Allelic Heterozygosity Research Articles

Allelic Diversity and Development of Breeder-Friendly Marker Specific to floury2 Gene Regulating the Accumulation of α-Zeins and Essential Amino Acids in Maize Kernel.

Maize zeins lack essential amino acids, such as methionine, lysine, and tryptophan. The floury2 (fl2) mutation reduces zein synthesis and increases methionine and lysine content in kernels. In this study, fl2 gene (1612bp) was sequenced in eight wild-type and two mutant inbreds and detected 218 SNPs and 18 InDels. Transversion of C to T at 343bp position caused the substitution of alanine by valine in the fl2 mutant. A PCR-based marker (FL-SNP-CT) was developed, which distinguished the favorable mutant fl2 allele (T) from the wild-type (C) Fl2 allele. Gene-based diversity analysis using seven gene-based InDel markers grouped 48 inbred lines into three major clusters, with an average genetic dissimilarity coefficient of 0.534. The average major allele frequency, gene diversity, heterozygosity, and polymorphism information content of the InDel markers were 0.701, 0.392, 0.039, and 0.318, respectively. Haplotype analysis revealed 29 haplotypes of fl2 gene among these 48 inbreds. Amino acid substitution (Ala-Val) at the signal peptide cleavage site produced unprocessed 24-kDa mutant protein instead of 22-kDa zein found in normal genotype. Eight paralogues of fl2 detected in the study showed variation in exon lengths (616-1170bp) and translation lengths (135-267 amino acids). Orthologue analysis among 15 accessions of Sorghum bicolor and two accessions of Saccharum spontaneum revealed a single exon in fl2 gene, ranging from 267 to 810bp. The study elucidated the molecular basis of fl2 mutation and reported a breeder-friendly marker for molecular breeding programs. This is the first study to characterize fl2 gene in a set of subtropically adapted inbreds.

Marker weighting improves single-step genomic prediction reliabilities of udder health traits in Nordic Red and Jersey dairy cattle populations

The standard single-step genomic prediction model assumes that all SNP markers explain an equal amount of genetic variance, which, however, may not be true. This is because SNPs are located in or near different genes with different functions. Therefore, it seems logical to consider SNP marker-specific weights when predicting genomic breeding values. We hypothesized that allowing differences in the amount of genetic variance explained by each SNP marker will improve prediction reliability and response to selection. To investigate this hypothesis, we first developed multi-trait standard single-step genomic models based on the current multi-trait random regression evaluation models for udder health traits of the Nordic Red (RDC) and Jersey (JER) dairy cattle populations. The models included 4 clinical mastitis (CM) traits, 3 test-day somatic cell score (SCS) traits, and the conformation traits fore udder attachment and udder depth. In the second step, we investigated the effect of applying different SNP marker weighting scenarios in the single-step genomic prediction models, for which a single-step SNP best linear unbiased prediction model was applied. We investigated the prediction reliability of the different models by forward prediction, where the last 4 years of the data were removed to estimate breeding values for validation candidates. In addition, genetic trends of the pedigree-based estimated breeding values (PEBV) and genomic enhanced breeding values (GEBV) were examined. The data sets for RDC and JER included 6.9 and 1.2 million animals of which 5.6 and 0.9 million cows had records, respectively. The number of genotyped animals was 125,789 and 64,777 for RDC and JER, respectively. Cows had repeated SCS observations but only single observations for all other traits and breeding values for all traits were modeled by one covariance function. This required modeling 12 eigenvalue breeding value coefficients for each cow and developing SNP marker weights for the principal components rather than for the biological traits. We investigated 3 SNP marker weighting scenarios: 1) a nonlinear method similar to BayesA, 2) using the classical formula 2pqû2 that accounts for allele heterozygosity, and 3) applying a mean SNP weight calculated by 2pqû2 for every 20 adjacent SNP markers. Bias, dispersion, and prediction reliability were calculated using PEBV or GEBV from the evaluation based on the full data set on those using the reduced data set. We found that the recent favorable genetic trend in CM and SCS has been accelerated since the introduction of genomic selection. The study also shows that a significant increase in prediction reliability, i.e., 0.74 vs. 0.48 for RDC and 0.72 vs. 0.41 for JER cows for CM, can be achieved with a standard single-step genomic prediction model compared with a pedigree-based prediction model. Almost all scenarios with SNP marker weighting further improved the prediction reliability between 0.5% and 12.7%. The highest improvement was achieved by weighing the SNP markers based on the 2pqû2 formula.

