCAGTAG-3′) with an amplicon size of 94 bp (Hukkanen et al. 2006). PCR reactions produced the expected sizes of the fragments for P. sparsa. The amplified products were then sequenced and subjected to BLAST analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for further identification. Sequence analysis revealed that the obtained partial sequence of P. sparsa-specific rDNA-ITS (GenBank submission no. MN477916) shared 100% identity to corresponding sequences from P. sparsa (accession no. Y15816). Samples were also tested for the presence of P. sparsa by real-time PCR using the same set of “P” primers. For real-time PCR, plant internal control primer pair R1 (5′-CAAACGACTCTCGGCAAC-3′) and R2 (5′-CCTCGGCCTAATGGCTT-3′) was used to target the highly conserved region of 5.8S plant ribosomal DNA (Hukkanen et al. 2006). The real-time PCR assay was performed in a Cepheid smart cycler II (Sunnyvale, CA) using iQ SYBR Green Supermix (BioRad Laboratories, Hercules, CA) in a 25-µl reaction according to the manufacturer’s protocol (Harper et al. 2010). All four samples extracted from symptomatic leaves were positive based on the real-time PCR assay. In addition, Koch’s postulates were fulfilled to verify the pathogenicity of the P. sparsa. Leaves from four uninfected blackberry plants (also cv. Ouachita) were surface sterilized, laid under sporulating leaf tissue, and incubated at 17°C with a 12-h photoperiod in a moist chamber. After 16 days, on the previously uninfected leaves, sporangiophores and sporangia consistent with P. sparsa developed. As a control, additional leaves from the same four plants were surface sterilized, placed in a moist chamber, incubated at 17°C with a 12-h photoperiod, and examined 16 days later. No lesions or sporulation developed on the uninoculated controls. To the best of our knowledge, this is the first report of P. sparsa causing downy mildew on blackberry in Georgia. Our findings suggest that Georgia blackberry growers should be aware of this disease and accordingly establish management measures for P. sparsa.The author(s) declare no conflict of interest.

First Report of Downy Mildew on Blackberry Caused by Peronospora sparsa in Arkansas

In March of 2014, blackberry (Rubus fruticosus) greenhouse seedlings with leaf symptoms that included yellowing on the leaf surface and reddish brown angular lesions with necrotic centers and chlorotic margins were detected in the University of Arkansas Fruit Research Station in Clarksville, AR (35°32.065' N, 93°24.3564' W). Symptoms were observed on multiple blackberries in the greenhouse, with an estimated prevalence of 25%. Three symptomatic samples of the affected plants were submitted to the Plant Health Clinic in Fayetteville, AR, for diagnosis. Sporulation was observed on the underside of the symptomatic leaf tissue. Hyaline sporangiophores were observed emerging from stomata on the undersides of leaves, 295 to 620 × 4 to 6 μm with long, straight trunks and were branched 3 to 4 times with bifurcated tips, with a length of 5 to 23 μm. Typically, one branch of each pair curved inward and one reflexed. Sporangiophores ended with sporangia that were round or slightly ovoid, colorless to yellowish-brown, and 14 to 22 × 11 to 18 μm. The causal agent was morphologically identified as Peronospora sparsa Berk (1,2). The identification was confirmed using a molecular method directly from plant tissue. DNA was extracted from two samples (~3 × 3 mm) from each of three symptomatic leaves, followed by PCR amplification using P. sparsa-specific rDNA-ITS region primers P1: 5'-CACGTGAACCGTATCAACC-3' and P2: 5'-GATAGGGCTTGCCCAGTAG-3' (GenBank Accession No. Y15816) (4). DNA amplification was successful, resulting in a product of 94 bp, confirming that P. sparsa was present in the symptomatic blackberry tissue. Sporulating leaf tissue was laid on the underside of surface sterilized blackberry leaves from three plants with a similar genetic background and incubated at 17°C with a 12-h photoperiod in a moist chamber. Sporangiophores and sporangia developed on the underside of lesions on previously uninfected leaves 16 days after inoculation. As a control, leaves from the same three plants were surface sterilized and placed in a moist chamber and incubated at 17°C with a 12-h photoperiod and examined 16 days later. No lesions or sporulation developed on the controls. Previously, P. sparsa has been reported on blackberry in California (3) and Mexico (5). To our knowledge, this is the first report of P. sparsa causing downy mildew on blackberry in Arkansas.

First Report of Bacterial Fruit Blotch on Melon Caused by Acidovorax citrulli in California.

