Accumulation Of Dendritic Cells Research Articles

Reciprocal regulation of T follicular helper cells and dendritic cells drives colitis development.

The immunological mechanisms underlying chronic colitis are poorly understood. T follicular helper (TFH) cells are critical in helping B cells during germinal center reactions. In a T cell transfer colitis model, a lymphoid structure composed of mature dendritic cells (DCs) and TFH cells was found within T cell zones of colonic lymphoid follicles. TFH cells were required for mature DC accumulation, the formation of DC-T cell clusters and colitis development. Moreover, DCs promoted TFH cell differentiation, contributing to colitis development. A lineage-tracing analysis showed that, following migration to the lamina propria, TFH cells transdifferentiated into long-lived pathogenic TH1 cells, promoting colitis development. Our findings have therefore demonstrated the reciprocal regulation of TFH cells and DCs in colonic lymphoid follicles, which is critical in chronic colitis pathogenesis.

The Role of the Immune System in the Course of Hashimoto's Thyroiditis: The Current State of Knowledge.

The process of thyroid autoimmunization develops against the background of genetic predispositions associated with class II human leukocyte antigens (HLA-DR), as well as cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), protein tyrosine phosphatase non-receptor type 22 (PTPN22), and forkhead transcription box protein P3 (FOXP3). Environmental factors, such as vitamin D deficiency, Zn, Se, and Mg, as well as infections, chronic stress, pregnancy, smoking, alcohol, medications, intestinal dysbiosis, and malnutrition, also play an important role. The first stage of autoimmunization involves the accumulation of macrophages and dendritic cells, as well as plasma cells. In the second stage, the mutual interactions of individual cells in the immune system lead to a decrease in the level of CD8+ in favor of CD4+, which intensifies the synthesis of T lymphocyte derivatives, especially Th1, Th17, Tfh, and Tc, reducing the level of Treg. Consequently, the number of the anti-inflammatory cytokines IL10 and IL2 decreases, and the synthesis of the pro-inflammatory cytokines IL-2, Il-12, Il-17, IL-21, IL-22, IFN-γ, and TNF-α increases. The latter two especially trigger the pyroptosis process involving the inflammasome. Activation of the inflammasome by IL-β and IL-18 produced by macrophages is one of the mechanisms of pyroptosis in the course of Hashimoto's thyroiditis, involving Gram-negative bacteria and NLRC4. In the next step, the apoptosis of thyroid cells is initiated by the intensification of perforin, granzyme, and proteoglycan synthesis by Tc and NK cells. The current findings raise many possibilities regarding interventions related to the inhibition of pro-inflammatory cytokines and the stimulation of anti-inflammatory cytokines produced by both T and B lymphocytes. Furthermore, since there is currently no effective method for treating thyroid autoimmunity, a summary of the review may provide answers regarding the treatment of not only Hashimoto's thyroiditis, but also other autoimmune diseases associated with autoimmunity.

Overview of histiocytic and dendritic disorders by the 5th version of WHO Classifi cation of Hematolymphoid Tumours from 2022.

Histiocytoses are rare disorders characterized by the accumulation of macrophages, dendritic cells, or monocyte-derived cells in various tissues and organs of children and adults, with a wide range of clinical manifestations, presentations, and histology. The histiocytoses are classified according to the WHO Classification, the last version of which was published in 2022, or according to the Histiocyte Society Classification, with the last version published in 2016. This text provides an overview of histiocytoses as described in the WHO Classification 2022.

Engineered Bacteriophage-Based In Situ Vaccine Remodels a Tumor Microenvironment and Elicits Potent Antitumor Immunity.

In situ vaccines (ISVs) utilize the localized delivery of chemotherapeutic agents or radiotherapy to stimulate the release of endogenous antigens from tumors, thereby eliciting systemic and persistent immune activation. Recently, a bioinspired ISV strategy has attracted tremendous attention due to its features such as an immune adjuvant effect and genetic plasticity. M13 bacteriophages are natural nanomaterials with intrinsic immunogenicity, genetic flexibility, and cost-effectiveness for large-scale production, demonstrating the potential for application in cancer vaccines. In this study, we propose an ISV based on the engineered M13 bacteriophage targeting CD40 (M13CD40) for dendritic cell (DC)-targeted immune stimulation, named H-GM-M13CD40. We induce immunogenic cell death and release tumor antigens through local delivery of (S)-10-hydroxycamptothecin (HCPT), followed by intratumoral injection of granulocyte-macrophage colony stimulating factor (GM-CSF) and M13CD40 to enhance DC recruitment and activation. We demonstrate that this ISV strategy can result in significant accumulation and activation of DCs at the tumor site, reversing the immunosuppressive tumor microenvironment. In addition, H-GM-M13CD40 can synergize with the PD-1 blockade and induce abscopal effects in cold tumor models. Overall, our study verifies the immunogenicity of the engineered M13CD40 bacteriophage and provides a proof of concept that the engineered M13CD40 phage can function as an adjuvant for ISVs.