Identification of Genetic Diversity of Taro White Cattle Using Microsatellite DNA Markers

Taro white cattle have a small population found in Taro Village, Tegalalang, and Gianyar, Bali, which must be protected as one of the most valuable biological resources for the Hindu community in Bali. White cattle require conservation efforts, with morphometric characterization and genetics providing the first phases of an animal conservation program. The purpose of this study was to identify the genetic diversity of Taro white cattle based on allele frequency, heterozygosity, and fixation index (FIT) using different microsatellite DNA loci so that it can be used as a study and reference in determining policies for the conservation of Taro white cattle in Indonesia, particularly in Bali. This cross-sectional observational study utilized ETH 185, INRA 035, and INRA 037 microsatellite DNA markers. Polymerase chain reaction amplified a total of 22 Taro white cattle blood samples with an average of 4.33 alleles; the average observed heterozygosity and expected heterozygosity were 0.288 and 0.637, respectively, with an average fixation index value of 0.55. In conclusion, there is a significant deviation from the Hardy-Weinberg equilibrium with the likelihood of inbreeding, as indicated by the Hardy-Weinberg balance. The microsatellite loci used in this study can be further used to evaluate the genetic diversity of Taro white cattle.

Effect of heterozygosity loss of HLA-I on immune evasion and promotion of non-small cell lung cancer brain metastasis and immunotherapy resistance.

209 Background: HLA-I play a crucial role in T cell recognition and killing of tumor cells as well as in PD-1/PD-L1 immunotherapy. Loss of heterozygosity (LOH) of HLA-I alleles has been found to be common in lung cancer patients and influences immune escape during tumor evolution. This study aims to explore the incidence of HLA-I LOH in intracranial metastases of advanced non-small cell lung cancer patients with brain metastasis and its impact on the efficacy of immunotherapy. Methods: A total of 29 patients with non-small cell lung cancer brain metastasis were included in this study. All enrolled patients underwent either percutaneous biopsy or surgical resection of intracranial metastases and had tissue specimens from the primary lung lesions. Whole-exome sequencing was performed on all primary/metastatic lesions to determine HLA-I typing/LOH and calculate tumor mutation burden (TMB). Additionally, we assessed the expression levels of CD8 T cells in the tumor immune microenvironment. Among the enrolled patients, 20 received PD-1/PD-L1 treatment. Results: Among the enrolled patients, 82.8% (24/29) had heterozygous HLA-I typing, with HLA-I LOH present in 25% (6/24) of patients' primary lesions and 58.3% (14/24) in brain metastatic lesions. Analysis of TMB in different lesions revealed a median TMB of 7.8 mut/Mb in lesions with intact HLA-I and 11.4 mut/Mb in lesions with HLA-I LOH. Notably, the median TMB in brain metastatic lesions with HLA-I LOH was 13.2 mut/Mb, higher than that in HLA-I LOH primary lung lesions (10.1 mut/Mb). Immunohistochemistry demonstrated that CD8 T cell expression levels were lowest in brain metastatic lesions with HLA-I LOH and highest in intact HLA-I primary lung lesions. Among patients who received immunotherapy, four cases exhibited inconsistent lesion responses, with stable or regressing primary lesions but progressive intracranial metastases. Survival analysis revealed that patients with HLA-I LOH in brain metastases had significantly lower PFS compared to those without (4.1 months vs. 6.9 months, P < 0.05), with no significant difference in OS. Conclusions: This study indicates that the incidence of HLA-I LOH in brain metastases of lung cancer is higher than that in primary lung lesions, accompanied by higher TMB, possibly due to the ineffective presentation of tumor antigens resulting in the accumulation of mutations in lost HLA-I. Moreover, tumors with HLA-I LOH have reduced levels of CD8 T cell infiltration, suggesting impaired tumor antigen presentation impedes immune cytotoxicity. These phenomena contribute to the poorer efficacy of immunotherapy in such patients. In conclusion, HLA-I LOH may be one of the important mechanisms of immune escape in lung cancer brain metastases.

Genetic network analysis uncovers spatial variation in diversity and connectivity of a species presenting a continuous distribution

