Adult Glioblastoma Cell Lines Research Articles

Abstract 3568: Developing pediatric glioblastoma microtumors with a three-dimensional bioprinter

Abstract Background:Glioblastoma multiforme is one of the most devastating forms of brain cancer seen in children. Children diagnosed with high-grade gliomas have poor prognosis, and there remains a need for improvement in the standard of care. In order to improve the standard of care for this condition, it is necessary to develop in vitro models which better recapitulate the nature of the tumors. Three-dimensional bioprinting has proven to be an effective technique in creating microtumors using adult glioblastoma cell lines but remains unexplored in pediatric glioblastoma. As such, we sought to develop a protocol which would allow for the creation of three-dimensionally bioprinted microtumors using patient-derived pediatric glioblastoma cells. Methods:A Bio X three-dimensional bioprinter (Cellink) was utilized to create the microtumor constructs. The composition of the bioink was modified through varying concentrations of sodium alginate and gelatin, or gelatin-methacrylate (Gel-MA). The microtumor size and volume was optimized through the variation of extrusion time, nozzle pressure, and both nozzle and print bed temperature. The crosslinking technique was also optimized through the utilization of 2% calcium chloride for varying exposure times, and also a 405-nm light (for Gel-MA bioink) at varied light intensity, length of time of application to, and distance from, the printed structure. Bioprinted pediatric XD456 brain tumor initiating cell constructs were treated with both chemotherapeutics and radiation to determine the model’s capacity to respond to treatment. PamStation 12 (PamGene Inc.) Kinomic data and RNA-seq (Illumina) data were generated for the constructs. Imaging was performed using Cytation 5 imager (Agilent). Results:Fluorescent microscopy with Calcein AM and Sytox™ Orange (ThermoFisher), along with viability assessments via CellTiter-Glo®, demonstrated expected cytotoxic effects after exposure to 10 μM Cisplatin. Additionally, PamStation 12 Kinomic and RNA-seq data indicated a difference in kinomic signaling between the bioprinted constructs as compared to the XD456 cells cultured as neurospheres. Conclusions:The utilization of a three-dimensional bioprinter allows for the creation of microtumors using patient-derived pediatric glioblastoma cells. Future studies will investigate the microtumors’ capacity as a drug screening model. The model will also be developed to further recapitulate the native tumor microenvironment of pediatric glioblastoma. Citation Format: Andee M. Beierle, Taylor L. Schanel, Hasan Alrefai, Joshua C. Anderson, Patricia H. Hicks, Lauren C. Nassour, Christopher D. Willey. Developing pediatric glioblastoma microtumors with a three-dimensional bioprinter. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 3568.

DTCM-glutarimide Delays Growth and Radiosensitizes Glioblastoma.

Glioblastoma (GBM) is the most aggressive brain tumor. Even with the advent of temozolomide, patient survival remains poor, with expected median survival around 1 year from diagnosis. Consequently, the relentless search for new therapeutic strategies able to increase patient outcome persists. 3-[(dodecylthiocarbonyl) methyl] glutarimide (DTCM-g) is a new anti-inflammatory compound that already showed antitumor effects. Clonogenic survival, proliferation, apoptosis, cell cycle progression and invasion capacity of pediatric and adult GBM cell lines (U87MG, U251MG, SF188 and KNS-42) were evaluated under treatment with DTCM-g. The combined treatment with radiation was also evaluated in vitro and in vivo through xerographic models. DTCM-g is able to impair proliferation, reduce clonogenic capacity and induce cell cycle arrest in GBM cell lines. No alteration in apoptosis rates was found after treatment. DTCM-g also reduces the invasion capacity of all GBM cell lines without alterations in MMP2 and uPa expression. Moreover, the drug radiosensitized GBM in vitro and in vivo. Although additional studies are still necessary to support our findings, our results suggest that DTCM-g may be a promising drug on the adjuvant treatment of GBM exhibiting antitumor effects, especially through radiosensitization.

Abstract 5871: Efficacy and selectivity of novel dually targeted kinase inhibitors for therapy of adult and pediatric high-grade glioma