In July 2013, a melon plant sample (Cucumis melo cv. Saski) with disease symptoms resembling bacterial fruit blotch (BFB), was collected from a 10-acre field located in Yolo County, California, and submitted to the Plant Pest Diagnostics Center of the CDFA. Melon leaves had small (5 to 10 mm in diameter), tan to dark reddish-brown, angular lesions surrounded by yellow halos, and larger V-shaped lesions that extended from the leaf margins to the midrib. Bacterial streaming was observed at 400× magnification. The bacterium isolated from a leaf tissue wet mount formed smooth, round, cream-colored, non-fluorescent colonies on Pseudomonas F agar, was gram-negative, rod-shaped, aerobic, and oxidase-positive. The strain grew at 41°C and produced a strong hypersensitive response on tobacco (Nicotiana tabacum) 24 h after tissue infiltration. Based on a positive immunoassay test for Acidovorax citrulli (Eurofins STA Lab, Inc., Longmont, CO) and positive real-time PCR assays using species-specific primer sets, BX-L1/BX-S-R2 (1) and ZUP2436/2437 (4), the strain was identified as A. citrulli. A 360-bp fragment of the 16S ribosomal RNA gene was amplified using conventional PCR with primers WFB1 and WFB2 (3). The fragment, GenBank Accession No. KJ531595, showed 100% identity with the corresponding regions of A. citrulli (CP000512) strain AAC00-1 by BLAST query. Pathogenicity tests were performed by injecting 0.5 to 1 ml suspensions of the bacteria (106 CFU/ml) under the rind of three mature honeydew fruit (Cucumis melo var. indorus), three watermelon fruit (Citrullus lanatus cv. Sugar Baby), and into the cotyledons of ten, 10-day-old watermelon seedlings (cv. Sugar Baby). The fruit and seedlings were incubated in plastic bags at 30°C and similar treatments with sterile water served as negative controls. After 4 days, the seedlings inoculated with the suspect strain exhibited dark brown necrotic lesions with yellow halos that later coalesced, causing the cotyledons to collapse. Seven days after inoculation, the honeydew fruit exhibited dry, rotten gray cavities (4 to 6 cm in diameter) in the pericarp tissue below the rind. In contrast, the watermelon fruit had completely collapsed in a watery rot after 7 days. No symptoms were observed on the negative control fruits and seedlings treated with water. The pathogen was re-isolated from the inoculated fruit and seedlings and confirmed as A. citrulli by species-specific PCR and immunoassay as described above. The melon seed lot used to plant the field in Yolo County, CA, also tested positive for A. citrulli using species-specific real-time PCR assays (1,4). DNA fingerprinting by pulse field gel electrophoresis of Spe I-digested whole cell genomic DNA showed that all of the California A. citrulli strains were members of subgroup II (haplotype C strain) (3). These haplotypes normally occur on watermelon. BFB is a seed-transmitted disease of cucurbits and a major concern for national and global seed trade. First observed in United States commercial watermelon fields in 1989, BFB can cause economic losses up to 90% for commercial watermelon, cantaloupe, and honeydew growers (1,2). While BFB routinely occurs in the southeastern United States, this is the first official record of the disease in California.

Novel curved balloon catheter for dilating postoperative angled lesions associated with congenital heart disease.

This study aimed to analyze the surface stress generated by a novel curved balloon and assess its efficacy for treating angular lesions associated with congenital heart disease. Obstructions at the anastomosis of aortopulmonary shunts and cavopulmonary connections may occur postoperatively. Catheter interventions are often performed for such lesions; however, acute angulation may cause balloon slippage or inappropriate stress on the vessel wall. We dilated the curved balloon in a curved vessel model and measured the resultant wall stress and its distribution. Clinical evaluations were performed using this balloon in angled lesions. In the curved vessel model, curved balloons generated uniform stress on the lesser and greater curvatures (curved type, lesser/greater = 0.343 MPa/0.327 MPa; P = 0.61), whereas straight balloons caused disproportionate stress (straight type, lesser/greater = 0.358 MPa/0.254 MPa; P = 0.19). However, the difference in average stress was not statistically significant. Furthermore, the stress was uniform along the entire length of the curved balloon, but differed between the mid and end portions of the straight balloon. Curved balloon dilations were performed for 10 lesions in 7 patients. The curved balloon conformed well to the angulated lesion without slipping. The median percent change in the minimal lumen diameter (MLD) was 64% (range, 0-206%). In 5 lesions, MLD increased by ≥50%. Oxygen saturation increased by 5% (0-9%). Although further clinical evaluation is necessary, this novel curved balloon may be a reasonable alternative in angled lesions, providing better conformability and preventing excessive stress to the vessel wall adjacent to the stenosis.

First Report of QoI-Resistant Downy Mildew (Plasmopara viticola) of Grape (Vitis vinifera cv. Vidal Blanc) in Kentucky.

Fungicides in the quinone outside inhibitor class (QoI, also referred to as strobilurins, FRAC group 11) are relied upon for management of a wide range of diseases, including anthracnose, black rot, downy mildew, and powdery mildew on grape. In June 2012, a grape grower from Anderson County in central Kentucky reported a planting of grapevines (Vitis vinifera cv. Vidal Blanc) with 90% downy mildew (Plasmopara viticola) incidence that would not respond to applications of the QoI fungicide Abound 2.08F (22.9% azoxystrobin, Syngenta Crop) or the QoI-containing fungicide Pristine (12.8% pyraclostrobin + 25.2% boscalid, BASF Corporation). Symptoms included yellow irregular lesions or brownish red angular lesions with necrosis on upper sides of leaves. Undersides of leaves contained dense white sporulation. The grower confirmed usage of 4 to 5 applications each of Abound and Pristine fungicides between 2011 and 2012, which exceeded the maximum number of applications allowed per season, as expressed on individual labels. Samples were collected from throughout the 0.4-ha vineyard, and the pathogen was identified as Plasmopara viticola based on morphology of sporangia and sporangiophores (2). Fungicide sensitivity was determined using methods published by Wong and Wilcox (3). Leaves were selected from the 3rd to 6th leaf position from disease-free plants. Nine-millimeter leaf discs were surface disinfested and treated with fungicide concentrations ranging from one-half of the lowest labeled rate to twice the highest label rate (850, 170, 270, and 540 mg/l azoxystrobin and 40, 80, 120, and 240 mg/l pyraclostrobin). Leaf discs were inoculated by placing 10-μl droplets of sporangial suspensions (1 × 104 sporangia per ml) and then incubated at room temperature (22 to 24°C) under fluorescent lights with a 12-h photoperiod (1,3). Dense white fungal growth developed within 10 days; discs treated with water did not develop signs of disease. Fungicide sensitivity was evaluated by determination of the effective concentration (EC50) (3). Leaf discs were examined under a dissecting microscope after 14 days to determine presence of fungal growth; those with visible sporangia and/or sporangiophores were considered diseased. Resulting EC50 concentrations were 420 and 390 mg a.i./l for Abound (azoxystrobin) and Pristine (pyraclostrobin), respectively. This was higher than EC50 ranges of resistant isolates reported by Baudoin et al. (100 and 25 mg/l for azoxystrobin and pyraclostrobin, respectively) (1). Additionally, ranges were higher than EC50 values of isolates not exposed to QoI fungicides reported by Baudoin et al. (1) and higher (14× and 39×, respectively) than those previously determined from P. viticola from Kentucky that were not exposed to QoI fungicides (Ward, unpublished). These EC50 ranges were also much higher than recommended label application rates, which ranged from 170 to 270 mg a.i./l for Abound and from 80 to 120 mg a.i./l for Pristine. Results indicated that P. viticola from this vineyard became insensitive to the fungicides Abound and Pristine. This will lead to future fungicide failures and increased incidences of downy mildew in vineyards. Although QoI-resistant P. viticola has been reported in Europe and elsewhere in the United States, this is the first documented report of QoI-resistant P. viticola in Kentucky. A complete survey is necessary to determine whether this phenomenon is widespread within the state.