The conservation of genetic diversity and connectivity is essential for the long-term persistence and adaptive ability of a species. Recent calls have been made for the inclusion of genetic diversity and differentiation measures in the assessment, management, and conservation of species. However, the literature often lacks direction on how to do so for species with continuous distributions or no distinct breaks in genetic connectivity. There are many considerations to overcome when investigating genetic diversity and connectivity of such species. We combine multiple genetic network methodologies with more traditional population genetic analyses within a single framework to address the challenges of investigating population structure and quantifying variation in genetic diversity and connectivity of wide-ranging species with continuous distributions. We demonstrate the efficacy and applicability of our framework through a study on woodland caribou (Rangifer tarandus) occupying the boreal forest of Canada; a species of significant conservation concern. The dataset consisted of 4911 unique individuals genotyped at 9 microsatellite loci, which were subsequently partitioned into 103 spatial nodes to create a population-based genetic network. The Walktrap community detection algorithm was used to detect hierarchical population genetic structure within the study area and node-based network metrics such as mean inverse edge weight and clustering coefficient were used to quantify the variation in genetic connectivity across the range. Lastly, genetic diversity was assessed by calculating allelic richness and heterozygosity of the nodes making up the network. The community detection analysis identified two communities at the coarsest scale to nine communities at the optimal partition. A strong pattern of Isolation by Distance (IBD) was found across the range at multiple scales. Furthermore, signs of genetic erosion along the study area’s southern boundaries were depicted by nodes presenting low genetic diversity and low centrality values. These results are important to the species status assessments in providing previously unavailable information on connectivity and diversity within and beyond the current local population units used in management. Our approach to quantify the patterns and extent of connectivity across the boreal range is comprehensive and could easily be adapted to other species. The results are robust and provide a solid foundation for the continued monitoring and recovery of the species.

Spatial variation in genomic signatures of local adaptation during the cane toad invasion of Australia.

Adaptive evolution can facilitate species' range expansions across environmentally heterogeneous landscapes. However, serial founder effects can limit the efficacy of selection, and the evolution of increased dispersal during range expansions may result in gene flow swamping local adaptation. Here, we study how genetic drift, gene flow and selection interact during the cane toad's (Rhinella marina) invasion across the heterogeneous landscape of Australia. Following its introduction in 1935, the cane toad colonised eastern Australia and established several stable range edges. The ongoing, more rapid range expansion in north-central Australia has occurred concomitant with an evolved increase in dispersal capacity. Using reduced representation genomic data of Australian cane toads from the expansion front and from two areas of their established range, we test the hypothesis that high gene flow constrains local adaptation at the expansion front relative to established areas. Genetic analyses indicate the three study areas are genetically distinct but show similar levels of allelic richness, heterozygosity and inbreeding. Markedly higher gene flow or recency of colonisation at the expansion front have likely hindered local adaptation at the time of sampling, as indicated by reduced slopes of genetic-environment associations (GEAs) estimated using a novel application of geographically weighted regression that accounts for allele surfing; GEA slopes are significantly steeper in established parts of the range. Our work bolsters evidence supporting adaptation of invasive species post-introduction and adds novel evidence for differing strengths of evolutionary forces among geographic areas with different invasion histories.

Identification of FASN Gene Polymorphisms, Expression and Their Relationship with Body Size Traits in Guizhou White Goat (Capra hircus) with Different Genders.

To investigate the nucleotide variation sites (SNPs) and expression differences of the fatty acid synthase gene (FASN) in Guizhou white goats, the relationship between the variation and body size traits was investigated. In this study, DNA was extracted from the blood of 100 samples of white goats from different regions in Guizhou province, China, and the variation sites were screened using pooled sequencing by mixing DNA samples, and 242 blood samples with body size traits were used for association analysis. The allele frequency, genotype frequency, homozygosity, heterozygosity and effective gene number were calculated by using PopGene 32.0 software, the population polymorphism information content was calculated by using PIC software (Version 0.6), and the state of genetic balance of the genes was analyzed by using the chi-square test. The mRNA of FASN gene expression levels in male and female goats were investigated by using real-time fluorescence quantitative PCR (RT-qPCR). The general linear mixed model of MINTAB software (Version 16.0) was used to analyze the association between FASN gene nucleotide mutation sites and body size traits. The results showed that there was one nucleotide mutation site g.141 C/T in the target fragment of FASN gene amplification, and revealed two alleles, C and T, and three genotypes CC, CT and TT. The genotype frequencies for CC, CT and TT were 0.4308, 0.4205 and 0.1487, respectively. The allele frequencies for C and T were 0.6410 and 0.3590, respectively. The genetic homozygosity (Ho) was higher than the heterozygosity (He). The χ2 test showed that the mutation site was in the Hardy-Weinberg equilibrium state (p > 0.05). The RT-qPCR results showed that the FASN gene had different expression levels in the longissimus dorsi muscle of male and female goats, and its expression was significantly higher in male goats than in female goats. The association analysis results showed that the mutation of the FASN gene had different effects on body size traits of male and female goats, and the presence of the populations of the T allele and the TT genotype recorded higher body size traits (body weight, heart girth and wither height) in female populations. Therefore, the site of the FASN gene can be used as a candidate marker for the early selection of growth traits in Guizhou white goats.