Abstract High grade gliomas (HGGs) in adults and children confer very poor prognosis, with median survival rates under two years post diagnosis. Genetic alterations in receptor tyrosine kinases (RTKs) are seen in both adult and pediatric glioblastoma. Amplification of epidermal growth factor receptor (EGFR), as well as mutations in the PI3K/AKT/mTOR pathway, are frequent and can be targeted by kinase inhibitor based strategies. However, clinical trials singly targeting either EGFR or PI3K have had marginal impact on HGG patient outcomes. Given data showing that compensatory kinase activation is responsible for refractory disease, we developed therapeutics that target more than one kinase. Employing a computational modeling approach, we exploited the known binding modes of structurally related ATP binding site inhibitors of EGFR and PI3K to design small molecules that simultaneously and selectively inhibit both kinases. A panel of novel inhibitors has been synthesized, screened for metabolic stability and characterized with respect to kinase inhibition. Six compounds with varying degrees of inhibition for EGFR and PI3K were evaluated in the NCI-60 COMPARE cell line panel, whereupon two molecules, MTX-216 and MTX-241, exhibited strong in vitro activity against a series of human HGG cell lines. We further evaluated cytotoxicity in five human glioblastoma (GBM) lines, some of which bear EGFRvIII, the truncation mutation frequently seen, and in three patient-derived pediatric diffuse intrinsic pontine glioma (DIPG) cells. Treatment with either MTX-216 or MTX-241 resulted in potent growth inhibition relative to targeting of EGFR alone or PI3K alone using gefitinib, lapatinib or alpelisib. Cytotoxic activity against DIPG patient-derived cell lines was observed at lower concentrations compared to adult GBM cell lines, suggesting that dosing could be de-escalated in children, thereby reducing risks of toxicities. Importantly, selectivity of these compounds was demonstrated against malignant cells versus normal human astrocytes. Furthermore, we have identified unique metabolism targeting features of these compounds in GBM and DIPG lines, indicating suppression of both glycolytic pathways and oxidative phosphorylation, which is not seen with clinically relevant EGFR or PI3K inhibitors. Given the documented metabolic dependencies of brain tumor cells on glycolytic pathways, future studies will evaluate whether biomarkers of sensitivity to the dual inhibitors can be identified. Taken together, our findings point toward proof that a single small molecule inhibitor with dual specificity for EGFR and PI3K represents a rational and promising treatment strategy for recurrent adult and pediatric HGG. Despite the knowledge that HGG is associated with deregulated EGFR and PI3K activity, no current treatment exists targeting both of these critical oncogenes with a single molecule approach. Citation Format: Trever R. Carter, Cavan P. Bailey, Yusha Y. Sun, Alexsandra B. Espejo, Christopher E. Whitehead, Judith Leopold, Joya Chandra. Efficacy and selectivity of novel dually targeted kinase inhibitors for therapy of adult and pediatric high-grade glioma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 5871.

CSIG-03. SMALL RNA SEQUENCING OF GLIOBLASTOMA MULTIFORME EXTRACELLULAR VESICLES

Glioblastoma (GBM) subverts the immune system towards immunosuppression through transfer of oncogenic components, including non-coding RNAs, via extracellular vesicles (EVs). GBM-derived EVs are detectable in blood and CSF and may one-day serve as liquid biopsies. EVs of 5 adult GBM cell lines generated at our institution from primary GBMs were harvested after serum-free culture and purified via sequential centrifugation. RNA was collected using the miRNAeasy kit (Qiagen) and sequenced with Illumina HiSeq 2000. Data was analyzed using the OASIS-2.0 platform using HG38. MirTarBase and MirDB interrogated validated and predicted microRNA-gene interactions. 712 of 28623 interrogated non-coding mi/pi/sno/sn/r-RNAs were expressed, most of which novel associations with GBM EVs. Hsa-miR-21-5p, hsa-let-7b-5p, hsa-miR-3182, hsa-miR-4448, hsa-let-7i-5p were most expressed; miRNAs and piRNAs combined generated 92-98% total expression. 10 miRNAs and 13 piRNAs constituted >50% total expression per RNA species per sample. The miRNA gene targeting profile was highly conserved and focused on PTEN, BCL2 and IGF1R, culminating in the silencing of cell cycle, PI3K/Akt, MAPK, p53 and Glioma KEGG pathways. MirDeep2 predicted 4 robustly expressed novel microRNAs with mature sequences aguggggccacgagcugaga, uagugguuaguacccugccuug, acagauugagagcucuuuu and auuucuguccaacuucug. Predicted gene targets of novel miRNAs closely overlapped those of validated miRNAs. Hierarchical clustering demonstrated dBT165 and dBT114 as a separate group based on total/mi/pi/r-RNA, and was predictive of >2 years survival. Hsa-miR-5585-3p (p-value: 0.04, fold-change: 2.8), hsa_piR_020365 (p-value:0.016, fold-change: 7, 17th highest overall expression), hsa_piR_008624 (p-value:0.017, fold-change: 3.6), as well as total hsa-mir-34 family expression (p-value: 0.018), total piRNA (p-value: 0.047) and snRNA (p-value: 0.035) expression were predictive of <2 years survival. We demonstrated expression of previously unassociated RNAs, including 4 novel miRNAs, and detailed clinical and prognostic relevance. Identification of non-coding RNAs and gene/pathway silencing analyses are of paramount importance for development of diagnostic and prognostic tools, providing pathophysiologic understanding, and, in the future, potentially direct decision-making.