First Report of a Leaf Spot on Greenhouse Tomato Caused by Cladosporium oxysporum in China

Tomato (Lycopersicon esculentum Mill.) is an important vegetable crop grown in Liaoning Province, China. In May 2012, dark brown, angular lesions were observed on lower, older leaves of 5-month-old tomato plants of cv. Bi Jiao in commercial greenhouses in Dawa County, which is administered by Panjin City in Liaoning Province. The irregularly shaped lesions varied in size from 1 to 7 mm in diameter. The necrotic lesions were usually surrounded by a yellow halo. Sporulation was rarely seen on the leaf surfaces. This contrasts with tomato leaf mold caused by Passalora fulva, in which the conidia develop as a velvety brown patch in lesions. By July 2012, the same disease was found in research greenhouses of Shenyang Agriculture University and Liaoning Academy of Agricultural Sciences. The incidence of symptoms was 30 to 40%. To identify the pathogen, leaf pieces (3 to 5 mm) with both infected and healthy portions were taken at the edge of lesions and surface-disinfected by placing them in 75% ethanol for 5 s, then transferred to a 0.1% aqueous mercuric chloride solution for 30 s and rinsed with sterilized water three times. The sections were placed on potato dextrose agar (PDA) at 25°C in the dark. Ten pure fungal cultures were obtained from single spores. For studies of microscopic morphology, isolates were grown on synthetic nutrient agar (SNA) in slide cultures. Conidia ranged in shape from subglobose or ovoid (2 to 4 × 2 to 3 μm) to subcylindrical (4.5 to 17.8 × 2.4 to 4.5 μm). Conidiophores were straight to slightly flexuous with typical nodes. The internal transcribed spacer (ITS) region from isolate PJ12-36 was amplified using primers ITS1 and ITS4 and sequenced (GenBank Accession No. KC137278). The 560-bp amplicons had 99% identity to C. oxysporum (JQ775499). On the basis of morphological characteristics (1) and nucleotide homology, the isolate was identified as C. oxysporum. Koch's postulates were fulfilled in the laboratory on fully expanded leaves of 5-week-old tomato plants 'Moneymaker' inoculated with C. oxysporum conidial suspensions (107 conidia ml-1). Eight seedlings were incubated in an illuminated incubator at 25°C for 8 to 10 days with 85% relative humidity. Characteristic lesions that developed on inoculated leaves were similar in appearance to those observed on diseased tomato plants in the greenhouse. C. oxysporum was reisolated from lesions and its identity was confirmed by morphological characteristics. C. oxysporum was previously reported as the causal agent of a leaf spot disease of pepper (2) and greenhouse tomato (4). To our knowledge, this is the first report of C. oxysporum causing disease on tomato foliage in China. It is noteworthy that C. oxysporum has led to a decline in pepper yield in northern regions of China (3). In addition, pathogenicity tests showed that the isolate W10-02 from pepper and the isolate PJ12-36 from tomato could each cause damage to the opposite host, producing symptoms similar to those observed on the host of origin. Studies are needed on strategies to manage C. oxysporum in crops, because its prevalence may cause yield loss both on tomato and pepper in northern regions of China.

First Report on the Occurrence of A2 Mating Type of the Cucurbit Downy Mildew Agent Pseudoperonospora cubensis in China.