Equivalent mating system parameters in post‐mining and undisturbed native plant populations confirms restitution of bird‐pollinator function

Abstract The restoration of diverse self‐sustaining ecosystems requires re‐establishment of functional interactions among species. For plant communities, pollinators are usually essential for pollination, seed set and seed quality. A common assumption in ecological restoration for plants pollinated by animals is one of ‘build it and they will come’, which is rarely tested. Beyond seed set, there may be negative genetic consequences for seed quality if pollinators and their behaviour do not reflect those in reference populations. Here, we conduct an ecological genetic assessment of seed quality via mating system parameters in Lambertia multiflora (Proteaceae), a species dependent on nectar‐feeding birds for pollination. Four populations of L. multiflora in disturbed sites that were rehabilitated following mineral sands mining were compared with four native reference populations, near Eneabba, Western Australia. In each population, approximately 10 offspring from each of 10 maternal plants were genotyped with 11 highly polymorphic microsatellite markers. From these data, genetic diversity and mating system parameters were assessed, and found to be equivalent across all populations. Mean allelic diversity and heterozygosity across loci were very high. All populations were completely outcrossing with no bi‐parental inbreeding. Mean correlated paternity, sibship and effective population size estimates for restored and natural populations were not significantly different and reflected uniformly high paternal diversity and wide outcrossing. Equivalent genetic results for restored and natural reference populations indicate successful restitution of bird‐pollinator services for L. multiflora in these post‐mining rehabilitation sites. Synthesis and applications. Reviewing our results with other published studies to date suggests a resilience of bird‐pollinator services in restored plant communities. These findings provide some reassurance to restoration practitioners working in these global south systems where bird pollination is a feature, at least for similar landscape scenarios. Our study also highlights the global contribution of ecological genetics to the objective assessment of functional species interactions in ecological restoration, an increasingly important goal of land managers and regulators seeking to improve restoration standards.

Zygosity-based sex determination in a butterfly drives hypervariability of Masculinizer.

Nature has devised many ways of producing males and females. Here, we report on a previously undescribed mechanism for Lepidoptera that functions without a female-specific gene. The number of alleles or allele heterozygosity in a single Z-linked gene (BaMasc) is the primary sex-determining switch in Bicyclus anynana butterflies. Embryos carrying a single BaMasc allele develop into WZ (or Z0) females, those carrying two distinct alleles develop into ZZ males, while (ZZ) homozygotes initiate female development, have mismatched dosage compensation, and die as embryos. Consequently, selection against homozygotes has favored the evolution of spectacular allelic diversity: 205 different coding sequences of BaMasc were detected in a sample of 246 females. The structural similarity of a hypervariable region (HVR) in BaMasc to the HVR in Apis mellifera csd suggests molecular convergence between deeply diverged insect lineages. Our discovery of this primary switch highlights the fascinating diversity of sex-determining mechanisms and underlying evolutionary drivers.

Abstract PO4-15-02: ApoE polymorphism is associated with aggressive tumor phenotypes for breast cancer patients

