Alterations In Primary Structure Research Articles

Effect of Tween 80 and Pluronic 127 on the stabilization of zein nanocarriers for the delivery of piperine

In the current research work, zein-based polymeric nanocarriers were developed for the delivery of piperine, where the effect of non-ionic surfactants (Tween 80 and Pluronic F-127) on the stability and in vitro drug release characteristics were studied. Physiochemical characterization studies showed that the particle size of blank and drug-loaded surfactant stabilized zein nanoparticles were <200 nm and particles were spherical in shape. FTIR studies confirmed the successful incorporation of piperine within the zein nanoparticle without any alteration in primary structure of zein. The circular dichroism spectroscopy suggested that α-helix content of zein was reduced following the incorporation of drug within nanoparticles. The solubility of piperine was enhanced significantly in the gastrointestinal tract, and higher sustained release was observed for tween 80-stablized zein nanoparticles. The formulations were stable towards thermal treatment up to 90 °C, showed superior resistance towards aggregation even at ionic strength >50 mM NaCl, and did not show any aggregation even at the isoelectric pH. Tween 80-stablized zein nanoparticles showed good redispersibility index with the cryoprotectant mannose (5 % w/v) after lyophilization. The current research would contribute to the advancement of zein nanoparticles for the delivery of nutraceutical agents, which may be utilized in the food supplements or therapeutic agents to improve the human health.

Epigenetic alteration contributes to the transcriptional reprogramming in T-cell prolymphocytic leukemia

T cell prolymphocytic leukemia (T-PLL) is a rare disease with aggressive clinical course. Cytogenetic analysis, whole-exome and whole-genome sequencing have identified primary structural alterations in T-PLL, including inversion, translocation and copy number variation. Recurrent somatic mutations were also identified in genes encoding chromatin regulators and those in the JAK-STAT signaling pathway. Epigenetic alterations are the hallmark of many cancers. However, genome-wide epigenomic profiles have not been reported in T-PLL, limiting the mechanistic study of its carcinogenesis. We hypothesize epigenetic mechanisms also play a key role in T-PLL pathogenesis. To systematically test this hypothesis, we generated genome-wide maps of regulatory regions using H3K4me3 and H3K27ac ChIP-seq, as well as RNA-seq data in both T-PLL patients and healthy individuals. We found that genes down-regulated in T-PLL are mainly associated with defense response, immune system or adaptive immune response, while up-regulated genes are enriched in developmental process, as well as WNT signaling pathway with crucial roles in cell fate decision. In particular, our analysis revealed a global alteration of regulatory landscape in T-PLL, with differential peaks highly enriched for binding motifs of immune related transcription factors, supporting the epigenetic regulation of oncogenes and genes involved in DNA damage response and T-cell activation. Together, our work reveals a causal role of epigenetic dysregulation in T-PLL.

Mislocalization of SMN from the I-band and M-band in human skeletal myofibers in spinal muscular atrophy associates with primary structural alterations of the sarcomere.

Spinal muscular atrophy (SMA) is caused by a deletion or mutation of the survival motor neuron 1 (SMN1) gene. Reduced SMN levels lead to motor neuron degeneration and muscular atrophy. SMN protein localizes to the cytoplasm and Cajal bodies. Moreover, in myofibrils from Drosophila and mice, SMN is a sarcomeric protein localized to the Z-disc. Although SMN participates in multiple functions, including the biogenesis of spliceosomal small nuclear ribonucleoproteins, its role in the sarcomere is unclear. Here, we analyzed the sarcomeric organization of SMN in human control and type I SMA skeletal myofibers. In control sarcomeres, we demonstrate that human SMN is localized to the titin-positive M-band and actin-positive I-band, and to SMN-positive granules that flanked the Z-discs. Co-immunoprecipitation assays revealed that SMN interacts with the sarcomeric protein actin, α-actinin, titin, and profilin2. In the type I SMA muscle, SMN levels were reduced, and atrophic (denervated) and hypertrophic (nondenervated) myofibers coexisted. The hypertrophied myofibers, which are potential primary targets of SMN deficiency, exhibited sites of focal or segmental alterations of the actin cytoskeleton, where the SMN immunostaining pattern was altered. Moreover, SMN was relocalized to the Z-disc in overcontracted minisarcomeres from hypertrophic myofibers. We propose that SMN could have an integrating role in the molecular components of the sarcomere. Consequently, low SMN levels might impact the normal sarcomeric architecture, resulting in the disruption of myofibrils found in SMA muscle. This primary effect might be independent of the neurogenic myopathy produced by denervation and contribute to pathophysiology of the SMA myopathy.

