Abnormal MRI Findings Research Articles

Postoperative MR evaluation of chondral repair in the knee

Articular cartilage abnormalities of the knee are a cause of significant patient morbidity. Several surgical techniques have been developed to treat these lesions to improve patient symptoms and to delay or prevent the development of osteoarthritis. MRI has been shown to be an accurate non-invasive test for the evaluation of articular cartilage injuries and for evaluating the postoperative knee following chondral repair. As these surgical repair techniques become more commonly performed, is important for radiologists to be familiar with the surgical techniques and the MRI appearance of the postoperative knee including both normal and abnormal findings. In this article, these chondral repair techniques will be reviewed as well those normal and abnormal MRI findings following these surgeries.

Glutaric aciduria type I: Outcome in the Republic of Ireland

Twenty-one patients have been diagnosed with glutaric aciduria type I over a 16-year period in the Republic of Ireland, 11 following clinical presentation and 10 following a high-risk screen. Nineteen have been managed with diet. Eight patients have died, of whom 7 were diagnosed clinically. Six had dystonic and one spastic cerebral palsy. Of the 11 patients who did not have cerebral palsy, 10 were diagnosed following a high-risk screen. Seven of the 11 have no abnormal neurological signs; 6 of the 7 have abnormal CT or MRI findings; and no case of striatal degeneration has occurred during the past 14 years in the high-risk screened group.

MRI of temporal bone: Clinical significance of incidental abnormality in a non-ENT group

Objectives: The purposes of this study are to determine the prevalence of abnormalities in the mastoid cavity and middle ear in a non-ENT population and to correlate with clinical data. Methods: Cross-sectional study. We prospectively evaluated a total of 100 adults and 30 children undergoing MRI scan for suspected intracranial pathology from May to July 2003. Patients who had a history of mastoid/middle ear surgery and were suffering otitis media were excluded. The T2-weighted images were reviewed. The abnormalities found on MRI were divided into (1) mastoid cavity abnormality and (2) middle ear abnormality. All patients were asked to complete a questionnaire pertaining to symptoms of mastoid/middle ear pathology and history of previous otitis media. Also their ears were examined carefully by otoscope or otomicroscope. Results: In both groups, most of abnormalities were found in the mastoid cavity. Analysis of the clinical data revealed that abnormal MRI findings of the mastoid cavity were significantly correlated to clinically significant mastoid/middle ear disease in adults. Conclusion: Incidental MRI abnormalities in mastoid cavity and middle ear detected in a non-ENT population were relatively uncommon, compared to incidental paranasal sinus abnormalities. However, clinicians should remember the possibility of the pathologies that demand active treatment among these abnormalities, especially when high signal abnormality is found in the mastoid cavity of adult.