Abstract Introduction: Apolipoprotein E (APOE) is implicated in several biological processes, such as protein synthesis, cell growth and differentiation, cholesterol transport, lipid metabolism, and tissue repair. APOE has different isoforms (E2, E3, and E4) that combine conflicting relations with cancer risk. This study aimed to evaluate the distribution of different isoforms of APOE among suspected HBOC (Hereditary Breast and Ovarian Cancer Syndrome) patients. Methodology: DNA was extracted from the blood cells of 108 patients. The detection was performed using qPCR after amplifying specific regions containing the polymorphisms. It was considered that all the amplicons containing Cq amplification < 35. The melting curve for each patient was analyzed to determine the frequency of the isoforms E2, E3, E4, and genotypes E2/E2, E2/E3, E2E4, E3/E3, and E3/E4. The allele and genotype were also correlated with hereditary variants previously identified by genetic tests for germline mutations and with tumoral phenotype. The data were expressed in frequency and associated using chi-square tests or Fisher's exact test (SPSS v20.0, p< 0.05). Results A total of 108 patients filling criteria for HBOC syndrome were evaluated. Among them, 15 (13.9%) had a mutation in BRCA1, 5 (4.6%) in BRCA2, and 2 (1.9%) in TP53. Most patients were under 45 years old (n=76, 70.4%), female (n=104, 96.3%), had a high school education (n=44, 44.0%), were non-smokers (n=79, 80.6%) or drinkers (n=76, 78.4%), and had no comorbidities (n=66, 64.1%). Overweight at diagnosis was observed in 61 (68.5%) individuals. The most frequent tumor phenotype and stage were luminal B (n=46, 43.4%) and stage IIIA (n=22, 26.2%), respectively. Neoadjuvant chemotherapy was performed in 40 (47.1%) with a high rate of complete and partial response 18 (36.7%) and 22 (44.9%), respectively. Regarding ApoE polymorphisms, the E2 allele showed the lowest frequency (n=7, 6.5%), E3 was present in 103 (95.4%) cases, while E4 was present in 39 (36.1%). The most frequent genotype was E3/E3 (n=64, 58.3%), followed by E3/E4 (n=34, 31.5%), E2/E3 (n=6, 5.6%), E4 (n=4, 3.7%), and E2/E4 (n=1, 0.9%). No cases of E2/E2 genotype were observed. The presence of E2 was inversely associated with comorbidity frequency (p=0.040) but directly associated with TP53 mutation (p=0.012) and triple-negative tumor phenotype (p=0.027). E3 was not associated with clinical characteristics, but E4 was associated with low Ki-67 immunoreactivity (p=0.033). The E2/E3 phenotype was directly associated with triple-negative tumors (p=0.044) and heterozygous tumors (p=0.011). Conclusion: The ApoE polymorphism, particularly the presence of the E2 allele in heterozygosity, is associated with TP53 mutation and a more aggressive tumor phenotype. Citation Format: Maria Claudia Luciano, Rosane Sant' Ana, Valeska Lima, Paulo Goberlanio Silva, Clarissa Albuquerquye, Flavio Bitencourt, Maria Julia Bezerra, Francisca Fernanda Oliveira, José Fernando De Moura, Isabelle Joyce Fernandes, Fernanda Leite. ApoE polymorphism is associated with aggressive tumor phenotypes for breast cancer patients [abstract]. In: Proceedings of the 2023 San Antonio Breast Cancer Symposium; 2023 Dec 5-9; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2024;84(9 Suppl):Abstract nr PO4-15-02.

Low genetic variability and high isolation of a post-harvest South American pinniped population as revealed by genome-wide single nucleotide polymorphisms

Abstract Otaria flavescens has been one of the most heavily exploited pinnipeds during the last 200 years, with depletion of ~90% in some colonies. After the prohibition on sealing in South America, populations stabilized except for the Uruguayan population, which showed a constant decrease. The underlying causes of its decline are unknown. This study used genome-wide single nucleotide polymorphisms to assess the variability and connectivity of some of the most overexploited sea lion colonies in the Atlantic Ocean. Our results revealed low allelic richness, nucleotide diversity, and heterozygosity in the Uruguayan population and evidence of complete isolation from the Argentinean populations under study. In contrast, the Patagonian populations showed a high degree of connectivity, which could explain their recovery and high levels of diversity at present. Our study highlights the critical situation of the Uruguayan sea lion population, emphasizing the need for maintaining continuous conservation efforts in the region.

Abstract 4955: An analytic pipeline of neoantigen selection for both MHC-I and MHC-II pathways

Abstract Background: Accurate neoantigen selection is pivotal for assessing mutation burden and optimizing cancer vaccine formulation thereby playing a crucial role in cancer immunotherapy. The concurrent activation of CD4+ and CD8+ T cells engenders a robust immune response, which is key to effective treatment. However, currently analytic tools predominantly focus on the MHC-I pathway, typically relying on metrics such as gene expression level and MHC-binding affinity of mutated peptides. To address this gap, our study presents a comprehensive pipeline that encompasses both MHC-I and MHC-II pathways and integrates three critical dimensions of immune response: neoantigen abundance, presentation, and immunogenicity. Methods: We estimated mutated peptide abundance by analyzing genomic allelic frequency, transcriptomic allelic frequency, and RNA expression level. Antigen presentation was assessed using the patient harmonic binding rank (PHBR, a composite binding score for all potential MHC-peptide pairs) and MHC diversity (the variety of MHC alleles involved in peptide binding), with additional consideration for the loss of heterozygosity of MHC-I alleles, potentially indicative of immune escape. For immunogenicity, we factored in agretopicity (comparison of MHC-binding affinity between mutated and wild-type peptides), foreignness (similarity to immunogenic foreign antigens), and dissimilarity (sequence disparity with self-peptides, reflecting T cell negative selection process). Results: Implementing our pipeline on a dataset from Parkhurst et al. (2019), we analyzed immune reactivity in relation to 11,537 somatic mutations from 75 gastrointestinal cancer patients. Key metrics—RNA expression, transcriptomic allelic frequencies, PHBR, and MHC diversity—demonstrated significant correlations with both CD4+ and CD8+ activity (p<0.05). Notably, genomic allelic frequency was a significant factor in CD8+ reactivity, whereas agretopicity was crucial for CD4+ reactivity. Conclusion: Our pipeline elucidates the necessity for implementing both MHC-I and MHC-II pathway analyses to effectively select neoantigen candidates for CD8+ and CD4+ T cells respectively. The study confirms that abundance and antigen presentation metrics are robust indicators of neoantigen immunogenicity, supporting their use as potential markers in crafting more effective cancer vaccines. The findings highlight the critical role of this dual-pathway selection approach in generating a comprehensive immune response through neoantigen vaccination. Citation Format: Ko-Han Lee, Timothy Sears, Andrea Castro, Maurizio Zanetti, Hannah Carter. An analytic pipeline of neoantigen selection for both MHC-I and MHC-II pathways [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 4955.