Role of dendritic cells in immunologic and smoking-induced lung diseases

Dendritic cells (DCs) are part of the specific and innate immune system and present antigens for lymphocytes but also regulate the actions of cells of the innate immune system such as eosinophilic and neutrophilic granulocytes. There are several types of DCs, which might have opposite functions: some enhance an immune reaction, and others activate regulatory T (Treg) lymphocytes and thus can induce tolerance towards an antigen. Normally DCs migrate to regional lymph nodes and there they present modified antigens to cells of the immune system, however, in disease this might not function, resulting in the accumulation of DCs. The role of DCs in lung disease has not gotten much attention in the past, as investigations were predominantly focused on lymphocytes, macrophages, and granulocytes. Only in the last decades, DCs been more recognized. Several investigations are focusing on their role in immunotherapy in lung cancer, another focus is on inflammatory disorders including infections and allergies. In this review, non-tumor and non-infectious lung diseases with a focus on smoking-induced, autoimmune, and allergic diseases are discussed.

Sexual dimorphism in skin immunity is mediated by an androgen-ILC2-dendritic cell axis.

Males and females exhibit profound differences in immune responses and disease susceptibility. However, the factors responsible for sex differences in tissue immunity remain poorly understood. Here, we uncovered a dominant role for type 2 innate lymphoid cells (ILC2s) in shaping sexual immune dimorphism within the skin. Mechanistically, negative regulation of ILC2s by androgens leads to a reduction in dendritic cell accumulation and activation in males, along with reduced tissue immunity. Collectively, our results reveal a role for the androgen-ILC2-dendritic cell axis in controlling sexual immune dimorphism. Moreover, this work proposes that tissue immune set points are defined by the dual action of sex hormones and the microbiota, with sex hormones controlling the strength of local immunity and microbiota calibrating its tone.

Tolerogenic dendritic cell-mediated regulatory T cell differentiation by Chinese herbal formulation attenuates colitis progression

IntroductionUlcerative colitis (UC) is a chronic inflammatory disease characterized by loss of immune tolerance to luminal antigens and progressive intestinal tissue injury. Thus, the re-establishment of immune tolerance is crucial for suppressing aberrant immune responses and UC progression. ObjectivesThis study aimed to investigate the mechanisms underlying the action of CDD-2103 and its bioactive compounds in mediating immune regulation in mouse models of colitis. MethodsTwo experimental colitis models, chronic 2,4,6-trinitrobenzene sulfonic acid (TNBS)- and T-cell transfer-induced Rag1-/- mice, were used to determine the effects of CDD-2103 on colitis progression. Single-cell transcriptome analysis was used to profile the immune landscape and its interactions after CDD-2103 treatment. Liquid chromatography-mass spectrometry (LC-MS) was used to analyze the major components interacting with lymphoid cells. A primary cell co-culture system was used to confirm the effects of bioactive component. ResultsCDD-2103 dose-dependently suppresses the progression of colitis induced by chemicals or T cell transplantation in Rag1-/- mice. The effect of CDD-2103 is primarily attributable to an increase in the de novo generation of regulatory T cells (Tregs) in the lamina propria (LP). Single-cell transcriptomic analysis revealed that CDD-2103 treatment increased the number of tolerogenic dendritic cells (DCs). Mechanistically, CDD-2103 promoted tolerogenic DCs accumulation and function by upregulating several genes in the electron transport chain related to oxidative phosphorylation, leading to increased differentiation of Tregs. Further LC-MS analysis identified several compounds in CDD-2103, particularly those distributed within the mesenteric lymph nodes of mice. Subsequent studies revealed that palmatine and berberine promoted tolerogenic bone marrow-derived dendritic cells (BMDC)-mediated Treg differentiation. ConclusionOverall, our study demonstrated that the clinically beneficial effect of CDD-2103 in the treatment of UC is based on the induction of immune tolerance. In addition, this study supports berberine and palmatine as potential chemical entities in CDD-2103 that modulate immune tolerance.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Neutrophils bearing adhesive polymer micropatches as a drug-free cancer immunotherapy.