Proteoform characterization based on top-down mass spectrometry.

Proteins are dominant executors of living processes. Compared to genetic variations, changes in the molecular structure and state of a protein (i.e. proteoforms) are more directly related to pathological changes in diseases. Characterizing proteoforms involves identifying and locating primary structure alterations (PSAs) in proteoforms, which is of practical importance for the advancement of the medical profession. With the development of mass spectrometry (MS) technology, the characterization of proteoforms based on top-down MS technology has become possible. This type of method is relatively new and faces many challenges. Since the proteoform identification is the most important process in characterizing proteoforms, we comprehensively review the existing proteoform identification methods in this study. Before identifying proteoforms, the spectra need to be preprocessed, and protein sequence databases can be filtered to speed up the identification. Therefore, we also summarize some popular deconvolution algorithms, various filtering algorithms for improving the proteoform identification performance and various scoring methods for localizing proteoforms. Moreover, commonly used methods were evaluated and compared in this review. We believe our review could help researchers better understand the current state of the development in this field and design new efficient algorithms for the proteoform characterization.

Analysis of NF2 gene mutations in intraspinal Schwannomas

To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene. Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing. Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations. The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.

A mass graph-based approach for the identification of modified proteoforms using top-down tandem mass spectra.

Although proteomics has rapidly developed in the past decade, researchers are still in the early stage of exploring the world of complex proteoforms, which are protein products with various primary structure alterations resulting from gene mutations, alternative splicing, post-translational modifications, and other biological processes. Proteoform identification is essential to mapping proteoforms to their biological functions as well as discovering novel proteoforms and new protein functions. Top-down mass spectrometry is the method of choice for identifying complex proteoforms because it provides a 'bird's eye view' of intact proteoforms. The combinatorial explosion of various alterations on a protein may result in billions of possible proteoforms, making proteoform identification a challenging computational problem. We propose a new data structure, called the mass graph, for efficient representation of proteoforms and design mass graph alignment algorithms. We developed TopMG, a mass graph-based software tool for proteoform identification by top-down mass spectrometry. Experiments on top-down mass spectrometry datasets showed that TopMG outperformed existing methods in identifying complex proteoforms. http://proteomics.informatics.iupui.edu/software/topmg/. xwliu@iupui.edu. Supplementary data are available at Bioinformatics online.

TopPIC: a software tool for top-down mass spectrometry-based proteoform identification and characterization.

http://proteomics.informatics.iupui.edu/software/toppic/ CONTACT: xwliu@iupui.eduSupplementary information: Supplementary data are available at Bioinformatics online.

Characterization of Proteoforms with Unknown Post-translational Modifications Using the MIScore.

Various proteoforms may be generated from a single gene due to primary structure alterations (PSAs) such as genetic variations, alternative splicing, and post-translational modifications (PTMs). Top-down mass spectrometry is capable of analyzing intact proteins and identifying patterns of multiple PSAs, making it the method of choice for studying complex proteoforms. In top-down proteomics, proteoform identification is often performed by searching tandem mass spectra against a protein sequence database that contains only one reference protein sequence for each gene or transcript variant in a proteome. Because of the incompleteness of the protein database, an identified proteoform may contain unknown PSAs compared with the reference sequence. Proteoform characterization is to identify and localize PSAs in a proteoform. Although many software tools have been proposed for proteoform identification by top-down mass spectrometry, the characterization of proteoforms in identified proteoform-spectrum matches still relies mainly on manual annotation. We propose to use the Modification Identification Score (MIScore), which is based on Bayesian models, to automatically identify and localize PTMs in proteoforms. Experiments showed that the MIScore is accurate in identifying and localizing one or two modifications.

Single substitutions to closely related amino acids contribute to the functional diversification of an insect-inducible, positively selected plant cystatin.