Construction of SNP fingerprints and genetic diversity analysis of radish (Raphanus sativus L.).

Radish (Raphanus sativus L.) is a vegetable crop with economic value and ecological significance in the genus Radish, family Brassicaceae. In recent years, developed countries have attached great importance to the collection and conservation of radish germplasm resources and their research and utilization, but the lack of population genetic information and molecular markers has hindered the development of the genetic breeding of radish. In this study, we integrated the radish genomic data published in databases for the development of single-nucleotide polymorphism (SNP) markers, and obtained a dataset of 308 high-quality SNPs under strict selection criteria. With the support of Kompetitive Allele-Specific PCR (KASP) technology, we screened a set of 32 candidate core SNP marker sets to analyse the genetic diversity of the collected 356 radish varieties. The results showed that the mean values of polymorphism information content (PIC), minor allele frequency (MAF), gene diversity and heterozygosity of the 32 candidate core SNP markers were 0.32, 0.30, 0.40 and 0.25, respectively. Population structural analysis, principal component analysis and genetic evolutionary tree analysis indicated that the 356 radish materials were best classified into two taxa, and that the two taxa of the material were closely genetically exchanged. Finally, on the basis of 32 candidate core SNP markers we calculated 15 core markers using a computer algorithm to construct a fingerprint map of 356 radish varieties. Furthermore, we constructed a core germplasm population consisting of 71 radish materials using 32 candidate core markers. In this study, we developed SNP markers for radish cultivar identification and genetic diversity analysis, and constructed DNA fingerprints, providing a basis for the identification of radish germplasm resources and molecular marker-assisted breeding as well as genetic research.

Genotyping of Uridine-Diphosphate Glucuronosyltransferases-1A1 (UGT1A1) Enzyme and Its Genetic Variant Allele Determination Using Polymerase Chain Reaction and Gel Electrophoresis

Dolutegravir is an integrase inhibitor that prevents the integration of the viral genome into the host cell’s DNA, thus halting HIV replication. The study aimed to conduct genotyping of immunocompromised patients in some Southern States of Nigeria on dolutegravir-based highly active antiretroviral therapy for the UGT1A1*6 and UGT1A1*28 variant alleles using gel electrophoresis and polymerase chain reaction. 52 HIV/AIDS patients participated in the study. Specific primers for UGT1A1*6 and UGT1A1*28: U1F1 forward primer: 5 – AGATACTGTTGATCCCAGTG - 3 and U211R reverse primer: 5 - CTTCAAGGTGTAAAATGGTC-3, was used for the gene amplification, followed by restriction digestion with Ava II. DNA concentrations were quantified with a NanoDrop-1000 spectrophotometer. Restriction fragment length polymorphism (RFLP) techniques were used for genotyping and Gel electrophoresis to determine the heterozygosity and homozygosity of UGT1A1 alleles. After the polymerase chain reaction (PCR), all DNA samples appeared at 280 base pairs on a 1% agarose gel electrophoretic medium. RFLP analysis confirmed the PCR results; thus, no mutations were observed in all the samples. There were no UGT1A1 genetic polymorphisms among the ethnic groups studied, although there was a mild significant link between dolutegravir and neuropsychiatric side effects in the patients (at p-value = 0.08).