Tumour-associated neutrophils can exert antitumour effects but can also assume a pro-tumoural phenotype in the immunosuppressive tumour microenvironment. Here we show that neutrophils can be polarized towards the antitumour phenotype by discoidal polymer micrometric 'patches' that adhere to the neutrophils' surfaces without being internalized. Intravenously administered micropatch-loaded neutrophils accumulated in the spleen and in tumour-draining lymph nodes, and activated splenic natural killer cells and T cells, increasing the accumulation of dendritic cells and natural killer cells. In mice bearing subcutaneous B16F10 tumours or orthotopic 4T1 tumours, intravenous injection of the micropatch-loaded neutrophils led to robust systemic immune responses, a reduction in tumour burden and improvements in survival rates. Micropatch-activated neutrophils combined with the checkpoint inhibitor anti-cytotoxic T-lymphocyte-associated protein 4 resulted in strong inhibition of the growth of B16F10 tumours, and in complete tumour regression in one-third of the treated mice. Micropatch-loaded neutrophils could provide a potent, scalable and drug-free approach for neutrophil-based cancer immunotherapy.

A44 STAT1 ACTS IN INNATE IMMUNE CELLS TO PREVENT LIVER PATHOLOGY FOLLOWING ASYMPTOMATIC INTESTINAL VIRAL INFECTION

Abstract Background In the mammalian gut, interactions between the host and commensal organisms must be regulated to prevent damage and derive benefits from these organisms. While this regulation has been well-studied in the context of bacteria, much less is known about how commensal-like viruses in the intestine are managed by the host. Evidence demonstrates that viral commensals can provide benefits to the host which supplement those from bacteria. In mice, depletion of the intestinal virome enhances susceptibility to DSS-induced colitis. Contributions of the virome can also be studied using murine norovirus strain CR6 (CR6), which forms persistent asymptomatic infections in the gut; this infection protects mice from both C. rodentium- and DSS-induced colitis. Despite these benefits, host-encoded mechanisms regulating viral commensalism remain understudied. One host-encoded mechanism is STAT1. In contrast to asymptomatic infection in wild-type mice, STAT1-deficient mice (Stat1-/-) develop severe disease characterized by liver necrosis and weight loss following CR6 infection. However, it remains unknown how the loss of STAT1 leads to CR6-induced disease. Aims We aimed to define STAT1-dependent mechanisms of protection from CR6-induced liver pathology. Methods To determine the contribution of STAT1 in protection from CR6-induced disease, Stat1-/- and STAT1-sufficient Stat1+/- littermates were infected i.v. with CR6. At days 3, 5, and 7 days post-infection, clinical disease, cell-intrinsic viral loads, pathology, and cellular infiltration were assessed. Bone marrow chimeras were used to evaluate the requirement for hematopoietic vs non-hematopoietic STAT1 in preventing disease. Results By 3 days post-infection, myeloid cells infiltrate the liver of CR6-infected Stat1-/- mice. Clinical disease is associated with accumulation of myeloid cells, including macrophage and dendritic cells in the liver . Sorting of liver-infiltrating immune cell populations revealed that Stat1-/- macrophage have elevated viral loads compared to Stat1+/- littermates (Figure). Notably, CD11b+ cells were enriched within the necrotic lesions characteristic of CR6-induced disease. Consistent with a role for innate immune cells in disease, bone marrow-derived macrophage from Stat1-/- mice failed to control viral replication in vitro. Further, bone marrow chimeras revealed that STAT1 expression in hematopoietic cells is necessary and sufficient to prevent CR6-induced disease. Together, these data suggest that in the absence of STAT1, innate immune cells become heavily infected with CR6 and mediate severe liver pathology. Conclusions Our data suggest that STAT1 is critical to maintaining a commensal relationship with the intestinal virome. In the absence of STAT1, failure to restrict the replication of viral commensal CR6 in innate immune cells leads to severe liver pathology. STAT1-deficient innate immune cells fail to control viral replication. Stat1 -/- and Stat1+/- mice were infected i.v. with CR6. 5 days post-infection, macrophage, dendritic cell, neutrophil, and monocyte populations were isolated from the liver by FACS. Viral genome copies were quantified by RT-qPCR. LoD = Limit of Detection. Mann-Whitney U test, ** = p ampersand:003C 0.01. Funding Agencies CIHR

Investigation of DNA damage and inflammatory marker profile in patients after bariatric surgery