Pseudoperonospora cubensis is a foliar pathogen of cucurbits. In cucumber, it produces chlorotic, angular lesions with dark sporangia on their under-surface. The distribution of pathotypes and mating types of P. cubensis were investigated in seven provinces in China. Twenty-nine isolates were obtained from Guangdong, Anhui, Hubei, Sichuan, Shandong, Beijing, and Harbin, one to six isolates from each province. They were collected from cucumber during summer 2011, except those from Harbin, which were collected from cucumber in summer 2012. Isolates were tested for pathogenicity and mating type. Pathogenicity was tested by inoculation of detached leaves of: cucumber (Cucumis sativum cvs. Bet-Alpha, SMR18), melon (Cucumis melo reticulatus cv. Ananas-Yokneam), pumpkin (Cucurbita maxima cv. Tripoli), squash (Cucurbita pepo, cv. Beruti), butternut gourd (Cucurbita moschata cv. Waltham), watermelon (Citrullus lanatus, cv. Malali), and sponge gourd (Luffa cylindrica, cultivar unknown). Mating type was determined by oospore production in melon leaf discs inoculated with mixed sporangia of a test isolate and A1 or A2 tester isolates, as recently described (2). The results showed that 22 isolates belonged to pathotype 3, sporulating on cucumber and melon; five isolates belonged to pathotype 6, sporulating on cucumber, melon, pumpkin, squash, and butternut gourd; one isolate belonged to pathotype 5, sporulating on the above five species and watermelon (1), and one isolate was capable of sporulating on the mentioned five species and sponge gourd, herein called pathotype 7. Of the 29 isolates tested, 22 belonged to the A1 mating type, six to the A2 mating type, and one did not produce oospores with either testers. Of the six A2 isolates, two originated from Sichuan, one from Beijing, and three from Harbin. All 22 isolates belonging to pathotype 3 were A1, whereas the other six isolates (four pathotype 6, one pathotype 5, and one pathotype 7) were A2. Crosses made between Chinese isolates belonging to opposite mating types resulted in the formation of abundant oospores in detached melon or cucumber leaves. The results prove that the A2 mating type of P. cubensis occurs in China. This explains the abundant occurrence of oospores of P. cubensis in nature in China (4). The data corroborate with Runge et al. (3), who suggested that the recent changes in the population structure of P. cubensis around the world resulted from the migration of a new genotype of P. cubensis from the Far East to Europe and the U.S.A. In Israel, a new pathotype attacking both Cucumis and Cucurbita appeared in 2002 (1), and A2 mating type first appeared in 2010 (2).

A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA.

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose-CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3'), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s.

First Report of Tomato Gray Leaf Spot Disease Caused by Stemphylium solani in Malaysia.

In June 2011, tomatoes (Solanum lycopersicum) in major growing areas of the Cameron Highlands and the Johor state in Malaysia were affected by a leaf spot disease. Disease incidence exceeded 80% in some severely infected regions. Symptoms on 50 observed plants initially appeared on leaves as small, brownish black specks, which later became grayish brown, angular lesions surrounded by a yellow border. As the lesions matured, the affected leaves dried up and became brittle and later developed cracks in the center of the lesions. A survey was performed in these growing areas and 27 isolates of the pathogen were isolated from the tomato leaves on potato carrot agar (PCA). The isolates were purified by the single spore technique and were transferred onto PCA and V8 agar media for conidiophore and conidia production under alternating light (8 hours per day) and darkness (16 hours per day) (4). Colonies on PCA and V8 agar exhibited grey mycelium and numerous conidia were formed at the terminal end of conidiophores. The conidiophores were up to 240 μm long. Conidia were oblong with 2 to 11 transverse and 1 to 6 longitudinal septa and were 24 to 69.6 μm long × 9.6 to 14.4 μm wide. The pathogen was identified as Stemphylium solani on the basis of morphological criteria (2). In addition, DNA was extracted and the internal transcribed spacer region (ITS) was amplified by universal primers ITS5 and ITS4 (1). The PCR product was purified by the commercial PCR purification kit and the purified PCR product sequenced. The resulting sequences were 100% identical to published S. solani sequences (GenBank Accestion Nos. AF203451 and HQ840713). The amplified ITS region was deposited with NCBI GenBank under Accession No. JQ657726. A representative isolate of the pathogen was inoculated on detached 45-day-old tomato leaves of Malaysian cultivar 152177-A for pathogenicity testing. One wounded and two nonwounded leaflets per leaf were used in this experiment. The leaves were wounded by applying pressure to leaf blades with the serrated edge of a forceps. A 20-μl drop of conidial suspension containing 105 conidia/ml was used to inoculate these leaves (3). The inoculated leaves were placed on moist filter paper in petri dishes and incubated for 48 h at 25°C. Control leaves were inoculated with sterilized distilled water. After 7 days, typical symptoms for S. solani similar to those observed in the farmers' fields developed on both wounded and nonwounded inoculated leaves, but not on noninoculated controls, and S. solani was consistently reisolated. To our knowledge, this is the first report of S. solani causing gray leaf spot of tomato in Malaysia.

Bacterial Leaf Spot of Zinnia Caused by Xanthomonas campestris pv. zinniae, a New Disease in Korea.