Follow-up MRI study of prefrontal volumes in first-episode psychotic patients

Structural MRI findings of abnormalities in the prefrontal cortex in schizophrenia and affective disorder have been inconsistent likely due to small, heterogeneous samples, the evaluation of prefrontal gray and white matter combined, and the fact that prefrontal cortex is typically not delineated into separate gyri (e.g., Shenton et al., 2001; Strakowski et al., 2002). We previously reported smaller prefrontal gray matter in first-episode schizophrenia relative to first-episode affective psychosis and controls (Hirayasu et al., 2001). One unresolved question in the literature is whether or not further volume reduction will be observed over time, the focus of this report. Prefrontal gray and white matter volumes were measured (see Fig. 1) in patients at the time of first hospitalization for schizophrenia (n=12, 3 females) or affective psychosis (n=10, 1 female, 9 bipolar, 1 unipolar), and psychiatrically well subjects (n=15, 1 female). Subjects were rescanned approximately 1.5 years later. Seven schizophrenia, six affective, and four comparison subjects were previously described solely at first scan (Hirayasu et al., 2001). Samples did not differ in age (28.1±8.4; 22.9±2.8; 25.4±4.5; F(2,34)=2.2, p=0.12) or WAIS Information scores (11.8±3.4; 12.2±3.1, 11.8±2.0; F(2.32)=0.6, p=0.9), nor in parental socioeconomic status (F(2.34)=2.32, p=0.11) or handedness (F(2.33)=1.6, p=0.22). BPRS scores were higher in schizophrenics (41.2±13.2) than affectives (33.8±8.0) (F(1,20)=5.71, p=0.027). Similar neuroleptics were prescribed for the patient groups (schizophrenics: 7 typical, 4 atypical, 1 none; affectives: 6 typical, 3 atypical, 1 none). Fig. 1 Prefrontal ROI definitions and volumes. (a) Coronal slice, (b) axial slice showing prefrontal gray and white matter, and (c) three. Three-dimensional reconstruction of the extent of gray and white matter boundaries. MR images were acquired with a 1.5-T ... Relative volumes [i.e., absolute volumes divided by intracranial contents (ICC)] were used in the analyses. Repeated-measures ANOVA was performed with diagnosis as the between-subjects factor and time and side as the within-subjects factors for gray and white matter separately. Prefrontal gray matter at time 1 was significantly different among groups (F2,30=5.56, p=0.009), with schizophrenics smaller than controls and affectives, who did not differ from each other. There was no interaction for group by time by side for prefrontal gray matter (F2,34=0.65, p=0.53). All groups showed larger gray matter on the left (F2,30=8.72, p=0.006). White matter volumes did not differ among groups (p>0.87), and all groups showed more white matter on the right (F1,30=39.20, p<0.001) and a reduction over time (F1,30=10.902, p=0.002), there was a trend for this effect to be larger on the right (F1,30=3.14, p=0.086) (%change over time for right white matter: schizophrenics 2.8%; affectives 6.5%; controls 2.1%). Neither removing the unipolar depression subject nor removing the females altered the results. There was no significant correlation between ROI volume change and medication dosage at time 1 for either patient group (Time 2 data came from out patients based on self-report and was for this reason not used). These data suggest that prefrontal cortical gray matter is selectively smaller at first hospitalization for schizophrenia relative to affective psychosis and controls, but this volume difference did not change over the relatively short post-first hospitalization time examined. Small gray matter volumes may be due to reduced dendritic arborization or increased neural density in prefrontal cortex in schizophrenia (Benes et al., 1992; Selemon et al., 1998). White matter, which was not different among groups, showed a decline with time in all groups, possibly consistent with normal aging (Good et al., 2001, although Bartzokis et al., 2001). Potential reasons for our not observing selective gray matter reductions point to several limitations of this study including the gender distribution, as females may have greater dorsolateral and orbitofrontal lobe involvement and males greater dorsomedial changes in schizophrenia (Gur et al., 2000); the use of large ROI, as sub-regions within the prefrontal cortex may change in volume at different rates (Gur et al., 1998; DeLisi et al., 1997); and lack of exact medication dosages and compliance histories during the intrascan interval cannot be ruled out as possible confounds. Although the sample size was small, the effect size was also small (Fig. 1) suggesting that even enlarging the sample would not result in a significant change in volume over time for either gray or white matter.

Outcomes of systematic screening for optic pathway tumors in children with Neurofibromatosis Type 1.

Optic pathway tumors (OPT) occur in about 15% of individuals with Neurofibromatosis Type 1 (NF1) and may effect substantial visual loss. Because their growth is not predictable at the time of discovery, neuroimaging for OPT in asymptomatic NF1 patients remains controversial. We evaluated the outcomes of systematic screening by both MRI and ophthalmic examinations for OPT in young children with NF1 seen at multi-disciplinary clinics for Neurofibromatosis and Genetics at one institution between 1996 and 2001. We report on 84 children who presented with NF1 under age 6 years, of whom 13 children presented with either known OPT or abnormal MRI findings and 11 children had OPTs identified by neuroimaging, including two children with abnormal eye examinations at presentation (one with strabismus and one with optic atrophy). Nine OPTs were detected in asymptomatic subjects with normal ophthalmic examinations. Three children with chiasmal lesions enlarging on subsequent MRI were treated with carboplatin and vincristine. After treatment, the vision in each involved eye was intact. In contrast, the 13 children with OPT diagnosed outside of screening guidelines included five children with substantial visual loss. Our observations suggest that early recognition of NF1 promotes appropriate surveillance and allows early intervention to reduce complications of OPT. This analysis supports prospective studies to compare the outcomes of systematic screening with neuroimaging to screening with ophthalmic examinations alone in children with NF1.

