Accession Number NC Research Articles

Primer design and restriction site analysis targeting POU domain class 1 transcription factor 1 gene of Friesian Holstein in silico

This study was conducted to design primer set and to map restriction site targeting synonymous mutation c.297A>G of the POU domain class 1 transcription factor 1 gene (POU1F1) of Friesian Holstein in silico. Primer set was designed to target exon 3 of the POU1F1 based on nucleotide sequence at GenBank database with accession number NC_037328.1 using primer3. Simulations of amplification targeting POU1F1 fragment and restriction fragment length polymorphism (RFLP) were conducted in silico using serial cloner version 2.6 and NEBcutter version 3.0, respectively. This study used a primer pair (5′-CCT TTT AGA ACT GAG ACT GGC TG-3′ and 5′-CCC ACA GCT GTT AAC AAG CA-3′) that produce 356 bp of estimated product size. Moreover, a synonymous mutation, c.297A>G of the POU1F1, could be detected using BsII restriction enzyme in silico. The BsII did not have restriction site for AA genotype. On the other hand, it could cut the PCR product size into two fragments (167 and 189 bp) for GG genotype. It can be concluded that in silico analysis successfully amplified target region using primer designed in this study and RFLP simulation using BsII could detect synonymous mutation c.297A>G of the POU1F1. Further in vitro study should be conducted to identify c.297A>G in Friesian Holstein population.

Analisis Molekuler Tilapia Lake Virus (TiLV) di Sentra Budidaya Benih Ikan Gurami (Osphronemus goramy) Jawa Timur

Tilapia Lake Virus (TiLV) is a New Emerging Disease that has been defined and included in the WOAH disease list (WOAH, 2022). This virus can infect both freshwater and marine fish, causing high mortality in Ttilapia up to 90%. Reverse transcyptase method - Semi Nested Polymerase Chain Reaction (RT-snPCR) for detection of TiLV in Osphronemus goramy. TiLV was discovered for the first time in Thailand and was also found in Jogjakarta in 2021. Further research is needed to see the damage and genetic variation caused by TiLV in Osphronemus goramy. This study aims to study the genetic variability and homology of TiLV isolates in Osphronemus goramy as definitive hosts in East Java. The results showed clinical symptoms of lethargic fish, decreased appetite, abnormal behavior, reduced reflexes, sluggish movements, darker body color, congestion, thinning fins and exopthalmia. The PCR results showed that the Osphronemus goramy showing clinical symptoms of TiLV infection were all positive. The sequencing results were further identified using the BLAST program, showing the highest similarity of the genetic identity of the sample at 96.8% with TiLV from Israel (Genebank Accession Number NC 029927.1).

Fine structure of a partition in the spike glycoprotein encoded in the SARS-CoV-2 genome

The gene encoding the spike glycoprotein of the SARS-CoV-2 virus that causes COVID-19 disease, was analyzed through two types of periodic tables (standard and cube) of the genetic code to discover the internal fine structure of the spike (S) protein. The analysis was performed on the Wuhan-Hu-1 SARS-CoV-2 sequence (GenBank accession number NC_045512.2). A partition was detected between codon numbers (three-letter code numbers) 47 and 48 that code amino acids in the S-protein. The population distribution of organized codes and amino acid replacements in the S-protein showed large differences between two regions of the cube-type periodic table. The genetic codes of codon numbers 48–63 (4th plane of the cube table) had a higher frequency than the genetic codes of each of the other three planes (1st–3rd planes). Planes-linkage structures involved in the partition were also analyzed and a simplified model for the S-protein gene was obtained where a planes-linkage of the 4th plane and another planes-linkage of the 1st–3rd planes were linked together in alternate shifts. Most of the code population in the 4th plane and their planes-linkage multiformity gave additional support to the partition between codon numbers 47 and 48 in the S-protein gene. Analysis of real lineages of the SARS-CoV-2 virus through the cube-type periodic table identified distinguishing features of the Omicron lineage that included not only a large code population within the receptor-binding domain of the S-protein, but also large percentage rises in the population of amino acid replacements in the 1st and 2nd planes.