In September 2011, bacterial leaf spot was observed on zinnia plants (Zinnia elegans L.) grown in a garden in Suwon, Korea. Leaf symptoms included angular lesions that were yellow or brown-to-reddish brown in the center. Bacterial isolates (BC3293 to BC3299) were recovered on trypticase soy agar from lesions surface-sterilized in 70% ethyl alcohol for 1 min. Pathogenicity of the isolates was confirmed by spray inoculation with a bacterial suspension (106 CFU/ml) prepared in sterile distilled water and applied to zinnia plants at the four- to five-leaf growth stage (two plants per isolate). Sterile distilled water was used as the negative control. The inoculated plants were incubated in a greenhouse at 26 to 30°C and 95% relative humidity. Characteristic leaf spot symptoms developed on inoculated zinnia plants 5 days after inoculation. No symptoms were observed on the negative control plants. The bacterium reisolated from the inoculated leaves was confirmed through gyrB gene sequence analysis (3). All isolates were gram-negative, aerobic rods, each with a single flagellum. Isolates were positive for catalase and negative for oxidase. The biochemical and physiological tests for differentiation of Xanthomonas were performed using methods described by Shaad et al. (2). The isolates were positive for mucoid growth on yeast extract-dextrose-calcium carbonate agar, growth at 35°C, hydrolysis of starch and esculin, protein digestion, acid production from arabitol, and utilization of glycerol and melibiose. Colonies were negative for ice nucleation, and alkaline in litmus milk. The gyrB gene (870 bp) and the 16S-23S rRNA internal transcribed spacer (ITS) regions (884 bp) were sequenced to aid in identification of the original field isolates using published PCR primer sets Xgyr1BF/Xgyr1BR (3) and A1/B1 (1), respectively. Sequence of the gyrB gene (GenBank Accession Nos. JQ665732 to JQ665738) from the zinnia field isolates shared 100% sequence identity with the reference strain of Xanthomonas campestris pv. zinniae (GenBank Accession No. EU285210), and the ITS sequences (GenBank Accession Nos. JQ665725 to JQ665731) had 99.9% sequence identity with X. campestris pv. zinnia XCZ-1 (GenBank Accession No. EF514223). On the basis of the pathogenicity assays, biochemical and physiological tests, and sequence analyses, the isolates were identified as X. campestris pv. zinniae. To our knowledge, this is the first report of bacterial leaf spot of zinnia caused by X. campestris pv. zinniae in Korea. The disease is expected to result in economic and aesthetic losses to plants in Korean landscapes. Thus, seed treatment with bactericides will be required to control the bacterial leaf spot of zinnia before planting.

First Report of Anthracnose Caused by Colletotrichum acutatum on Tamarillo in the United States.

An aggressive anthracnose disease was identified on greenhouse and home garden cultivated tamarillo (Solanum betaceum) in 2010 and 2011 in Prince George's and Montgomery counties of Maryland. Angular lesions, dark brown at the edges and tan at the interior, eventually engulfed leaves of mature, fruit bearing trees. Additional lesions were seen on petioles and stems, resulting in stem girdling. Flower clusters were also attacked, but fruit lesions were not observed. Sporulation was evident only on stem tissue. In greenhouse-cultivated 3- to 8-month-old immature plants were found to be infected in the foliar and apical regions, resulting in death. Cultures obtained from surface-sterilized leaf and stem tissue of multiple disease samples cultivated on potato dextrose agar consistently resulted in a single fungal isolate. Molecular identification was carried out by sequence analysis of the region amplified using ITS1 forward and ITS4 reverse primers (ITS1 and 2, 5.8S ribosomal RNA). Full matches were found to Glomerella acutata (anamorph Colletotrichum acutatum Simmonds). A representative sequence was submitted to GenBank as JN863589. Cultures were reddish gray with masses of macroscopically mucilaginous orange-brown spores. Conidia were fusiform, measuring 14.0 ± 2.3 × 5.7 ± 0.7 μm. No setae were present, but structures resembling immature perithecia were present, embedded in the agar, a characteristic of C. acutatum Group D isolates (2). Six immature plants (5 months old) and three mature plants (2 years old) were spray inoculated with 1 × 104 conidia per ml of water into apical regions and on the upper foliage. Plants were enclosed in clear plastic bags and incubated for 3 days. Two noninoculated plants of each age were maintained as controls. Bags were removed and plants were maintained in the greenhouse at 25°C. Within 2 weeks, all inoculated plants expressed disease symptoms. Lesions on the foliage were evident as well as the apical regions. Lesions progressed, killing the upper regions of the plant within 1 month. Isolations consistently resulted in cultures of C. acutatum. A culture obtained from infected tissue derived from the first inoculation study was used to repeat Koch's postulate. Anthracnose of tamarillo has been reported in South America and New Zealand where commercial production is concentrated, however, it is primarily a fruit disease (1). Our isolate is principally a foliar and stem pathogen. Host range for C. acutatum is wide enough that our isolate likely originated from another host since there is no widespread tamarillo production in the United States. Interestingly, solanaceous crop plants are generally subject to infection by C. coccodes, not C. acutatum, however, this may be changing (3).

Bacterial Leaf Spot of Iceberg Lettuce Caused by Xanthomonas campestris pv. vitians Type B, a New Disease in South Korea.