Quantitative PCR Analysis of Mitochondrial DNA Content in Patients with Mitochondrial Disease

Abstract: Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real‐time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5′TTACCGGGCTCTGCCATCT3′‐TAMRA and VIC‐5′AGCAATAACAGGTCTGTGATG3′‐TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5‐20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age‐matched group, and about 10% of patients had muscle mtDNA levels 2‐ to 16‐fold higher than the mean of the age‐matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

Detection of cervical nerve root hypertrophy by ultrasonography in chronic inflammatory demyelinating polyradiculoneuropathy

Several studies have demonstrated abnormal MRI findings in chronic inflammatory demyelinating polyradiculoneuropathy (CIDP), especially hypertrophy and abnormal enhancement of spinal nerve roots, but there have been few reports on ultrasonographic findings of spinal nerve roots in CIDP. To determine whether ultrasonography (US) enables detection of hypertrophy of the cervical nerve roots, how frequently hypertrophy occurs in CIDP, and whether US findings correlate with any clinical and laboratory features, US of cervical nerve roots was performed using a 7.5-MHz linear-array transducer in 13 CIDP patients and 35 control subjects. A coronal oblique plane with a transducer placed on the lateral side of the neck was used to visualize the cervical nerve roots just after their point of exit from the cervical foramina, and their diameters were measured. US demonstrated hypertrophy of the cervical nerve roots in 9 (69%) of the 13 CIDP patients as compared with findings in control subjects. The degree of hypertrophy was significantly associated with the level of CSF protein ( χ 2=5.8, p<0.05, logistic simple regression analysis) but not with other clinical features. US is considered to be a useful method for evaluating cervical nerve root hypertrophy, which is frequently seen in patients with CIDP, particularly in patients with elevated level of CSF protein.

Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease.

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

MRI findings in central nervous system systemic lupus erythematosus are associated with immunoserological parameters and hypertension.

Involvement of the brain is one of the most important complications of systemic lupus erythematosus (SLE). To investigate the correlation between abnormal cranial MRI findings and age, duration of SLE, neuropsychiatric (NP) manifestations, hypertensive status, and the presence of antiphospholipid antibodies (PA) in patients with SLE we evaluated the MRI results of 81 SLE patients in nine NP clinical subgroups.Immunoserological status was described by the presence of lupus anticoagulant (LA), and anticardiolipin antibodies (aCL). The MRI findings were categorized as normal [41], cerebral atrophy [15], small subcortical hyperintensity [7], and infarct larger than 10mm [18]. Mean age differed among the clinical subgroups (ANOVA, p = 0.002), whereas there was no age difference among the subgroups based on MRI and immunoserological results. Patients with hypertension (33/81) were a mean of 6 years older at the time of examination (p = 0.033) and had stroke more frequently, than normotensive ones (p = 0.0015). MRI abnormalities were more frequent in patients with LA positivity (p < 0.01) than in those without these antibodies, and in the hypertensive than in the normotensive subgroup (p = 0.00041). The presence of PA was associated with abnormal MRI even after controlling for the effect of age and hypertensive status (p = 0.011). In our study the MRI findings in central nervous system SLE were independent of the age of patients and the age at the diagnosis of SLE, and were not influenced by the duration of SLE; however, they were associated with immunoserological parameters and hypertension.

Degree of Hypomyelination and Magnetic Resonance Spectroscopy Findings in Patients with Pelizaeus Merzbacher Phenotype

As only 10 - 30 % of patients with a Pelizaeus Merzbacher disease (PMD) phenotype carry mutations of the proteolipid protein (PLP) gene, we were interested if the degree and time-dependent progression of abnormal MRI and MRS findings would discriminate patients with mutations of the PLP gene (Pelizaeus Merzbacher disease, PMD) from patients without a defect of the PLP gene (Pelizaeus Merzbacher-like disease, PMLD). For a standardised intraindividual follow-up and for comparison of the degree of hypomyelination, we have applied a newly developed semiquantitative myelination score on a total of 18 MRI series of 4 PMD and 4 PMLD patients. We found severe hypomyelination (< 50 % of normal) in 2 PMD and in 2 PMLD patients, moderate hypomyelination (< 75 % of normal) in 2 PMD and mild hypomyelination (> 75 % of normal) in 2 PMLD patients. Our score revealed a clear correlation between the degree of hypomyelination and the severity of clinical handicap in PMD but not in PMLD patients. MRS showed heterogeneous cerebral metabolite patterns in both patient groups and seems to reflect a mixture of unspecific changes due to primary hypomyelination and secondary gliosis and demyelination. Neither by MRI nor by MRS were patterns found that would allow differentiation between PMD and PMLD patients.