A Novel Pathogen of an Emerging Infectious Disease (Large Kidney Disease) in Farmed Blue Foxes

An emerging infectious disease (EID) in foxes called “large kidney disease”, characterized by enlarged kidneys, has been breaking out in fox farms in China, although its pathogenesis has not yet been elucidated. Here, we performed viral metagenomics sequencing on diseased fox tissue samples that identified a virus with 82.6% homology to the xenotropic murine leukemia virus-related virus (XMRV) PreXMRV-1 provirus strain (GenBank accession number NC_007815.2) in sick fox tissue. It was named PreXMRV-20, and its genome was verified by reverse transcription-polymerase chain reaction (PCR) and PCR product sequencing. Nonenveloped and polygonal virus-like particles consistent with the shape and size of XMRV were observed by negative staining electron microscopy. Administered subcutaneously, PreXMRV-20 infected weaned foxes, leading to growth retardation. The discovery of the PreXMRV-20 strain (the first isolation of an XMRV homolog in blue foxes) identifies a potential public health issue in blue fox breeding since XMRV has been confirmed to be a zoonotic virus.

Genome Sequence of Novel Clostridium perfringens Bacteriophage vB_CpeS-17DYC, Isolated from Wastewater in China.

Phage vB_CpeS-17DYC was isolated from wastewater from a poultry market using Clostridium perfringens strain DYC. The vB_CpeS-17DYC genome is 39,184 bp long, with 65 open reading frames and a GC content of 30.6%. It shared 93.95% nucleotide identity, with 70% query coverage, with Clostridium phage phiCP13O (GenBank accession number NC_019506.1). Virulence factor genes were not found in the vB_CpeS-17DYC genome.

Analysis of prevailing pertussis strains from different regions in China after the application of acellular vaccines.

Analysis of prevailing pertussis strains from different regions in China after the application of acellular vaccines.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Haplogroups determination from RNR1 and RNR2 regions of mitochondrial DNA

Mitochondrial DNA (mtDNA) has two regions, i.e. coding and control regions which are also known as hypervariation (HV) regions. Analysis of hypervariation regions or the entire human mtDNA genome is an important element that could be used during human evolutionary, forensic or phylogenetic studies. Although most human phylogenetics studies often use HV regions; the lack of information from those regions can complicate the process of haplogroup determination. Therefore, in this study, the human mtDNA coding regions such as MT-RNR1 and MT-RNR2 genes were used as an alternative to determine the haplogroups. A total of four primer pairs were designed based on MT-RNR1 and MT-RNR2 genes using the Primer Designing Tool software. The human mtDNA sequence from the National Center for Biotechnology Information (NCBI) database (accession number NC_012920.1) was used as a reference. These primers were used in the PCR amplification approach using DNA genomic samples isolated from human peripheral blood. Polymorphism analysis of MT-RNR1 and MT-RNR2 regions using the Mitomaster database was performed to determine haplogroups. The results indicated that three haplogroups were identified which are N11a, H2a and H1. In conclusion, the primers designed from mitochondrial RNR1 and RNR2 genes can be used for human haplogroup identification.

Bioinformatics Analysis of LDLR Gene Mutation that Shed a New Light on Red Yeast Rice Monacolin K Treatment – Systematic Review

Background: Hypercholesteremia is the major cause of cardiovascular diseases. It results from elevated cholesterol levels in the blood. LDL cholesterol is removed from the circulation by using the LDL receptor. Red mold rice or red yeast rice is produced by fermentation of the Monascus Purpureus yeast on rice. Many researchers suggest that the active component in Red Yeast Rice (monacolin k) serves as a treatment for hypercholesteremic patients.
 Methods: By using NCBI databases, specifically GenBank to analyze DNA sequence and mRNA sequence of LDLR gene. GenBank file format was helpful to extract an accession number of the gene, number of amino acids, exons, and length of nucleotides. FASTA format was also useful to retrieve the nucleotide sequence and get the function of the protein. BLAST was used to compare the protein product of the LDLR gene between humans and pan paniscus (pygmy chimpanzee).
 Results: In accession number NC_000019, the number of amino acids in protein product is 44389 bp, and the number of exons found is 18. On the other hand, the gene is located in chromosome 19. The function of LDLR gene is to control the production of LDL receptor where the low-density lipoprotein particles attach to it and are taken into the cell ending up in the lysosome where the protein is degraded and cholesterol is made which will inhibit 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase that controls the production of cholesterol. Finally, many organisms have the same gene like dogs, cows, mice, rats, zebrafish, and frogs.
 Conclusion: Mutation in the LDLR gene causing high level of cholesterol in the blood especially LDL (Low-density Lipoprotein). Monacolin k that found in red yeast rice (RYR) is safe and natural alternative treatment for hypercholesteremic patients by lowering the cholesterol level in the blood.