In 2008 and 2009, a leaf spot of iceberg lettuce (Lactuca sativa var. capitata) was observed in two fields of Pyeongchang District and Jecheon City in South Korea, respectively. Disease incidence averaged 3.5% in the two fields. Symptoms on leaves included black, water-soaked, angular lesions with halos. Two bacterial isolates, BC2932 and BC3095, were recovered on trypticase soy agar (TSA) from lesions surface sterilized in 70% ethyl alcohol for 1 min. Both isolates had gram-negative, aerobic rods each with a single flagellum. Colonies on peptone sucrose agar were yellow and raised with smooth margins. Pathogenicity was evaluated on 3-week-old lettuce plants (cv. Avi). Bacteria were grown on TSA for 48 h at 28°C. A bacterial suspension in sterile distilled water (100 ml at 1 × 105 CFU/ml) was sprayed onto three plants for each isolate. Plants were maintained in a growth chamber at 28°C and 90% relative humidity. Isolates induced identical symptoms 3 days after inoculation as those originally observed in the fields. Pathogenicity of bacteria reisolated 10 days after inoculation from lesions surface sterilized in 70% ethyl alcohol was confirmed by inoculation as described above. No symptoms were observed on two control plants treated with sterile distilled water. Identity of bacteria reisolated from inoculated leaves was confirmed by PCR with specific primer set B162 (1). DNA of the original two isolates and 12 reisolates (two per inoculated plant) was amplified by PCR assay using Xanthomonas campestris pv. vitians Type B LMG938 (= BC2575) as a positive control treatment and X. axonopodis pv. vitians strain CFBP2538 (= BC2610) as a negative control treatment. The PCR amplicon for each of the 14 test isolates was identical in size to that of X. campestris pv. vitians Type B LMG938. No fragment of X. axonopodis pv. vitians CFBP2538 was amplified. Patterns of metabolic fingerprinting of the original two isolates were more similar to those of X. campestris pv. vitians Type B LMG938 than X. axonopodis pv. vitians CFBP2538 using Biolog Microbial Identification System Version 4.2 (Biolog Inc., Hayward, CA). X. campestris pv. vitians Type B LMG938, BC2932, and BC3095 were identified as X. campestris pv. pelargonii with a Biolog similarity index of 0.68, 0.45, and 0.78, respectively. Strain X. axonopodis pv. vitians CFBP2538 was identified as X. campestris pv. juglandis with an index of 0.48. The dnaK (958 bp), gyrB (859 bp), and rpoD (884 bp) regions were partially sequenced to aid in identification of the two original field isolates as well as X. campestris pv. vitians Type B LMG 938 and X. axonopodis pv. vitians CFBP2538 using reported PCR primers (3). Sequences were compared with those of reference strains of Xanthomonas in GenBank. Sequences of the three genes from the two lettuce field isolates shared 100% similarity to those of the genes of X. campestris pv. vitians Type B LMG938 and had a distance index value of 0.040, 0.099, and 0.046, respectively, with the reference strain of X. axonopodis pv. vitians CFBP2538 determined by p-distance modeling using MEGA Version 4.1 (2). Based on the pathogenicity test and sequence analyses, the isolates were identified as X. campestris pv. vitians Type B. To our knowledge, this is the first report of bacterial leaf spot of iceberg lettuce caused by X. campestris pv. vitians Type B in South Korea.

First Report of Bacterial Blight on Conventionally and Organically Grown Arugula in Nevada Caused by Pseudomonas syringae pv. alisalensis

In 2007, leaf spots were observed on arugula (Eruca vesicaria subsp. sativa cv. My Way) grown under sprinkler irrigation for fresh market in conventional and organic production fields located above 1,200 m (4,000 feet) in Nevada (NV). Approximately 30% of each planting was affected. Initially, symptoms consisted of small (<2 mm in diameter), angular, water-soaked spots visible from both sides of the leaf, some of which developed a shot-hole appearance. The spots enlarged and coalesced, remaining angular. Lesions ranged from black to tan, occasionally developing a chlorotic or purple margin. Some lesions resembled symptoms of downy mildew on arugula, but microscopic examination revealed no sporangiophores associated with the lesions. Bacterial ooze was observed when sections of symptomatic leaves were examined microscopically. Blue-green fluorescent pseudomonads were isolated from lesions on King's medium B agar from three arugula plantings. Twelve strains (at least three from each planting) were evaluated along with known strains of Pseudomonas syringae pv. alisalensis and P. syringae pv. maculicola in all assays. Bacterial strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction on tobacco (Nicotiana tabacum L. cv. Sansun) indicating that the bacteria belonged to Lelliot's LOPAT group 1 (2). This was confirmed by analysis of fatty acid methyl esters (MIS-TSBA version 4.10; MIDI, Inc., Newark, DE), which indicated that the strains were highly similar (similarity >0.80) to P. syringae. Amplification of DNA between repetitive bacterial sequences (rep-PCR) using the BOXA1R primer resulted in identical banding patterns for the NV arugula strains and P. syringae pv. alisalensis from arugula in California (1). Koch's postulates were completed by confirming pathogenicity of the isolated strains on the arugula cvs. Italian and Astro. Strains were grown on nutrient agar for 48 h at 27°C, adjusted to 108 CFU/ml in sterile 0.01 M phosphate buffer (pH 7.0), and spray inoculated until runoff onto 2- to 3-week-old plants. Control plants were similarly sprayed with sterile phosphate buffer. Plants were held for 2 days in a mist chamber and 7 days on a greenhouse bench (24 to 26°C). Angular lesions similar to symptoms observed on the original plants developed on leaves of all inoculated arugula plants. In addition, some plants developed blackening of the smaller veins accompanied by chlorosis of the surrounding interveinal tissue in 10- to 20-mm diameter areas of the leaves. Small black lesions (as much as 10 mm long) were also observed on the petioles. Bacterial strains reisolated from the symptomatic tissue were identical to P. syringae pv. alisalensis by rep-PCR. Control plants remained symptomless. Similar inoculation and incubation methods confirmed that the host range of the NV arugula isolates was identical to that of known strains of P. syringae pv. alisalensis. The arugula and P. syringae pv. alisalensis isolates caused leaf spots on broccoli raab (Brassica rapa subsp. rapa cv. Sorento) and oats (Avena sativa cv. Montezuma). Pathogenicity tests were repeated. This confirms that the leaf spot observed on conventionally and organically grown arugula in NV was caused by P. syringae pv. alisalensis. To our knowledge, this is the first report of this disease on arugula in NV.

First Report of Soybean Rust Caused by Phakopsora pachyrhizi on Erythrina herbacea (Coral Bean).