Fine-scale spatial genetic structure and dispersal among Italian smooth newt populations in a rural landscape

Amphibians are particularly sensitive to habitat loss and fragmentation caused by the intensification and modernization of farming occurring in the second half of the twentieth century in the Mediterranean basin. However, artificial water bodies, associated with traditional husbandry, proved to be important surrogate for amphibian feeding and reproduction. Here, multilocus genotypes were used to investigate the spatial population structure of Lissotriton vulgaris meridionalis and the role of drinking troughs in supporting viable breeding populations within a rural landscape interested by traditional husbandry and agriculture. Our genetic analysis highlighted the conservation value and the potential stepping-stone function of artificial aquatic sites in the dispersal of the species and for the gene flow maintenance. Indeed, populations of drinking troughs show allelic richness and heterozygosity levels comparable to those from natural ponds and there is no great evidence of genetic bottlenecks. A complex system of artificial aquatic sites and few natural wetlands was identified sustaining a well-structured network of demes highly interconnected with themselves and natural aquatic sites. The conservation of the identified genetic clusters may be useful to prevent further population declines and future loss of genetic diversity within the study area characterized by scarce natural wetlands that frequently dried because of agricultural practices and strong seasonality. Site-specific protection measures are needed to contrast the progressive disappearance of drinking troughs observed in the last years in Italy because of the abandonment of traditional farming practices in favour of modern agriculture and intensive farming.

Analysis of locus estimates of allelic diversity of STR markers in a sample of breeding bulls

Genotypes of the 11 DNA microsatellite loci of 84 bulls of seven breeds were used to evaluate 14 indicators of allelic diversity/differentiation. Traditional and multidimensional statistical methods were applied to the data matrices from the original and transformed estimates (11×14). Estimates of heterozygosity had coefficients of variability of 8-14 %, the number of alleles per locus and indicators of differentiation of breeds at the level of 20-26 %, fixation indices – 38-44 %. Statistically significant Kendall correlations (0.8-1.0) between indicators of allelic richness and heterozygosity, fixation indices, and differentiation indicators were established. The variability of the transformed estimates of diversity/differentiation indicators by loci was in the range of 6-32 %. Including by loci Eth3, Tgla122, Eth225, Bm2113 – 6-12 %, loci Inra23, Tgla126, Eth10 – 15-20 %, loci Tgla227, Sps115, Tgla53, Bm1824 – 28-32 %. The nonparametric Mann-Whitney-Wilcoxon test showed statistically significant differences in the medians of the Eth3 locus with the Bm2113 locus, the Tgla126 locus with the Eth3, Inra23, Tgla122, Eth225, Bm2113, Bm1824, Eth10 loci. The principal component analysis (PCA) identified two components with a total information content of 95,2 %. The first one took into account 59.4 % of the total variance, had the highest loads in intra-breed diversity data and was defined as an «alpha component». The second accounted for 35.8 % of the total variance, had the highest loads in inter-breed differentiation data and was defined as a «beta component». 2D-PCA-ordination showed that a characteristic grouping of loci took place for the analyzed breeds (samples), loci and measures of diversity. Loci Tgla227 and Tgla53 formed group A, group B – loci Tgla122, Eth225, Eth10, group C – loci Inra23, Bm2113 and Bm1824. The loci of the conditional group D (Eth3, Tgla126, Sps115) were defined as «untypical». Validation of ordination was confirmed by calculations on reduced data (dimension 11×7) and the method of non-metric multidimensional scaling (nMDS). The consistency of ordinations according to the Procrust test was 96 % (pperm <0.001). A similar classification of loci was obtained by cluster analysis (UPGMA) with butstrap probabilities of cluster: A – 73, B – 100, C – 73, D – 47 %. The distances and similarity indicators (S) between the profiles of loci and the «true» summary estimates for 11 loci were calculated. Loci Tgla126 and Sps115 had S ≈ 40 %, loci Tgla53 and Bm1824 – at the level of 60 %, loci Inra23, Tgla227 and Bm2113 – 70-75 %, loci Eth3, Tgla122, Eth225 and Eth10 – 84-88 %. The average absolute deviation of the estimates of diversity indicators for the four loci with S≥84 % from the «true» estimates was 3.4 %, for the four loci with S≤60 % – 12.4 %. According to component scores, a general diversity index, γLV, was calculated for each locus. Its correlation with the estimates of the Shannon/Sherwin′s γ-diversity with a 95 % probability value was in the range of 0.73-0.98, Kendall's rank correlation was 0.67 (pvalue = 0.005). The conducted research makes a certain contribution to the expansion of tools for processing molecular genetic data in the analysis of allelic diversity in subdivided populations.

Episodic population fragmentation and gene flow reveal a trade-off between heterozygosity and allelic richness.