Hypothermia Reduces Neurological Damage in Asphyxiated Newborn Infants

Background: Perinatal asphyxia remains one of the most devastating neurologic processes. There is experimental and clinical evidence that cerebral cooling may suppress the biochemical cascades leading to delayed cerebral damage. Objective: To determine if hypothermia started soon after delivery reduces cerebral damage in term infants. Design/Methods: Retrospective chart analysis with historical controls. Ten asphyxiated newborns treated with hypothermia between October 1998 and October 1999 were compared to 11 asphyxiated newborns admitted from September 1997 to September 1998. Characteristics at birth of infants of the two groups (control and hypothermia) were comparable. After obtaining parental consent, whole-body hypothermia was induced before the 6th hour of life by placing a cold blanket (Polar Air, Augustine Medical Inc., model 600) around the body of the patients. Rectal temperature was maintained between 32 and 34°C for 72 h. Outcome was assessed by neurological evaluation at birth and every 3 months up to the 12th month. Brain MRI was performed in the 2nd month. We had no evidence of severe adverse events related to hypothermia. In the hypothermic group there was a significant (p < 0.05) reduction of major neurologic abnormalities at follow-up and abnormal MRI findings. Conclusions: Hypothermia appears to be safe. Our results on morphological damage evaluated by brain MRI and neurological outcome are encouraging: randomized controlled trials are needed to confirm this experience.

Tongue atrophy in facioscapulohumeral muscular dystrophy.

Involvement of the lingual muscle is considered one of the exclusion criteria of facioscapulohumeral muscular dystrophy (FSHD). In a series of 151 Japanese patients with 4q35-FSHD, seven patients (4.6%) had tongue atrophy with abnormal MRI findings and typical myogenic patterns of electromyography. All seven patients belong to a group of early-onset FSHD with large gene deletions on chromosome 4q35. Our result suggests that the patients with 4q35-FSHD could have myopathic tongue atrophy.

Comparison of MRI and MRA findings in children with a variety of neurologic conditions

The role of MRA in the evaluation of children is evolving. We compared MRA and MRI in children with a variety of neurologic conditions to determine when MRA provides positive, cost-beneficial information. A total of 114 patients were retrospectively studied. MRA and MRI were performed and compared. MRA was abnormal in 34 (30%) of 114 patients: five (83%) of six with Menkes’ disease, four (33%) of 12 with sickle cell disease, 12 (38%) of 32 with vascular malformations, one (6%) of 17 with headaches, seven (24%) of 24 with new focal deficits, one (10%) of 10 with seizures, and four (31%) of 13 with miscellaneous diagnoses. MRA and MRI were concordant in 73 (64%) of 114. Maximum concordance was in patients with Menkes’ disease (100%) and minimum in those with new focal deficits (50%). The best MRA cost/benefit ratios were obtained in patients with Menkes’ disease, vascular malformations, and sickle cell disease. A normal MRI usually forecasted a normal MRA. However, abnormal MRI findings did not always predict MRA abnormalities. Positive, cost-beneficial information is provided by MRA mostly in conditions known to involve the cerebral vasculature. Indications to perform MRA should be based on the neurologic diagnosis and MRI findings.

Can cerebral MRI at age 1 year predict motor and intellectual outcomes in very‐low‐birth weight children?

This follow-up study reports on cerebral MRI findings in 20 very-low-birthweight (VLBW) infants without disabilities at age 1 year in relation to motor, intellectual, and perceptual function at age 6 years. MRI findings, anthropometrics, and Bayley Scales of Infant Development scores at age 1 year as predictors of psychomotor status at age 6 years are also evaluated and compared. Outcome parameters were the Peabody Developmental Motor Scales and the Wechsler Preschool and Primary Scale of Intelligence. The results show that infants with myelin hyperintensities including the centrum semiovale or with occipital hyperintensities with associated ventricular dilatation at age 1 scored lower on the Peabody Gross Motor Locomotion Scale at age 6 than infants with normal myelination or with isolated occipital hyperintensities. This may indicate damage to motor fibers caused by perinatal periventricular leukomalacia. No relation was found between abnormal MRI findings at age 1 and later fine motor, intellectual, and perceptual function. Comparing different age 1-year predictors, an abnormality score defined by MRI was used as an independent predictor of gross motor locomotion function at age 6 years. However, the Bayley Mental Development Index scores and weight at age 1 were more important predictors of later motor and intellectual outcome, respectively, than MRI findings. It is recommended that cerebral MRI should not be used routinely to examine VLBW infants without disabilities at 1 year of age.