Soybean rust (SBR), caused by the obligate fungus Phakopsora pachyrhizi Syd. & P. Syd., was initially reported on soybean (Glycine max L.) in Louisiana in 2004 and has since been reported on soybean and/or kudzu (Pueraria lobata (Willd.) Ohwi) in 9 states in 2005, 15 states in 2006, and 19 states in 2007 (1). The host range of P. pachyrhizi includes plants that are all in the Fabaceae or legume family. Six plant species in the United States have been reported as hosts of P. pachyrhizi: soybean, kudzu, Florida beggarweed (Desmodium tortuosum (Sw) DC.), dry bean (Phaseolus vulgaris L.), lima bean (P. lunatus L.), and scarlet runner bean (P. coccineus L.) (4). On 17 April 2008, a rust disease was observed on a weedy legume host with red showy flowers that was growing with kudzu in an overgrown vacant lot in the understory of live oak trees (Quercus virginiana Mill.) in Citra, FL. The discovery was made during routine scouting of this Integrated Pest Management Pest Information Platform for Extension and Education (IPM PIPE) mobile sentinel plot (3). The plant was confirmed by University of Florida botanists to be Erythrina herbaceae L., commonly known as coral bean. Coral bean is native to the southeastern United States and also is planted as a perennial ornamental. A sample of leaves exhibiting rust pustules characteristic of P. pachyrhizi uredinia was collected and examined with a microscope. Brown-to-brick red, angular lesions that were 3 to 11 mm in diameter (average 6.75 mm) were observed on the undersides of the leaves of two trifoliates. Within these lesions, there were several uredinia, some exuding hyaline, echinulate urediniospores (20 × 25 μm). The visual diagnosis and the species of the rust fungus were confirmed to be P. pachyrizi by a real-time PCR protocol (2). The diagnosis on this new host was verified by a USDA, APHIS National Mycologist in Beltsville, MD. Coral bean may serve as an additional overwintering host for P. pachyrhizi in the southeast. To our knowledge, this is the first report of soybean rust caused by P. pachyrhizi on E. herbaceae.

First Report of Rust Caused by Phakopsora pachyrhizi on Soybean in Democratic Republic of Congo.

Nigeria (1) and Uganda (3) are the closest countries to the Democratic Republic of Congo (DRC) where soybean rust caused by Phakopsora pachyrhizi has been reported. In February 2007, during a disease survey in DRC, soybean (Glycine max) leaves with rust symptoms (tan, angular lesions with erumpent sori exuding urediniospores) were observed in 10 fields in the following areas in Bas Congo Province: Bangu, Kimpese, Kolo-Fuma, Lukala, Mbanza-Ngungu, Mpalukide, Mvuazi, and Ntemo. Rust incidence in these fields ranged from 85 to 100%, while severity ranged between 3 and 35% of the leaf area on infected plants. Urediniospores were hyaline, minutely echinulate, and 23 to 31 × 16 to 20 μm. Within a week of collection, infected leaf samples were sent to the USDA-ARS Foreign Disease-Weed Science Research Unit (FDWSRU) for pathogen identification. DNA was extracted from sections of leaves containing sori with the Qiagen DNeasy Plant Mini kit (Valencia, CA), and all 10 field samples amplified in a real-time fluorescent PCR with the P. pachyrhizi-specific primers Ppm1 and Ppa2 (2). Infected leaves of cultivar Vuangi collected from one field each in the INERA Research Station, Kimpese-Crawford, and Kimpese-Ceco were separately washed in sterile water to collect urediniospores that were used to separately inoculate three detached leaves of susceptible cultivar TGx 1485-1D (4). Lesions on inoculated leaves developed 5 days after inoculation (DAI), and pustules (110 to 130 μm) formed 7 DAI and erupted 2 days later exuding columns of urediniospores similar in size to the initially collected isolates. Inoculation of another set of detached leaves with a spore suspension (1 × 106 spores per ml) from the first set of detached leaves resulted in typical rust symptoms. Seedlings of cultivar Williams also showed typical rust symptoms when inoculated separately with urediniospores collected from nine fields (i.e., all except Kimpese-Ceco, which was infective in the detached leaf assay). Inoculation and incubation were carried out at the FDWSRU Plant Pathogen Containment Facility at Fort Detrick as described earlier (2). The PCR assay, morphological characters of the isolates, and pathogenicity tests demonstrate that P. pachyrhizi occurs in DRC. To our knowledge, this is the first report of P. pachyrhizi infecting soybean in DRC.