Abstract
 Purpose: Obesity is a significant risk factor in the development of many serious diseases. The most prominent ones among them are diabetes and coronary heart disease. Elevated blood sugar levels in obese individuals lead to increased susceptibility to infections due to the suppression of the immune response. Moreover, fatty skin folds can cause topical infections, ulcers, and delayed/impaired wound healing. Therefore, inflammatory and pro-inflammatory markers in the serum have gained importance in diseases such as diabetes and obesity. Furthermore, in obesity, reactive oxygen species (ROS) lead to DNA damage. 8-oxo-dG, which is the primary product of DNA oxidation, can be detected in the serum, saliva, and urine, making it an ideal biological marker for DNA damage in large population-based studies. The Comet assay analysis is a method used to demonstrate the double-strand breaks in DNA. Induction of γ-H2AX in tissue indicates the initiation of a well-regulated mechanism to reverse double-strand breaks in DNA. Potential benefits of monitoring the genomic health in obesity include creating a sense of urgency for personalized intervention measures and evaluating their progress. DNA damage in obesity is believed to be a reversible condition. Chronic inflammation is an etiological factor known to support DNA damage and neoplastic transformations in cells. Cytokines secreted from adipose tissue, especially TNF-alpha, IL-6, and IL-1β, promote the accumulation of various cells, including neutrophils, macrophages, and dendritic cells, and it indicates the initiation of an inflammatory process. In this project, it was aimed to investigate possible changes in inflammation markers and DNA damage in individuals undergoing bariatric surgery, who were beginning to improve endocrine and metabolic syndrome markers. 
 Materials and methods: For this purpose, blood and urine samples were collected from 45 obese patients, who had undergone bariatric surgery and 45 healthy volunteers matched for age and gender. The levels of inflammatory markers (IL-1β, IL-6, IL-8, and TNF-α) and the DNA damage marker γ-H2AX in serum, as well as the amount of 8-oxo-dG in urine, were determined using ELISA. Additionally, the percentage of DNA damage was determined using the Comet assay analysis. 
 Results: Weight control achieved through bariatric surgery and the subsequent reduction in fat tissue resulted in a significant decrease in the levels of γ-H2AX and 8-oxo-dG, as well as a parallel significant reduction in the percentage of DNA damage in the Comet assay results. The significant decrease in inflammatory markers IL-1β, IL-6, IL-8, and TNF-α levels indicated that bariatric surgery also affects inflammation indirectly. 
 Conclusion: Although there are numerous studies in the literature on individual parameters related to DNA damage in various diseases and obesity, it is believed that the present study determining DNA damage, oxidation, and repair mechanisms simultaneously with inflammatory marker levels serves as a guiding example for comparing genomic health and stability in pre-obese, post-obese, and non-obese individuals.

Distinct fibroblast functions associated with fibrotic and immune-mediated inflammatory diseases and their implications for therapeutic development.

Fibroblasts are ubiquitous cells that can adopt many functional states. As tissue-resident sentinels, they respond to acute damage signals and shape the earliest events in fibrotic and immune-mediated inflammatory diseases. Upon sensing an insult, fibroblasts produce chemokines and growth factors to organize and support the response. Depending on the size and composition of the resulting infiltrate, these activated fibroblasts may also begin to contract or relax thus changing local stiffness within the tissue. These early events likely contribute to the divergent clinical manifestations of fibrotic and immune-mediated inflammatory diseases. Further, distinct changes to the cellular composition and signaling dialogue in these diseases drive progressive fibroblasts specialization. In fibrotic diseases, fibroblasts support the survival, activation and differentiation of myeloid cells, granulocytes and innate lymphocytes, and produce most of the pathogenic extracellular matrix proteins. Whereas, in immune-mediated inflammatory diseases, sequential accumulation of dendritic cells, T cells and B cells programs fibroblasts to support local, destructive adaptive immune responses. Fibroblast specialization has clear implications for the development of effective induction and maintenance therapies for patients with these clinically distinct diseases.

The Protective Role of Tubular Epithelial Cells Produced Fms-like Tyrosine Kinase Receptor 3 Ligand in Acute Kidney Injury