A causal link has been reported between positively selected amino acids in plant cystatins and the inhibitory range of these proteins against insect digestive cysteine (Cys) proteases. Here we assessed the impact of single substitutions to closely related amino acids on the contribution of positive selection to cystatin diversification. Cystatin sequence alignments, while confirming hypervariability, indicated a preference for related amino acids at positively selected sites. For example, the non-polar residues leucine (Leu), isoleucine (Ile) and valine (Val) were shown to predominate at positively selected site 2 in the N-terminal region, unlike selected sites 6 and 10, where polar residues are preferred. The model cystatin SlCYS8 and single variants with Leu, Ile or Val at position 2 were compared with regard to their ability to bind digestive proteases of the coleopteran pest Leptinotarsa decemlineata and to induce compensatory responses in this insect. A functional proteomics procedure to capture target Cys proteases in midgut extracts allowed confirmation of distinct binding profiles for the cystatin variants. A shotgun proteomics procedure to monitor whole Cys protease complements revealed protease family specific compensatory responses in the insect, dependent on the variant ingested. Our data confirm the contribution of closely related amino acids to the functional diversity of positively selected plant cystatins in a broader structure/function context imposing physicochemical constraints to primary structure alterations. They also underline the complexity of protease/inhibitor interactions in plant-insect systems, and the challenges still to be met in order to harness the full potential of ectopically expressed protease inhibitors in crop protection.

Chemistry as an Expanding Resource in Protein Science: Fully Synthetic and Fully Active Human Parathyroid Hormone‐Related Protein (1–141)

Human parathyroid hormone related protein (hPTHrP), originally isolated from lung cancer cell lines in 1987, [1] is a 141-amino acid polypeptide widely found in both normal and tumor tissue cells. The N-terminal region of hPTHrP possesses a high degree of structural homology with human parathyroid hormone (hPTH), and both hormones effect the elevation of calcium levels in the blood.[2] Although PTH and PTHrP act through binding to the same receptor, the PTH-receptor type-1 (PTHR1), in vitro studies suggest that the two ligands may differ in the precise molecular modes of their receptor interactions.[3,4] Under normal conditions, hPTHrP, which is widely expressed in the tissues of embryos and adults, plays an essential role in a range of functions related to development and growth, including: fostering of the cartilaginous growth plate, [5] bone anabolism, [6] development of mammary gland, [7] transport of calcium ions across the placenta, [8] relaxation of smooth muscle, or vasodilatation, [9] and eruption of tooth.[10] In analogy to the related anti-osteoporosis therapeutic agent, PTH, researchers have found that PTHrP, administered daily, may induce anabolic effects on the skeleton. Interestingly, the risk of hypercalcemia associated with PTH–based therapeutics may be lowered with the use of PTHrP. These findings raise the possibility that PTHrP and/or congeners, thereof could offer an advantage over currently used PTH peptides in therapeutics related to osteoporosis. A growing understanding of the role that hPTHrP may play in mediating the progression of cancer further enhances interest in this polypeptide. An intriguing property of hPTHrP is the finding that it exhibits anti-apoptotic and proliferation–promoting effects on tumor cells.[11–14] Recent studies have shown that antagonists of PTHR1 are able to remarkably inhibit the growth of tumors.[15–17] The development of an efficient synthetic route to homogeneous hPTHrP, and analogs thereof, would facilitate the systematic study of the interaction between hPTHrP and its receptor, PTHR1. Such research would offer important insights into the structure-activity relationship (SAR) of the polypeptide, and could well facilitate the development of practical PTHR1 antagonists, to suppress the growth of tumors, or agonists, for the treatment of osteoporosis.[18] Certainly, one could imagine that a wisely crafted hPTHrP lookalike could have exploitable antiproliferative properties. In our judgment, the synthesis of protein targets offers significant learning opportunities at the interface of chemistry, biology and medicine.[19] The advantage of pursuing chemistry based approaches to protein targets arises from the fact that this forum uniquely allows for the versatile design of unnatural probe structures possessing defined alterations of amino sequence and structure, including the incorporation of non-proteogenic amino acids.[20–22] Notwithstanding impressive accomplishments in protein engineering, which were enabled by spectacular advances in molecular biology, we have felt that chemical based synthesis, in principle, also has much to offer in terms of reaching a specific protein target, in reasonable research–level quantities (usually several milligrams), above all with very high levels of homogeneity. Thus, the purposes of this research were several. First, we hoped to reach hPTHrP by purely chemical means, and to show that it manifests full biological function. With this accomplished, the basis for an SAR program, involving alterations of primary structure (proteogenic and non-proteogenic amino acid substitutions) and molecular constraints, would be solidly in place. More broadly, we would be exploring, albeit in only a preliminary fashion, prospects for using chemistry as a major resource in protein discovery science.[23] The field of protein chemical synthesis was greatly advanced with the discovery of cysteine-based native chemical ligation (NCL), by Kent and co-workers.[24–26] More recently, the scope of NCL has been expanded to encompass a wide range of non-cysteine amino acids, through methods developed in our laboratory and others.[27–33] As outlined in Figure 1, the general non-cysteine based NCL strategy adopted by our group involves the installation of a temporary thiol functionality on the N-terminal amino acid residue at the site of ligation. Following amide bond formation, the polypeptide or glycopeptide is exposed to mild, metal-free dethiylation conditions, resulting in the selective removal of the extraneous thiol functionality. Figure 1 In a demonstration of the applicability of this ligation strategy to the assembly of challenging polypeptides lacking Cys residues, we recently disclosed total syntheses of hPTH, [34] and analogs thereof. Using these methods, we have now achieved the de novo total synthesis of hPTHrP (1–141).[35] We describe herein the synthesis and demonstration of biological activity of our synthetic hPTHrP (1– 141) polypeptide and a truncated analog, hPTHrP (1–37).