First Report of Melon Aphid-Borne Yellows Virus Infecting Watermelon in Korea.

Watermelon (Citrullus lanatus) is one of the most popular crops in Korea, with over 100 million units produced annually. As watermelon cultivation increases, the damage caused by plant viruses in watermelon farms is also increasing. In July 2020, some watermelons cultivated on farms in Uiryeong showed typical viral symptoms, such as yellowing and necrosis. In previous studies, two plant viruses, cucurbit aphid-borne yellows virus (CABYV) and cucurbit chlorotic yellows virus (CCYV), have been reported as causal agents of yellowing disease in the cucurbitaceae plant in Korea. To identify the virus(es) associated with the symptomatic watermelon plants, 11 samples were collected. Total RNA was extracted from each sample using the Plant RNA Prep kit (Biocube System, Gwacheon, Korea). RT-PCR was performed using primer sets specific to CABYV and CCYV to detect each virus (Kwak et al. 2018, Wintermantel et al. 2019). CABYV was detected in one sample, and CCYV was detected in 8 samples. Every sample presented similar yellowing symptoms; however, neither virus was detected in the remaining two samples. To investigate unknown viruses, a transcriptome library was constructed using total RNA of the watermelons and sequenced using a NovaSeq 6000 sequencer (Illumina, San Diego, CA). The reads were de novo assembled and annotated using the KEGG virus genome database with the NCBI BLAST utility. All procedures of next generation sequencing were performed by Macrogen (Seoul, Korea). Three large viral contigs were identified, and additional BLAST analyses for nucleotides (nt) and proteins indicated that they were CABYV, CCYV, and melon aphid-borne yellows virus (MAYBV). A total of 247,198 reads were mapped to reference MABYV sequence (GenBank Accession Number NC_010809), and the sequencing depth was 6,575X. The contig (MW505927) had a size of 5,677 nt and showed 100% coverage and 96% identity with known complete MABYV sequences (JQ700307 and EU000534). To confirm the presence of MABYV, RT-PCR was performed using specific primer sets targeting MABYV (MABYV-262-F, 5'-GAACCGTCGACGCACTTCAAAGAGTA-3' and Polero-uni-R, 5'-GATYTTATAYTCATGGTAGGCCTTGAG-3'; Knierim et al. 2010). The expected size of 262 bp was obtained from 5 out of 11 samples, including the two samples mentioned above. MABYV belongs to the genus Polerovirus and has been reported in cucurbit crops in China, Taiwan, and Thailand (Xiang et al. 2008, Knierim et al. 2010, Cheewachaiwit et al. 2017). According to the farmer, outbreak of aphids had previously occurred and were controlled with pesticides. Since aphids are known to be vectors of poleroviruses, we surmise that the watermelons were infected with MABYV by the aphids at that time. To monitor the outbreak of MABYV, watermelon farms in Uiryeong will be continuously investigated. To our knowledge, this is the first report of MABYV in Korea.

Unique SARS-CoV-2 Variant Exhibiting Plenteous Missense Mutations in Structural and Nonstructural Genes.

Determining the variations in SARS-CoV-2 variant is considered main factor for understanding the pathogenic mechanisms, aid in diagnosis, prevention and treatment. The present study aimed to determine the genetic variations of SARS-CoV-2. The sequences of SARS-CoV-2 were obtained from National Center for Biotechnology Information (NCBI) and studied according to the time of isolation and their origin. The genome sequence of SARS-CoV-2 accession number NC_045512 which represented the first isolated sequence of SARS-CoV-2 (Wuhan strain) was used as the reference sequence. The obtained genome sequences of SARS-CoV-2 were aligned against this Wuhan strain and variations among nucleotides and proteins were examined. The sequence of SARS-CoV-2 accession number MT577016 showed very low homology 98.75% compared to Wuhan strain NC_045512. The analysis identified 301 nucleotide changes, which correspond to 258 different mutations; most of them 80% (207/258) were missense point mutations followed by 17.1% (44/258) silent point mutations. The critical mutations occurred in viral structural genes; 16.7% (43/258) mutations reported in S gene and 1 missense mutation was observed in E gene. Our finding showed the lowest homology and relatively distant phylogenetic relation of this SARS-CoV-2 variant with Wuhan strain along with high frequency of mutations including those in spike S and envelope E genes.