Introduction: Dendritic cells (DC) accumulate in the kidneys of patients with acute kidney injury (AKI), but the Fms-like tyrosine kinase receptor 3 ligand (Flt3L)-dendritic cell axis is poorly defined in kidneys with AKI. Meanwhile it has not been reported whether Flt3L is produced by kidney cells under ischemic-reperfusion injury (IR) induced microenvironment. Methods: (1) Blood specimens and urine were collected from two patient cohorts: a) patients with pre-renal AKI and healthy controls for analysis of serum Flt3L. b) patients with acute myocardial infarction (AMI) developed with or without AKI on admission for analysis of serum and urine Flt3L. (2) Wild type mice and T cell-deficient mice ( Tcra -/- mice) were applied. IR induced AKI mice and hypoxia-reoxygenation stimulated HK-2 cell line (human tubular epithelial cell line) were constructed. The expression of Flt3L in kidney, tubular epithelial cells, and T cells were measured by RT-PCR, ELISA, immunohistochemistry, immunofluorescence staining, RNAscope, and flow cytometry. (3) Wild type mice and type I conventional dendritic cell (cDC1)-deficient mice ( Irf8 -/- mice) were treated with 15 μg rFlt3L or 10mg/kg gilteritinib (Flt3 inhibitor). They were subjected to IR. Serum and kidney tissues were collected. Kidney function, tubular injury, and DC accumulation were quantified. Results: Initially, among patients with pre-renal AKI, we observed an increased level of serum Flt3L within two days after admission. Another patient cohort revealed that this increase was specific for AMI patients with AKI rather than without AKI or healthy controls. Furthermore, among these AMI patients, serum Flt3L levels correlated with Creatinine increase (R 2 = 0.4532, p = 0.0002) and BUN increase (R 2 = 0.3417, p = 0.0017) within 48 hours after admission. Similarly, urine Flt3L levels among these AMI patients also steadily elevated with Creatinine increase (R 2 = 0.6395, p < 0.0001) and BUN increase (R 2 = 0.5115, p = < 0.0001) within 48 hours after admission. Flt3L was also enhanced in wild type mice with IR-AKI but not affected in T cell-deficient mice ( Tcra -/-) with IR-AKI. Among kidney tissue, Flt3L-positive cells scattered within tubules in outer stripe of the outer medulla (OSOM) and mRNA and protein increased within 24 hours after IR-AKD. In vitro, FLT3L mRNA was markedly induced in HK-2 cells during hypoxia and FLT3L protein remained enhanced during reoxygenation. Phenotypically, the numbers of renal cDC1 and CD64 +DC were significantly decreased in gilteritinib-treated IR-AKI mice, which were associated with more severe tubular injury. With reduced kidney cDC1, Irf8 -/- mice also showed worsen kidney injury and aggravated functional failure upon IR-AKI. Therapeutic administration of rFlt3L significantly increased kidney cDC1 and CD64 +DC upon IR-AKI in wild type but not Irf8 -/- mice. This was associated with significantly reduced tubular injury of wild type mice .In addition, pre-treatment of wild type mice with rFlt3L increased kidney cDC1 and protected the mice from severe IR-AKI. Conclusion: Flt3L is upregulated in human and mice and produced by tubular epithelial cells during IR-AKI. It fosters the accumulation of kidney cDC1 and CD64 +DC, thereby limiting the severity of kidney injury in mice. The current study implies the possibility of DC-based immunotherapy for treatment of AKD.

HDAC3 Is Required for Pathognomonic Features of Langerhans Cell Histiocytes

Langerhans cell histiocytosis (LCH) is a pediatric inflammatory myeloid neoplasm that develops due to dysregulated myeloid cell development. BRAFV600E is the most common disease-causing mutation and constitutively activates the mitogen-activated protein kinase (MAPK) pathway in myeloid lineage precursors leading to the key pathognomonic features of LCH cells. Enhanced myelopoiesis and reduced CCR7 expression promote accumulation of LCH cells in tissues by simultaneously increasing the production of pathological DCs and preventing tissue egress. Furthermore, LCH cells acquire an oncogene induced senescence-associated secretory phenotype (SASP) that depends on mammalian target of rapamycin (mTOR), which is hallmarked by increased expression of anti-apoptotic proteins, inflammatory cytokines, and matrix metalloproteinases enhancing survival of LCH cells and promoting recruitment of inflammatory immune cells forming characteristic granulomatous lesions. These pathognomonic features result in the accumulation of LCH cells in any organ causing a wide range of clinical symptoms. Frontline therapy for LCH involves combination chemotherapy and steroidal anti-inflammatories, or MAPK inhibitors, which have significant toxicity and fail to eliminate disease causing precursors. New therapeutic approaches are urgently needed. Here, using multiple genetic mouse models, we show that normal epidermal Langerhans cells (LCs) depend on HDAC3 for their development, differentiation, and survival. Integrative RNA and chromatin-immunoprecipitation-sequencing show loss of HDAC3 abrogates the expression of master regulators of myeloid development and function including Csf1r, Spi1, Id2 and Runx3. LCH cells are also known to rely on Csf1r and Pu.1 for their development and homeostasis, thus we hypothesized that LCH cells similarly rely on HDAC3 for their development and survival. CD11c Cre LSL-BRAFV600E ( BRAFV600E CD11c) mice develop severe multifocal LCH with pronounced lesion development in their livers and lungs, hepatosplenomegaly, and a reduced lifespan due to the accumulation of pathological dendritic cells (DCs). We generated BRAFV600E CD11c HDAC3 fl/fl ( BRAFV600E HD3KO) mice, which produce pathological DCs that simultaneously express BRAFV600E and harbor a conditional deletion in the deacetylase domain of HDAC3. Compared to BRAFV600E CD11c mice, BRAFV600E HD3KO mice exhibited significantly less hepatosplenomegaly, reduced lesional burden (Panel A), attenuated disease progression, and improved survival indicating reduced LCH disease burden. Compared to BRAFV600E CD11c flow cytometry showed BRAFV600E HD3KO had reduced numbers of LCH cells in lungs and livers linking improved disease outcomes to abrogation of pathological DCs. Flow cytometric analysis of circulating myeloid cells further found reduced frequency of circulating DCs and DC progenitors, indicating that a lack of HDAC3 activity prevents the development of pathological DCs (Panel B). LCH-like cells can be generated in vitro by culturing BRAFV600E CD11c bone marrow with granulocyte-monocyte colony-stimulating factor (GM-CSF), providing a valuable drug screening tool. Treating LCH-like cells with RGFP966, an HDAC3-specific inhibitor, increased apoptosis indicated by annexin-V and DAPI staining, reduced expression of Bcl-2, increased CCR7 expression, and decreased S6 phosphorylation (an indication of decreased mTOR activity), showing that pharmacological inhibition of HDAC3 may prove therapeutically efficacious by abrogating pathognomonic features of LCH cells. Together, our findings identify HDAC3 as a critical epigenetic regulator for both healthy and pathological LCs. We further show, HDAC3 is required for multiple pathognomonic features of LCH cells and could be a promising drug target. Furthermore, if HDAC3 is required for the development of pathological DC and DC progenitors, HDAC3 blockade would address a great need in treatment of patients with LCH.