Identification of proteins interacting with lactate dehydrogenase in claw muscle of the porcelain crab Petrolisthes cinctipes

Biochemical adaptation of enzymes involves conservation of activity, stability and affinity across a wide range of intracellular and environmental conditions. Enzyme adaptation by alteration of primary structure is well known, but the roles of protein–protein interactions in enzyme adaptation are less well understood. Interspecific differences in thermal stability of lactate dehydrogenase (LDH) in porcelain crabs (genus Petrolisthes) are related to intrinsic differences among LDH molecules and by interactions with other stabilizing proteins. Here, we identified proteins that interact with LDH in porcelain crab claw muscle tissue using co-immunoprecipitation, and showed LDH exists in high molecular weight complexes using size exclusion chromatography and Western blot analyses. Co-immunoprecipitated proteins were separated using 2D SDS PAGE and analyzed by LC/ESI using peptide MS/MS. Peptide MS/MS ions were compared to an EST database for Petrolisthes cinctipes to identify proteins. Identified proteins included cytoskeletal elements, glycolytic enzymes, a phosphagen kinase, and the respiratory protein hemocyanin. Our results support the hypothesis that LDH interacts with glycolytic enzymes in a metabolon structured by cytoskeletal elements that may also include the enzyme for transfer of the adenylate charge in glycolytically produced ATP. Those interactions may play specific roles in biochemical adaptation of glycolytic enzymes.

Spectral, conformational and chemical properties of opossum methemoglobin.

Opossum methemoglobin differs from methemoglobin A in spectral, spin state, conformational and chemical properties. The primary structural alterations in opossum hemoglobin, including the critical substitution at alpha 58 (E7) His leads to Gln result in the following properties. (a) Major contribution of the spectral transitions due to inositol hexakisphosphate binding arises from the alpha chains. (b) The aquomet to hydroxymet (high-spin to low-spin) transition as a function of pH is slightly retarded resulting in considerable high spin at alkaline pH. (c) The tertiary conformation (t) around the beta hemes, upon transition to a T quaternary state, differs from the known hemoglobin t tertiary structure. (d) Both alpha and beta hemes are susceptible to rapid reduction by ascorbic acid (the reduction rate being tenfold faster than that of methemoglobin A). These properties suggest that the heme environments in both the alpha and beta subunits of opossum hemoglobin are different from those of human hemoglobin A.

Imbalance of growth factor signalling in diabetic kidney disease: is connective tissue growth factor (CTGF, CCN2) the perfect intervention point?