Genome Sequencing Identified a SARS-CoV-2 Lineage B.1.1.7 Strain with a High Number of Mutations from Dhaka, Bangladesh.

ABSTRACTWe report a coding-complete genome sequence of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) strain SARS-CoV-2/BGD/GC001, isolated from a Bangladeshi patient with respiratory symptoms. Phylogenetic analysis assigned this strain to lineage B.1.1.7, which presented a total of 36 mutations in the spike and other genomic regions compared to strain Wuhan Hu-1 (GenBank accession number NC_045512.2).

Phylo-geo-network and haplogroup analysis of 611 novel coronavirus (SARS-CoV-2) genomes from India.

The novel coronavirus (SARS-CoV-2) from Wuhan China discovered in December 2019 has since developed into a global epidemic. Presently, we constructed and analyzed the phylo-geo-network of SARS-CoV-2 genomes from across India to understand the viral evolution in the country. A total of 611 full-length genomes from different states of India were extracted from the EpiCov repository of GISAID initiative on 6 June, 2020. Their alignment with the reference sequence (Wuhan, NCBI accession number NC_045512.2) uncovered 270 parsimony informative sites. Furthermore, 339 genomes were divided into 51 haplogroups. The network revealed the core haplogroup as that of reference sequence NC_045512.2 (Haplogroup A1) with 157 identical sequences present across 16 states. Remaining haplogroups had <10 identical sequences across a maximum of three states. Some states with fewer samples had more haplogroups. Forty-one haplogroups were localized exclusively to any one state. The two most common lineages are B6 and B1 (Pangolin) whereas clade A2a (Covidex) appears to be the most predominant in India. Because the pandemic is still emerging, the observations need to be monitored.

Genetic variations among SARS-CoV-2 strains isolated in China

The rapid spread of COVID-19, which has led to a global pandemic, has placed public health systems under severe pressure. Identifying variations in SARS-CoV-2 strains from different regions is a key factor for understanding the pathogenic mechanisms, aid in diagnosis, prevention and therapy of this disease. The present study is an analytical descriptive study aimed to determine genetic variations among SARS-CoV-2 strains isolated in China. Sixty six complete genome sequences of the virus were retrieved from NCBI, the sequence of original Wuhan strain accession number NC 045512 was used as the reference sequence. Each genome sequence was blasted against the original Wuhan strain; the analysis was done using NCBI Nucleo-blast. The collected sequences showed 10 different variants. One hundred and thirty four mutations were identified among the variants of SARS-CoV-2 in this study; most of them 52.2% (70/134) were missense point mutation, majority of the mutations 65.7% (88/134) occurred in the open reading frame a/b (ORFab), few mutations occurred in the structural viral genome, each of spike (S) gene and nucleocapsid (N) gene showed 4 mutations; 2 silent point mutations and 2 missense point mutations occurred in each gene whereas membrane (M) gene showed silent point mutation and no mutation observed in the envelope E gene. The remarkable observation in this study showed by Yunnan variant accession number MT226610 which exhibited high incidence of mutations, it displayed 28 different point mutations; only 3(10.7%) of them were silent mutations while the rest were missense mutations. Our analysis showed several mutations including spike S gene and membrane M gene which may be responsible for a change in the structures of target proteins.

Prediction of Epitopes in the Proteome of Helicobacter pylori

Helicobacter pylori (H. pylori) is classified by the World Health Organization (WHO) as a group I carcinogen and is one of the most efficient human pathogens with over half of the world's population colonized by this gram-negative spiral bacterium. H. pylori can cause a chronic infection in the stomach during early childhood that persists throughout life due to diverse mechanisms of immune response evasion. H. pylori has several factors strongly associated with increased risk of disease such as toxins, adhesins, and chemoattractants, some of which are highly polymorphic, phase variable, and have different functions. Conventional treatments involve the use of antibiotics. However, treatment frequently fails due to the resistance H. pylori has progressively developed to antibiotics. This creates the need for different treatments made possible by identifying new therapeutic targets in the pathogen’s genome.The purpose of this study was an in silico prediction of T- and B- epitopes in H. pylori proteins. Twenty-two external membrane proteins from H. pylori Strain 26695 (accession number NC_000915) were identified using the web tool Vaxign (http://www.violinet.org/vaxign/). A total of one-hundred epitopes (60 class I epitopes and 40 class II epitopes) that could be used to develop novel non-antibiotics drugs for an H. pylori infection were predicted.