Milk fat globule membrane supplementation protects against β-lactoglobulin-induced food allergy in mice via upregulation of regulatory T cells and enhancement of intestinal barrier in a microbiota-derived short-chain fatty acids manner

Milk fat globule membrane (MFGM), which contains abundant glycoproteins and phospholipids, exerts beneficial effects on intestinal health and immunomodulation. The aim of this study was to evaluate the protective effects and possible underlying mechanisms of MFGM on cow’s milk allergy (CMA) in a β-lactoglobulin (BLG)-induced allergic mice model. MFGM was supplemented to allergic mice induced by BLG at a dose of 400 mg/kg body weight. Results demonstrated that MFGM alleviated food allergy symptoms, decreased serum levels of lipopolysaccharide, pro-inflammatory cytokines, immunoglobulin (Ig) E, IgG1, and Th2 cytokines including interleukin (IL)-4, while increased serum levels of Th1 cytokines including interferon-γ and regulatory T cells (Tregs) cytokines including IL-10 and transforming growth factor-β. MFGM modulated gut microbiota and enhanced intestinal barrier of BLG-allergic mice, as evidenced by decreased relative abundance of Desulfobacterota, Rikenellaceae, Lachnospiraceae, and Desulfovibrionaceae, while increased relative abundance of Bacteroidetes, Lactobacillaceae and Muribaculaceae, and enhanced expressions of tight junction proteins including Occludin, Claudin-1 and zonula occludens-1. Furthermore, MFGM increased fecal short-chain fatty acids (SCFAs) levels, which elevated G protein-coupled receptor (GPR) 43 and GPR109A expressions. The increased expressions of GPR43 and GPR109A induced CD103+ dendritic cells accumulation and promoted Tregs differentiation in mesenteric lymph node to a certain extent. In summary, MFGM alleviated CMA in a BLG-induced allergic mice model through enhancing intestinal barrier and promoting Tregs differentiation, which may be correlated with SCFAs-mediated activation of GPRs. These findings suggest that MFGM may be useful as a promising functional ingredient against CMA.

Accumulation of plasmacytoid dendritic cell is associated with a treatment response to DNA-damaging treatment and favorable prognosis in lung adenocarcinoma.