First Report of Soybean Rust Caused by Phakopsora pachyrhizi in Ghana

Nigeria is the only country in West Africa where soybean rust, caused by Phakopsora pachyrhizi, has been officially reported (1). During a disease survey in Ghana during October 2006, soybean (Glycine max) leaves with rust symptoms (tan, angular lesions with erumpent sori exuding urediniospores) were observed in 11 fields in the following districts: Kassena Nankana in the Upper East Region; East Gonja, Central Gonja, and Tolon-Kumbungu in the Northern Region; and Ejisu-Juabeng in the Ashanti Region. Disease incidence in these fields ranged from 50 to 100% and disease severity ranged between 3 and 40% of the leaf area on infected plants. Urediniospores were hyaline, minutely echinulate, and 23 to 31 × 14 to 18 μm. Within a week of collection, leaf samples were sent to the USDA-ARS Foreign Disease-Weed Science Research Unit for verification of pathogen identity. DNA was extracted from leaf pieces containing sori with the Qiagen DNeasy Plant Mini kit (Valencia, CA), and all 11 field samples amplified in a real-time fluorescent PCR with the P. pachyrhizi-specific primers Ppm1 and Ppa2 (2). Sequence alignment of the internal transcribed spacer (ITS) region 2 further confirmed the identification as P. pachyrhizi (2). Infected leaves from three fields were separately washed in sterile water to collect urediniospores that were used to separately inoculate three detached leaves (for each isolate) of susceptible cultivar TGx 1485-1D (3). The abaxial surface of detached leaves was sprayed with 400 μl of spore suspension (1 × 106 spores per ml). A single leaf piece was placed in a 9-cm-diameter petri dish with adaxial side appressed on 1% technical agar amended with 10 μg/ml of kinetin. Lactic acid (1.5 ml/liter) and benomyl (12.5 mg/liter) were added to the agar medium to inhibit growth of saprophytic fungi and bacteria. Petri dishes were incubated at 20°C with a 12-h light/12-h dark cycle. Lesions on inoculated leaves developed 5 to 6 days after inoculation (DAI), and pustules (105 to 120 μm) formed 7 to 8 DAI and erupted 3 days later exuding columns of urediniospores similar in size to the initially collected isolates. Inoculating another set of detached leaves with a spore suspension (1 × 106 spores per ml) from the first set of detached leaves resulted in typical rust symptoms. The PCR assay, alignment of ITS region 2, morphological characters of the isolates, and pathogenicity tests demonstrate that P. pachyrhizi occurs in Ghana. To our knowledge, this is the first report of P. pachyrhizi in Ghana.

Late Season Occurrence of Soybean Rust Caused by Phakopsora pachyrhizi on Soybean in Illinois.

Soybean rust, first reported in the continental United States in Louisiana in 2004 (2), is one of the most important foliar diseases of soybean worldwide. On 10 October 2006, 20 soybean leaflets from 20 plants at physiological maturity were arbitrarily collected in research plots near Glendale, IL at the University of Illinois Dixon Springs Agricultural Center in Pope County and sent by overnight courier. On 11 October, leaflets were examined with a dissecting microscope at the Soybean Disease Laboratory at the National Soybean Research Center, and then at the Plant Disease Clinic, University of Illinois. Tan, angular lesions that were 2 to 4 mm in diameter were observed on the lower leaf surfaces of two of the 20 leaflets. Within these lesions, there was one uredinum on one leaflet and four on the other leaflet exuding hyaline, echinulate urediniospores (20 × 25 μm). On 11 October 2006, these leaflets were sent by overnight courier to the USDA/APHIS/PPQ/NIS Laboratory, Beltsville, MD Plant Disease Clinic for identification by morphological examination and by PCR using primers specific to Phakopsora pachyrhizi (1). Both tests confirmed the presence of P. pachyrhizi. The 18 leaflets that did not have sporulating pustules on 11 October were incubated in the laboratory for 5 days at near 100% relative humidity. Following incubation, nine leaflets were observed to have uredinia exuding urediniospores with a range of 1 to 43 uredinia per leaflet. These results indicate that incubation may be necessary to maximize the potential to observe uredinia exuding urediniospores. To our knowledge, this is the first report of P. pachyrhizi infecting plants in Illinois.

First Report of Bacterial Blight of Romanesco Cauliflower (Brassica oleracea var. botrytis) Caused by Pseudomonas syringae pv. alisalensis in California.

In 2005, a new disease was detected on commercial, organically grown romanesco (green) cauliflower (Brassica oleracea var. botrytis) grown in San Benito County, California. Initial symptoms consisted of small (1 to 2 mm in diameter), angular, water-soaked flecks. These flecks developed into tan-to-gray, angular lesions measuring as much as 5 mm in diameter. Lesions were usually surrounded by chlorotic borders. Coalescing lesions caused the leaf to turn papery in texture and have a blighted appearance. A blue-green fluorescing pseudomonad was consistently isolated from lesions on King's medium B. Strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Samsun). These data indicated that the bacteria belonged to Lelliot's LOPAT group 1 (2). This was confirmed with data from fatty acid methyl ester analysis (MIS-TSBA version 4.10, MIDI, Inc., Newark, DE), which showed that the strains were highly similar (similarity = 0.921 or greater) to Pseudomonas syringae. Amplification of repetitive bacterial sequences (rep-PCR) using the BOXA1R primer and the polymerase chain reaction resulted in identical banding patterns for the romanesco strains and the P. syringae pv. alisalensis pathotype strain. Pathogenicity was demonstrated by growing inoculum of six strains in nutrient broth shake cultures for 48 h (24°C), adjusting the bacterial suspension to 106 CFU/ml, and spraying the resulting suspension onto green cauliflower (cv. Romanesco Precoce). Plants were enclosed in plastic bags for 24 h and then incubated in a greenhouse (24 to 26°C). Control plants were misted with sterile water and treated the same way. After 5 days, foliar symptoms identical to symptoms seen in the field developed on all inoculated plants, and reisolated strains were characterized and found to be identical to P. syringae pv. alisalensis by the tests described above. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. To our knowledge, this is the first report of commercially grown romanesco green cauliflower as a host of P. syringae pv. alisalensis. The infested field had approximately 30% of the plants affected, with perhaps 10% sustaining some crop loss. This bacterial pathogen has previously been reported on commercial plantings of arugula (Eruca sativa), broccoli (Brassica oleracea var. botrytis), and broccoli raab (Brassica rapa var. rapa) and under experimental (greenhouse) conditions causes disease on additional hosts, including members of the Poaceae (1).