Oxygen-Inducible Conversion of Lactate to Acetate in Heterofermentative Lactobacillus brevis ATCC 367.

Lactobacillus brevis is an obligatory heterofermentative lactic acid bacterium that produces high levels of acetate, which improve the aerobic stability of silages against deterioration caused by yeasts and molds. However, the mechanism involved in acetate accumulation has yet to be elucidated. Here, experimental evidence indicated that aerobiosis resulted in the conversion of lactate to acetate after glucose exhaustion in L. brevis ATCC 367 (GenBank accession number NC_008497). To elucidate the conversion pathway, in silico analysis showed that lactate was first converted to pyruvate by the reverse catalytic reaction of lactate dehydrogenase (LDH); subsequently, pyruvate conversion to acetate might be mediated by pyruvate dehydrogenase (PDH) or pyruvate oxidase (POX). Transcriptional analysis indicated that the pdh and pox genes of L. brevis ATCC 367 were upregulated 37.92- and 18.32-fold, respectively, by oxygen and glucose exhaustion, corresponding to 5.32- and 2.35-fold increases in the respective enzyme activities. Compared with the wild-type strain, the transcription and enzymatic activity of PDH remained stable in the Δpox mutant, while those of POX increased significantly in the Δpdh mutant. More lactate but less acetate was produced in the Δpdh mutant than in the wild-type and Δpox mutant strains, and more H2O2 (a product of the POX pathway) was produced in the Δpdh mutant. We speculated that the high levels of aerobic acetate accumulation in L. brevis ATCC 367 originated mainly from the reuse of lactate to produce pyruvate, which was further converted to acetate by the predominant and secondary functions of PDH and POX, respectively.IMPORTANCE PDH and POX are two possible key enzymes involved in aerobic acetate accumulation in lactic acid bacteria (LAB). It is currently thought that POX plays the major role in aerobic growth in homofermentative LAB and some heterofermentative LAB, while the impact of PDH remains unclear. In this study, we reported that both PDH and POX worked in the aerobic conversion of lactate to acetate in L. brevis ATCC 367, in dominant and secondary roles, respectively. Our findings will further develop the theory of aerobic metabolism by LAB.

Analisis Mutasi pada Kodon 531 Pada Gen Rpob Mycobacterium tuberculosis Penyebab Resistensi Rifampisin

Tuberculosis (TB) is a serious disesase in the world. According to the WHO, it is estimated more than 3 million people die every year as a result of this infectious disease. One factor that causes diffi culty handling TB chemoteraphy is not effective against the bacteria Mycobacterium tuberculosis that causes TB . Effectiveness of treatment is often hampered by the emergence of bacterial resistance against M. Tuberculosis chemotherapy agents are given. From some research found that bacterial resistance may occur in more one type of chemotherapy agent also known as multi-drug resistance (MDR). Mycobacterium tuberculosis develop resistance mechanisms that are different from other bacteria in general. In prokaryotes, resistance is generally due to the transfer of genetic, either through plasmids,transposons and other. Reference sequence beta sub unit of RNAP protein M. Tuberculosis with accession number NP_215181.1 and M. tucerculosis rpoB gene with accession number NC_000962.3 used to obtain preliminary information from the data base www.ncbi.nlm.gov and www.uniprot.org . Mutation done according to several studies literature. Analysis of the composition, profi le, location and structure of protein using www.expasy.org, TMHMM and http://bioinf.cs.ucl.ac.uk/psipred. The primer design is done with Primer Design Program. Based on the analysis of mutation in the beta subunit of RNAP protein M. Tuberculosis, codon 531 (Ser -&gt;Leu), it is known that mutations cause changes in some properties and structure of proteins. Possible changes affecting the nature of bacterial resistance to antibiotics rifampicin. However, further analysis needs to be done with the analysis of the docking technique.