Favorable responses to the treatment including immune checkpoint inhibitors (ICIs) have been consistently reported in lung cancer with smoking history. As the tumor microenvironment (TME) may be involved in the treatment response to ICIs, we aimed to investigate the TME of lung cancer with different smoking status. Lung adenocarcinoma (LUAD) tissue (Tu) and adjacent normal-appearing lung tissue (NL) from current and never smokers were investigated by single-cell RNA sequencing and immunofluorescence and immunohistochemical staining. The clinical implications of identified biomarkers were validated using open-source datasets. The lungs of smokers had an increased proportion of innate immune cells in NL tissues, whereas Tu tissues had a lower proportion of these cells than those of non-smokers. Monocyte-derived macrophages (mono-Mc), CD163-LGMN macrophages, monocyte-derived dendritic cells (DCs), and plasmacytoid DCs (pDCs) were significantly enriched in smokers' Tu. Among these clusters, pDCs, specifically enriched in the Tu of smokers. The expression of representative pDC markers, leukocyte immunoglobulin-like receptor A4 (LILRA4) and Toll-like receptor 9 (TLR9), was increased in the stromal cells of LUAD in patients with a smoking history. In an animal model of lung cancer, ionizing radiation induced robust TLR9 expressing immune cells in peritumoral area. Survival analysis using a TCGA-LUAD dataset indicated that patients overexpressing pDC markers exhibited superior clinical outcomes to age-, sex-, and smoking-matched control groups. Top 25% patients with high TLR9 expression exhibited significantly higher tumor mutational burden than that of low TLR9 expression group (bottom 25% patients) (5.81 mutations/Mb vs 4.36 mutations/Mb; P = 0.0059, Welch's two-sample t-test). There is an increased pDC in the TME of smokers' lung cancer, and the response of pDC to DNA damaging treatment would lead a conducive environment to ICIs containing regimens. These findings suggest that R&D that induces an increase in the activated pDC population is continuously required to enhance therapeutic effectiveness of ICIs-containing therapies in lung cancer.

The impact of lipids on the cancer-immunity cycle and strategies for modulating lipid metabolism to improve cancer immunotherapy.

Lipids have been found to modulate tumor biology, including proliferation, survival, and metastasis. With the new understanding of tumor immune escape that has developed in recent years, the influence of lipids on the cancer-immunity cycle has also been gradually discovered. First, regarding antigen presentation, cholesterol prevents tumor antigens from being identified by antigen presenting cells. Fatty acids reduce the expression of major histocompatibility complex class I and costimulatory factors in dendritic cells, impairing antigen presentation to T cells. Prostaglandin E2 (PGE2) reduce the accumulation of tumor-infiltrating dendritic cells. Regarding T-cell priming and activation, cholesterol destroys the structure of the T-cell receptor and reduces immunodetection. In contrast, cholesterol also promotes T-cell receptor clustering and relative signal transduction. PGE2 represses T-cell proliferation. Finally, regarding T-cell killing of cancer cells, PGE2 and cholesterol weaken granule-dependent cytotoxicity. Moreover, fatty acids, cholesterol, and PGE2 can improve the activity of immunosuppressive cells, increase the expression of immune checkpoints and promote the secretion of immunosuppressive cytokines. Given the regulatory role of lipids in the cancer-immunity cycle, drugs that modulate fatty acids, cholesterol and PGE2 have been envisioned as effective way in restoring antitumor immunity and synergizing with immunotherapy. These strategies have been studied in both preclinical and clinical studies.

IL-12α deficiency attenuates pressure overload-induced cardiac inflammation, hypertrophy, dysfunction, and heart failure progression.

IL-12α plays an important role in modulating inflammatory response, fibroblast proliferation and angiogenesis through modulating macrophage polarization or T cell function, but its effect on cardiorespiratory fitness is not clear. Here, we studied the effect of IL-12α on cardiac inflammation, hypertrophy, dysfunction, and lung remodeling in IL-12α gene knockout (KO) mice in response to chronic systolic pressure overload produced by transverse aortic constriction (TAC). Our results showed that IL-12α KO significantly ameliorated TAC-induced left ventricular (LV) failure, as evidenced by a smaller decrease of LV ejection fraction. IL-12α KO also exhibited significantly attenuated TAC-induced increase of LV weight, left atrial weight, lung weight, right ventricular weight, and the ratios of them in comparison to body weight or tibial length. In addition, IL-12α KO showed significantly attenuated TAC-induced LV leukocyte infiltration, fibrosis, cardiomyocyte hypertrophy, and lung inflammation and remodeling (such as lung fibrosis and vessel muscularization). Moreover, IL-12α KO displayed significantly attenuated TAC-induced activation of CD4+ T cells and CD8+ T cells in the lung. Furthermore, IL-12α KO showed significantly suppressed accumulation and activation of pulmonary macrophages and dendritic cells. Taken together, these findings indicate that inhibition of IL-12α is effective in attenuating systolic overload-induced cardiac inflammation, heart failure development, promoting transition from LV failure to lung remodeling and right ventricular hypertrophy.

AXL antibody and AXL-ADC mediate antitumor efficacy via targeting AXL in tumor-intrinsic epithelial-mesenchymal transition and tumor-associated M2-like macrophage.