平衡機能検査とＭＲ検査との関係

We often encounter patients with isolated vertigo in which the origin cannot be determined. MR testing for this condition has gained widespread use because of the ease with which it detects ischemia in comparison to that on CT. However, it has remained uncertain whether abnormal imaging findings do indeed reflect clinical morbidity. This study investigated the usefulness of MR imaging and ENG for vertebrobasilar circulation disorder and brainstem dyscirculation.Of 157 cases of vertigo, OKP (ENG) findings were abnormal in 59 cases (38%) and ETT (ENG) was abnormal in 79 cases (50%). Abnormal MRI findings were observed in 45 cases (29%) and abnormal MRA findings were seen in 111 cases (71%). x2 test demonstrated a significant relationship between the MRI and OKP or ETT findings and also between the MRA and OKP or ETT findings.We conclude that an infarction and high intensity signal in thee, pons and cerebellum were definite morbid findings ; we also recognize a side-to-side difference in the vertebral artery to indicate ischemia or infarction of the lower pons. We confirmed the utility of MR testing in diagnosis and follow up of head and neck ischemic disease as well as the importance of equilibrium examination.

Bilateral acute optic neuritis: prospective clinical, MRI, CSF, neurophysiological and HLA findings

This paper presents the clinical picture and the results of a battery of tests performed in a prospective study of 30 patients (aged 15-53 years; 14 females) consecutively referred during a six-and-a-half-year period and suffering from bilateral acute optic neuritis (BAON) according to clinical criteria. Both eyes were affected within a time span of six weeks. Ten patients showed papillitis in one or both eyes. Causes of BAON other than clinically definite multiple sclerosis (CDMS), present in 12 patients, were carefully ruled out and all relevant blood tests were normal, having excluded two patients with Leber's optic neuropathy. Tissue typing showed HLA-DR15 in 12 patients. The proportion of abnormal results at onset was 14/27=52% (cerebral MRI), 23/30=77% (VEP), 11/27=41% (SEP), 10/24= 42% (biotesiometry), 8/20=40% (CSF oligoclonal bands), 10/26=38% (IgG-index), and 9/25=36% (CSF leukocyte count). One year from onset, 24 patients were reexamined; another two patients were followed clinically and with VEP only. Abnormal results were observed by MRI in 13/21=62%, by VEP in 21/26=81%, by SEP in 6/23=26%, and by biotesiometry in 9/24=38%. Five patients had developed CDMS. The visual acuity improved in one or both eyes in 19, remained unchanged in four, and deteriorated in three patients. The frequency of abnormal VEP, IgG-index, and oligoclonal bands was significantly lower in idiopathic cases than in patients with CDMS. Abnormal results tended to be less frequent when symptoms occurred simultaneously (n=15), suggesting simultaneous BAON to be more rarely a part of MS. Bilateral idiopathic cases seemed to show abnormal CSF, MRI, and VEP findings less frequently than unilateral cases.

Multiple system atrophy presenting as parkinsonism: clinical features and diagnostic criteria.