OP55BIOCHEMICAL ANALYSIS COMBINED WITH 3D STRUCTURAL PROTEIN MODELLING IDENTIFIES THE ROLE OF SPECIFIC MITOCHONDRIAL MUTATIONS IN GBM

INTRODUCTION: Altered mitochondrial metabolism is a hallmark of glioblastoma (GBM). Previous work in our group using next generation sequencing of GBM cell line mitochondrial DNAs (mtDNAs), combined with 3D structural protein analysis, identified 42 non-synonymous mutations, including 8 within the MT-CYB subunit of complex III (CIII) of the mitochondrial respiratory chain (MRC). Four MT-CYB mutations were predicted to impact on function and concomitant measurement of the MRC enzyme activities in a cohort of GBM cell lines revealed their potential structure-function relationships. METHOD: A cohort of 5 adult GBM cell lines were grown at 37°C and 5% CO2 and 25% O2 until 80% confluent. The cells were treated to allow access of ligands to the inner mitochondrial membrane so that relative activities of complex I, II, linked II/III and IV could be determined spectrophotometrically. RESULTS: Although diverse MRC activity profiles were seen between GBM cell lines, a relationship between CII/CIII activity and the MT-CYB mutation F18L was observed which correlated with structural predictions. GBM cell lines containing F18L, exhibited statistically elevated CII/CIII activity (p > 0.0001) relative to a non-neoplastic control cell line. CONCLUSION: We show a link between a single mtDNA mutation and altered mitochondrial metabolism in GBM which highlights the predictive power of our combined approach. F18L is a germ-line mutation occurring in ∼30% of GBM-patients, raising the possibility that some patients are predisposed to alterations in mitochondrial function. F18L thus provides a target for diagnostic/prognostic research and the development of patient-specific therapeutics.

Abstract C292: Inhibition of carbonic anhydrase (9 and 12) decreases cell proliferation and gene expression in human glioblastoma cell.

Abstract Propose: Glioblastoma (GB) is the most common and lethal malignant primary brain tumor, representing up to 50% of all primary brain gliomas, and carries the poorest prognosis. An important factor for tumor progression is the acidification of the environment that is promoted by carbonic anhydrases (CAs) 9 and 12, directing to the acquisition of metastatic phenotype and chemoresistance to anticancer drugs. Indisulam is a novel anticancer drug with potent inhibition of CAs. It has in vitro and in vivo activity and prevents cell cycle progression in tumor cells, downregulates genes involved in cytotoxic drug resistence and cell proliferation. The aim this study was to evaluate the expression and the effects of inhibition of the 9/12 CAs by indisulam in proliferation and in gene expression of GB cell lines subjected to normoxia or hypoxia. Materials and Method: The U87-MG, U251, U138-MG, U343-MG-a adult GB cell lines were cultured in conditions of hypoxia or normoxia. Functional studies of cell proliferation and clonogenic capacity were performed in triplicate with Indisulan at different concentrations during 24, 48 and 72h. Gene expression of CA9, CA12, VEGF and HIF1α was assessed using qRT-PCR. Statistical analysis was made by one-way ANOVA and Bonferoni post-hoc. Results: Indisulam displayed inhibitory characteristics to hypoxia induced CA9/CA12 expression in the four GBM cell lines. All experiments showed that the inhibition of CA9/12 with indisulam were dose- and time-dependent (p&amp;lt;0.05) and caused a decreased on cell proliferation and the capacity clonogenic. The evaluation of gene expression in conditions of hypoxia (1%) compared to normoxia (preliminary experiments) showed increased expression to the genes CA9, CA12, HIF-1α and VEGF with decreased expression when the cells were treated with Indisulam. Conclusion: Our results indicate antiproliferative and inhibitory effect of the indisulam in GB cell line on condition of normoxic and hypoxic. It suggests that indisulam may be an interesting candidate for the development antitumor therapies based on the inhibition of tumor-associated carbonic anhydrase. Financial Support: FAPESP Citation Information: Mol Cancer Ther 2013;12(11 Suppl):C292. Citation Format: Silvia A. Teixeira, Julia A. Pezuk, Maria S. Brassesco, Carlos G. Carlotti, Luiz G. Tone, Carlos A. Scrideli. Inhibition of carbonic anhydrase (9 and 12) decreases cell proliferation and gene expression in human glioblastoma cell. [abstract]. In: Proceedings of the AACR-NCI-EORTC International Conference: Molecular Targets and Cancer Therapeutics; 2013 Oct 19-23; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2013;12(11 Suppl):Abstract nr C292.