The receptor tyrosine kinase AXL is an emerging driver of cancer recurrence, while its molecular mechanism remains unclear. In this study we investigated how AXL regulated the disease progression and poor prognosis in non-small cell lung cancer (NSCLC) and triple negative breast cancer (TNBC). We performed AXL transcriptome analysis from TCGA datasets, and found that AXL expression was significantly elevated in NSCLC and TNBC correlating with poor prognosis, epithelial-mesenchymal transition (EMT) and immune-tolerant tumor microenvironment (TME). Knockdown of AXL or treatment with two independent AXL antibodies (named anti-AXL and AXL02) all diminished cell migration and EMT in AXL-high expressing NSCLC and TNBC cell lines. In a mouse model of 4T1 TNBC, administration of anti-AXL antibody substantially inhibited lung metastases formation and growth, accompanied by reduced downstream signaling activation, EMT and proliferation index, as well as an increased apoptosis and activated anti-tumor immunity. We found that AXL was abundantly activated in tumor nodule-infiltrated M2-macrophages. A specific anti-AXL antibody blocked bone marrow-derived macrophage (BMDM) M2-polarization in vitro. Targeting of AXL in M2-macrophage in addition to tumor cell substantially suppressed CSF-1 production and eliminated M2-macrophage in TME, leading to a coordinated enhancement in both the innate and adaptive immunity reflecting M1-like macrophages, mature dendritic cells, cytotoxic T cells and B cells. We generated a novel and humanized AXL-ADC (AXL02-MMAE) employing a site-specific conjugation platform. AXL02-MMAE exerted potent cytotoxicity against a panel of AXL-high expressing tumor cell lines (IC50 < 0.1 nmol/L) and suppressed in vivo growth of multiple NSCLC and glioma tumors (a minimum efficacy dose<1 mg/kg). Compared to chemotherapy, AXL02-MMAE achieved a superior efficacy in regressing large sized tumors, eliminated AXL-H tumor cell-dependent M2-macrophage infiltration with a robust accumulation of inflammatory macrophages and mature dendritic cells. Our results support AXL-targeted therapy for treatment of advanced NSCLC and TNBC.

Dendritic Cell-Based Immunity: Screening of Dendritic Cell Subsets in Breast Cancer-Bearing Mice.

Breast cancer (BC) is the most devastating disease, particularly the lethal invasive form. It is the most underlying cause of death among women worldwide. The expansion of BC is controlled by a variety of alterations in the tumor cells themselves, in addition to the state of the immune system, which has a direct influence on the tumor microenvironment. Numerous receptors expressed by T-cells interact with ligands on antigen-presenting cells to provide activation signals results in mounting effector anti-tumor T-cell responses. On the other hand, there is a dearth of information about the actual interactions and reactions of T-cells and dendritic cells (DCs) all through the progression of tumor development. Immune system response against BC was investigated through tumor induction in mice. The size and volume of the tumor were calculated. Moreover, the phenotypical profile of T-cells and DCs from lymph nodes (LN) and spleens of BC-bearing mice was investigated. In addition, the levels of Transforming growth factor-β, Interferon-gamma (IFN-γ), Interleukin IL-2, IL-10, IL-4, IL-12, and tumor necrosis factor (TNF)-α were determined. MDA231 cells were utilized to induce BC in 30 white BALB/C mice, whereas the other 30 mice acted as healthy controls and were not treated with any cancer-causing agents. The impact of malignancy was evaluated using flow cytometry based on the marking surface molecules, as well as the titer of specific cytokines of the mice's LN culture using the ELISA method. These cytokines included transforming growth factor-β (TGF-β), IFN-γ, IL-2, IL -10, IL -4, IL -12, and TNF-α. The findings showed that the maturation of DCs was inhibited, followed by an accumulation of immature DCs. These immature DCs increase the release of TGF-β and cytokines like IL-10 and inhibit the release of IFN-γ and IL-12 in the culture supernatant of nodal lymph and spleen suspension of BC-bearing mice compared to control. In addition, there was a low expression of CD80 and CD86 on DCs, which indicates a low maturation process. According to the findings, the tumor microenvironment may have been responsible for preventing the maturation of DCs. This, in turn, weakened the immune response and facilitated the ability of the tumor to proliferate. Furthermore, the tumor microenvironment increased the number of immature DCs by inhibiting their stimulation by overexpression of TGF-β-produced by regulatory T lymphocytes and stimulation of tumor cells. In addition, the tumor microenvironment stimulated the secretion of cytokines such as IL-10, and CD4 and decreased the secretion of IFN-γ-and IL-12 in tumor-induced mice cultured LN and spleen.