To evaluate the possibility that parkinsonian signs may be the only presenting feature of multiple system atrophy (MSA), parkinsonian patients were studied who had no atypical clinical signs and had no symptoms of autonomic dysfunction, but who reported that they had not experienced the anticipated good response to dopaminergic treatment. These stringent criteria identified 20 patients from a series of 298 consecutive parkinsonian outpatients. The following clinical pointers were analysed: (a) rate of disease progression; (b) symmetry of parkinsonian symptoms and signs; (c) occurrence of resting tremor during the first three years from onset. In addition, all patients underwent (d) acute and chronic challenge with dopaminergic drugs; (e) cardiovascular reflex autonomic function tests; (f) high field MRI. Rapid progression of disease was seen in 45% of patients, onset was symmetric in 25%, tremor was absent at onset in 70%, response to dopaminergic drug challenges was inadequate in 40%, abnormal cardiovascular reflexes occurred in 50%, and some abnormal MRI finding occurred in 35% of cases. Each of these features was equally weighted by giving to each patient a 0 to 6 point score corresponding to the number of abnormal findings. Fifteen patients scoring higher than 1 were considered at risk for having MSA: five of them were classified as clinically possible (score 2), six as clinically probable (score 3-4), and four patients were classified as clinically definite multiple system atrophy (score 5). The six pointers considered were variably combined in each patient, none of them being universally abnormal in patients with high scores. The patients were followed up for a mean 2.1 (SEM 0.65) years. All but one of the 10 patients prospectively classified as probable or definite MSA developed unequivocal clinical signs of fully symptomatic MSA. A receiver operator characteristic cure was plotted for the prospective score based on follow up diagnosis. The best compromise for trade off between sensitivity and specificity was a cut off value at a score of 3. The sensitivity and specificity of the individual pointers considered to predict fully symptomatic MSA varied considerably, and no single item could predict whether patients presenting with just parkinsonian signs went on during the two year follow up period to develop fully symptomatic MSA. Instead, the number of abnormalities offered a predictive value for the clinical prognosis of these parkinsonian patients.

脊椎管外病変の病態と手術的治療について

In patients with a degenerative lumbar spine, stenosis can occur, not only at the entrance zone but also at the mid and exit zones of the nerve root canal. Symptoms of degenerative lumbar stenosis relate to two types, due to either caudal or root involvement. Extracanal (mid and exit zone) lesions are an important cause of failed back surgery. Patients suffering from root symptoms may have an extra-canalicular lesion, especially in senile patients.We classified stenotic lesions in the degenerative lumbar spine from the viewpoint of extra-canalicular lesions. We diagnosed stenosis from abnormal MRI findings and selective radiculography. Stenotic lesions were classified into three groups; extra-canalicular only, intra- and extra-canalicular, and migrated hernia. The second group of both intra- and extra-canalicular was further classified into three types. Double crush, defined as one root with two lesions at two disc levels; Double root, defined as two roots involved at one disc level and a combined type.We treated 31 patients surgically according to that classification. Twenty eight patients achieved pain relief after the operations, but 3 patients operated on twice complained of residual leg pain. Osteoplastic facet laminectomy was a useful procedure for exposing the extracanal region and provided a good operative field and safe decompressive method.

White Matter MRI Hyperintensities in a Hundred and Twenty-Nine Consecutive Migraine Patients

The most frequently reported abnormal MRI finding in migraine is the presence of high signal white matter foci (WMF) on long TR images. Recently, WMF have been distinguished in periventricular WMF (PVF), when contiguous to ventricles, and deep WMF (DF), when far from these. DF, but not PVF, appear positively correlated with cerebrovascular risk factors and are called leukoaraiosis. In this study the MRI examination was performed in 129 consecutive migraine patients (83 of them had migraine without aura and 46 migraine with aura). In 19.3% of the migraineurs studied we observed WMF on T2 weighted images strictly localized in the deep white matter (DF). No PVF were observed. These findings were independent of the type of migraine and did not correlate with age, sex, disease duration, or frequency of attacks. The presence in a subgroup of migraineurs of leukoaraiosis (DF), for which a vascular genesis has been hypothesized, suggests that migraine could represent, a cerebrovascular risk factor in these patients.

Imaging study on the mode of development and changes in avascular necrosis of the femoral head in systemic lupus erythematosus: long-term observations.

To find out when and how avascular necrosis of the femoral head (ANFH) develops in patients with SLE who are receiving corticosteroids, we carried out a 3-yr prospective study using imaging methods. Twenty-three patients with SLE who were free of hip pain and radiographically negative were enrolled in the study. Initially, abnormal findings characteristic of ANFH were detected in eight (35%) and six (26%) patients on MRI and radionuclide uptake bone scanning, respectively. During a 3-yr observation period abnormalities on MRI, bone scanning and radiography were found in four, five and four patients, respectively and three patients developed hip pain. Analyses of imaging changes demonstrated that only a small proportion of patients (2/8, 25%) who initially showed abnormal MRI progressed to be radiographically positive for ANFH over the 3 years. High doses of corticosteroids over the 3-yr period were to be responsible for the emergence of change in MRI abnormalities. It is also suggested that abnormal MRI findings tend to develop either within a relatively short interval after the start of corticosteroid treatment or are associated with the exacerbation of SLE.