Phylogenetic tree of Kuantan cattle by DNA barcoding

&lt;p&gt;Kuantan cattle is one of local beef cattle breed of Riau Province which its origin was unknown. Kuantan cattle are commonly found in Indragiri Hulu and Kuantan Singingi Regency. Based on phenotype characterizations, kuantan cattles are similar with pesisir cattle (West Sumatera beef cattle). Historically, kuantan cattle were pesisir cattle brought by “minang” immigrants (Immigrant from West Sumatera) to this region. The purpose of this study was to analyze the origin of the kuantan cattle through genetic diversity analysis using DNA barcode. DNA barcode used was Cytochrome oxidase subunit I gene which was found in the mtDNA. DNA isolation was done on 25 kuantan’s blood samples and 18 pesisir blood samples. Amplification of COI gene segment used Polymerase Chain Reaction technique. The forward primer sequence used in this study was F’5 TTCTCAACCAACCATAAAGATATTGG-3’ and the reverse primer sequence used was reverse 5’-TAGACTTCGGGGTGTCCAAAGAATCA-3. It squeezed kuantan and pesisir sequence 5711 - 6420 base (GeneBank accession number NC_005971) with length by 710 bp. Analysis result of sequence using MEGA 5.2 Program showed that there were 6 polymorphic sites establishing 7 haplotypes on kuantan cattle and 9 polymorphic sites establishing 12 haplotypes on pesisir cattle. Based on genetic distance and phylogeney tree, kuantan and pesisir cattle were in same group with &lt;em&gt;Bos indicus&lt;/em&gt;. Mutation in the COI gene segment in this study was too small and was not able to distinguish the difference of those breeds. The result of neighbor joining analyze indicated that kuantan cattle origin was from &lt;em&gt;Bos indicus&lt;/em&gt; just like pesisir cattle.&lt;/p&gt;&lt;strong&gt;Key Words: &lt;/strong&gt;COI Gene, Polymorphic, Kuantan Cattle, Genetic Distance, Phylogenetic Tree

The complete mitochondrial genome sequence of the Canada goose (Branta canadensis)

The Canada goose (Branta canadensis) entire mitochondrial genome of a bird from Western Pennsylvania has 16,760 bp (GenBank accession number NC 007011) and has been analyzed for gene locations, length, start codon and stop codons. This genome from a bird harvested during the non-migratory season is the REFSEQ and the haplotype is designated GCC-A. There are two rRNAs, 22 tRNAs, 13 protein-coding regions, and 1 displacement loop region. The base composition of mtDNA was A (30.2%), G (15.1%), C (32.1%), and T (22.6%), so the percentage of A and T (52.8%) was slightly higher than G and C. All genes except ND6 and eight tRNA genes (Gln, Ala, Asn, Cys, Tyr, Ser, Pro and Glu) are encoded on the heavy strand. The gene arrangement is the same as most birds and differs from mammals by an inversion of the mtDNA at the connection between the D-loop and the ND5 junctions.

Genetic Polymorphisms in CYP2E1: Association with Schizophrenia Susceptibility and Risperidone Response in the Chinese Han Population

BackgroundCYP2E1 is a member of the cytochrome P450 superfamily, which is involved in the metabolism and activation of both endobiotics and xenobiotics. The genetic polymorphisms of CYP2E1 gene (Chromosome 10q26.3, Accession Number NC_000010.10) are reported to be related to the development of several mental diseases and to be involved in the clinical efficacy of some psychiatric medications. We investigated the possible association of CYP2E1 polymorphisms with susceptibility to schizophrenia in the Chinese Han Population as well as the relationship with response to risperidone in schizophrenia patients.MethodsIn a case-control study, we identified 11 polymorphisms in the 5' flanking region of CYP2E1 in 228 schizophrenia patients and 384 healthy controls of Chinese Han origin. From among the cases, we chose 130 patients who had undergone 8 weeks of risperidone monotherapy to examine the relationship between their response to risperidone and CYP2E1 polymorphisms. Clinical efficacy was assessed using the Brief Psychiatric Rating Scale (BPRS).ResultsStatistically significant differences in allele or genotype frequencies were found between cases and controls at rs8192766 (genotype p = 0.0048, permutation p = 0.0483) and rs2070673 (allele: p = 0.0018, permutation p = 0.0199, OR = 1.4528 95%CI = 1.1487–1.8374; genotype: p = 0.0020, permutation p = 0.0225). In addition, a GTCAC haplotype containing 5 SNPs (rs3813867, rs2031920, rs2031921, rs3813870 and rs2031922) was observed to be significantly associated with schizophrenia (p = 7.47E-12, permutation p<0.0001). However, no association was found between CYP2E1 polymorphisms/haplotypes and risperidone response.ConclusionsOur results suggest that CYP2E1 may be a potential risk gene for schizophrenia in the Chinese Han population. However, polymorphisms of the CYP2E1 gene may not contribute significantly to individual differences in the therapeutic efficacy of risperidone. Further studies in larger groups are warranted to confirm our results.