In episodic environments like deserts, populations of some animal species exhibit irregular fluctuations such that populations are alternately large and connected or small and isolated. Such dynamics are typically driven by periodic resource pulses due, for example, to large but infrequent rainfall events. The repeated population bottlenecks resulting from fragmentation should lower genetic diversity over time, yet species undergoing these fluctuations appear to maintain high levels of genetic diversity. To resolve this apparent paradox, we simulated a metapopulation of constant size undergoing repeat episodes of fragmentation and change in gene flow to mimic outcomes experienced by mammals in an Australian desert. We show that episodic fragmentation and gene flow have contrasting effects on two measures of genetic diversity: heterozygosity and allelic richness. Specifically, fragmentation into many, small subpopulations, coupled with periods of infrequent gene flow, preserves allelic richness at the expense of heterozygosity. In contrast, fragmentation into a few, large subpopulations maintains heterozygosity at the expense of allelic richness. The strength of the trade-off between heterozygosity and allelic richness depends on the amount of gene flow and the frequency of gene flow events. Our results imply that the type of genetic diversity maintained among species living in strongly fluctuating environments will depend on the way populations fragment, with our results highlighting different mechanisms for maintaining allelic richness and heterozygosity in small, fragmented populations.

Genetic diversity analysis of Katchaikatty Black – An endangered sheep breed from Tamil Nadu

The study presents the genetic diversity of Katchaikatty Black, an endangered and culturally significant sheep breed of Tamil Nadu. A panel of 25 microsatellite markers recommended for Indian sheep was used for genotyping. Considerable genetic variation in terms of allele diversity and heterozygosity was observed within the investigated breed. A total of 174 distinct alleles were detected across the analyzed microsatellite loci with an average of 6.96 alleles per locus. The average observed and expected heterozygosity values were 0.600 and 0.706, respectively. The positive heterozygote deficiency (FIS) value of 0.171, estimated for this breed may be due to the possibility of Wahlund effect resulting from sampling from different breeding flocks, i.e. different villages and flocks in the same area. A normal L-shaped curve suggested absence of genetic bottleneck in this breed. The information generated will be useful in guiding conservation and management programmes for Katchaikatty Black sheep.

Characterization of Myostatin (MSTN) Gene Using PCR-RFLP Method in KUB Chicken

This study aims to obtain MSTN gene diversity and MSTN gene association. The materials used in this study were 96 KUB chickens and 96 KUB chicken blood samples consisting of 41 males and 55 females. This research method is an experiment. Data collected included body weight, weight gain and body size of male and female KUB chickens, and diversity and association of MSTN genes. Data analysis used mean difference test (T-test), T2-Hotelling, Principal Component Analysis (PCA), Genotype and allele frequencies, Hardy-Weinberg equilibrium, Heterozygosity and Polymorphic Information Content (PIC). The results showed that body weight at 1 and 2 months of age, body weight gain at 1-2 months and body size of male KUB chickens at two months were significantly (P<0.05) higher than female KUB chickens. The body size characteristic of male and female KUB chickens is chest circumference (CC) while the body shape characteristic is wing length (WL). The MSTN|MspI gene in KUB chickens is polymorphic. The KUB chicken population is in Hardy-Weinberg imbalance. Heterozygosity of the KUB chicken population showed a value of Ho (0.31) < He (0.51). The MSTN| MspI gene of KUB chicken was associated with body weight, weight gain and body measurements and the best genotype was (-/-).

HLA Type Variation Across Populations

Background: Human Leukocyte Antigen (HLA) is highly polymorphic and it is commonly used as a marker for core population genital aspects such as human migration, predisposition to diseases and in tissue transplantation compatibility. Methodology: For our study authors have taken up sample size of 86 for meta- analysis of high-resolution frequency data of the HLA allele. North Indian patients from tertiary centre were analyzed for identification of HLA-A, B, C, DRB1 and DQB1 alleles by sing serological and molecular typing techniques. A plethora of known alleles were identified at different loci e.g., HLA A 18, HLA B 36, HLA C 5, HLA DRB1 28 and HLA DQB1 8. This study focusing on frequencies of HLA alleles and their homozygosity and heterozygosity have been reported, but HLA data in the North Indian population living in Delhi, Haryana, Uttarakhand , Uttar Pradesh, Punjab and Himachal Pradesh, are reported here characterized. Allele frequencies were analyzed by using the Hardy-Weinberg equilibrium. Results: Allele heterozygosity was observed in 96.51% individuals for locus HLA-A, 97.67% individuals for locus HLA-B and 96.51% for HLA-DRB1,overallheterozygosity for all three loci was 89.5% (77/86 individuals). Among individuals showing homozygosity (9 individuals), two showed homozygosity at two loci. Conclusion: The increased heterozygosity for class 1 and class 2 is associated with selective advantage against infectious diseases. The phenotypic frequency of B*35 alleles (B*35:01, B*35:03 and B*35:08) in our study is 31.39%. Comparable B*35 allele phenotypic frequency (27.5%) was reported in north Indian patients.