The prevalence of diabetes mellitus and its clinical complications are increasing rapidly worldwide. Diabetic nephropathy has already become the leading cause of end-stage renal disease in developed countries and is thus forming an increasing clinical problem [1]. Mesangial matrix accumulation and glomerular basement membrane (GBM) thickening are primary structural alterations characteristic for diabetic nephropathy [2]. These structural changes are accompanied by increased permeability of the GBM for proteins, resulting in increased urinary albumin excretion (UAE). Growth factors and cytokines such as transforming growth factor-b (TGF-b), growth hormone, insulin-like growth factor (IGF) and vascular endothelial growth factor (VEGF) play important roles in the development of diabetic nephropathy [2,3]. In addition to these ‘pro-fibrotic’ growth factors, the ‘anti-fibrotic’ growth factor bone morphogenetic protein-7 (BMP-7) has been reported to be downregulated in diabetic nephropathy, and addition of BMP-7 in experimental diabetes is capable of antagonizing renal fibrosis [4]. TGF-b is generally accepted to be the main pro-fibrotic factor in diabetic nephropathy. Several studies have reported that TGF-b is upregulated in diabetes and induces matrix accumulation in vitro and in vivo. Inhibition of TGF-b by administration of neutralizing antibodies or antisense oligonucleotides, or by blocking its downstream signalling pathway all result in prevention of the fibrotic process in diabetic nephropathy [1]. However, since TGF-b also has important anti-proliferative and anti-inflammatory effects, inhibition of TGF-b may be a double-edged sword. Therefore, alternative targets for therapeutic intervention are needed to treat this complication of diabetes mellitus. A few years ago, connective tissue growth factor (CTGF) was proposed as a potential target for anti-fibrotic strategies. The question was asked whether CTGF is just another factor in renal fibrosis, or a particularly interesting key player in tissue response to injury [5]. As will become apparent from this review, recent evidence does indeed support a prominent role for CTGF in the pathogenesis of diabetic nephropathy, both as a downstream effector of profibrotic TGF-b action and as an extracellular mediator of cross-talk between various growth factor signalling pathways implicated in diabetic kidney disease.

Induction of caspase-8 in human cells by the extracellular administration of peptides containing a C-terminal SLV sequence

Extracellular administration of a membrane permeable model peptide containing the tripeptide sequence, SLV, at the C-terminus to human endothelial and kidney cells resulted in an induction of caspase-8 (FLICE), the apical enzyme of the apoptosis caseade. The unmodified or N-terminally SLV-tagged peptide had no effect, thereby eliminating an unspecific induction of apoptosis as the cause of the caspase activity observed. Drastic alterations of primary structure and structure forming properties of the carrier peptide did not significantly influence the caspase-8 inducing activity of the C-terminal SLV-tag, supporting previous findings that translocation into the cell interior is a more general ability of peptides.

Protein conformation and disease: pathological consequences of analogous mutations in homologous proteins.

The antibody light chain variable domain (V(L))(1) and myelin protein zero (MPZ) are representatives of the functionally diverse immunoglobulin superfamily. The V(L) is a subunit of the antigen-binding component of antibodies, while MPZ is the major membrane-linked constituent of the myelin sheaths that coat peripheral nerves. Despite limited amino acid sequence homology, the conformations of the core structures of the two proteins are largely superimposable. Amino acid variations in V(L) account for various conformational disease outcomes, including amyloidosis. However, the specific amino acid changes in V(L) that are responsible for disease have been obscured by multiple concurrent primary structure alterations. Recently, certain demyelination disorders have been linked to point mutations and single amino acid polymorphisms in MPZ. We demonstrate here that some pathogenic variations in MPZ correspond to changes suspected of determining amyloidosis in V(L). This unanticipated observation suggests that studies of the biophysical origin of conformational disease in one member of a superfamily of homologous proteins may have implications throughout the superfamily. In some cases, findings may account for overt disease; in other cases, due to the natural repertoire of inherited polymorphisms, variations in a representative protein may predict subclinical impairment of homologous proteins.

Current concepts of PLP and its role in the nervous system.

Proteolipid protein (PLP) and its smaller isoform DM20 constitute the major myelin proteins of the CNS. Mutations of the X-linked Plp gene cause the heterogeneous syndromes of Pelizaeus-Merzbacher disease (PMD) and spastic paraplegia (SPG) in man and similar dysmyelinating disorders in a range of animal species. A variety of mutations including missense mutations, deletions, and duplications are responsible. Missense mutations cause a predicted alteration in primary structure of the encoded protein(s) and are generally associated with early onset of signs and generalised dysmyelination. The severity of the phenotype varies according to the particular codon involved and the influence of uncharacterised modifying genes. There is some evidence that the dysmyelination results from the altered protein acquiring a novel function deleterious to the oligodendrocyte's function. Transgenic mice carrying extra copies of the Plp gene provide a valid model of PMD/SPG due to gene duplication. Depending on the gene dosage, the phenotype can vary from early onset of severe and lethal dysmyelination through to a very late onset of a tract-specific demyelination and axonal degeneration. Mice with a null mutation of the Plp gene assemble and maintain normal amounts of myelin but develop a progressive axonopathy, again demonstrating tract specificity. The results indicate that the functions of PLP are far from clear. There is good evidence that it is involved in the formation of the intraperiod line of myelin, and the results from the knockout and transgenic mice suggest a role in the interaction of oligodendrocyte and axon.

FT-IR and Near-Infared FT-Raman Studies of the Secondary Structure of Insulinotropin in the Solid State: α-Helix to β-Sheet Conversion Induced by Phenol and/or by High Shear Force

Insulinotropin (glucagon-like peptide I) is a peptide containing 31 amino acid residues. It stimulates the secretion of the hormone insulin. The solubility of this peptide is highly dependent on its environment and the treatment that it has undergone. For instance, synthetic insulinotropin is highly soluble in neutral phosphate-buffered saline (1 mg/mL). However, the application of shear force by stirring renders it extremely insoluble (1 μg/mL). This property may be explained in terms of a change in peptide secondary structure with no alteration in primary structure. In order to understand this phenomenon, FT-IR and near-IRFT-Raman were employed to examine four samples prepared under different experimental conditions. It was found that solubility decreases as the α-helix is converted to an antiparallel β-sheet structure.

Separation of signal transduction and adaptation functions of the aspartate receptor in bacterial sensing.

In order to investigate the functions of stimulus recognition, signal transduction, and adaptation, the aspartate receptor gene for bacterial chemotaxis in Salmonella typhimurium has been sequenced and modified. A carboxyl-terminal truncated receptor was shown to bind aspartate and to transmit a signal to change motility behavior. However, the truncated receptor showed greatly reduced methyl-accepting capacity, and did not allow adaptation to the sensory stimulation. The separation of receptor functions by alteration of primary structure emphasizes that the receptor is directly involved in adaptation and is not solely a device for transmitting a signal across a membrane.

TRNA alterations in cancer.

1. 3H-, 125I-, and 32P-labeling methods were developed for base composition and sequence analysis of minute amounts of nonradioactive nucleic acids containing modified constituents. 2. Base composition analysis showed tRNA from two "liver-like" minimal deviation hepatomas, Morris hepatomas 5123D and 7777, to exhibit typical alterations when compared with liver tRNA. Our observations, which were made for different transplant generations of the tumors, indicated a trend toward undermethylation and undermodification of tRNA. 3. Sequence analysis of several cytoplasmic and mitochondrial tRNAs from hepatoma 5123D showed partial lack of m2G and complete lack of Gm and Q. 4. Sequence analysis of mitochondrial tRNAs from hepatoma 5123D indicated several instances of alterations of primary structure, a phenomenon not previously observed for cytoplasmic tRNAs from neoplasms. 5. Biochemical mechanisms underlying these alterations, as well as their functional implications, have yet to be investigated. 6. Modification patterns, but not primary structures, of mitochondrial tRNAs have been highly conserved when compared to prokaryotic and eukaryotic cytoplasmic tRNAs. This implies that (a) post-transcriptional modifications must play a crucial role in tRNA function, and (b) alterations of post-transcriptional modifications in tumor tRNAs have to be regarded as highly significant deviations from the norm.

The molecular basis of the heterogeneity of the MM isozyme of rabbit muscle creatine phosphokinase

Purified rabbit muscle creatine phosphokinase MM isozyme was resolved into a pattern of six subbands by starch gel electrophoresis at pH 6.3 in a Tris-citrate buffer system. Following urea dissociation and denaturation, urea-starch gel electrophoresis resolved six distinct, enzymatically inactive subunits of molecular weight 43 000 daltons as determined by sodium dodecyl sulfate-acrylamide gel electrophoresis. This indicates that six different subunit types are involved in rabbit MM isozyme subbanding. The six subbanded pattern obtained following renaturation and reassociation from urea was identical to that exhibited by the purified, untreated MM isozyme. The exact nature of the subbanding is not clear; but it does not appear to be due to sulfhydryl group interactions or to alternative conformations of a single M-type subunit. Rather, it appears to be due to conformational differences resulting from alterations in primary structure, deamidation or ligand heterogeneity.